Intracerebral injection hydrogel for delaying MCI progress and slowly releasing virus plasmids

Abstract

The invention relates to a composite drug delivery system for treating Alzheimer's disease. Specifically, the invention provides a composite drug delivery system which comprises plasmids and hydrogel loaded with the plasmids, and the plasmids comprise plasmids serving as active ingredients; the hydrogel is formed by mixing chitosan, sodium beta-glycerophosphate, sodium hydroxyethyl cellulose and hyaluronic acid; a nucleotide sequence for expressing a protein sequence for treating the Alzheimer's disease is integrated in the plasmid, and the sequence is as shown in SEQ ID NO: 4. The composite drug delivery system disclosed by the invention can penetrate through a blood brain barrier and has a slow release effect.

Description

Technical Field

[0001] The invention relates to the field of biomedicine, and in particular to an intracerebral injection hydrogel capable of delaying the progression of MCI and slowly releasing viral plasmids. Background Art

[0002] AD is a chronic progressive neurodegenerative disease characterized by extracellular Aβ deposition, intracellular hyperphosphorylated tau protein and neurofibrillary tangles (NFTs), and progressive and irreversible memory impairment and other advanced cognitive impairment as the main clinical manifestations.

[0003] Once AD ​​occurs, it gradually progresses. There is currently no effective treatment, which places a serious economic burden on society and families. Therefore, it is particularly important to prevent the occurrence of AD. Can we detect and treat it early? In fact, we can. The stage before AD occurs is mainly manifested as mild cognitive impairment (MCI), that is, mild neurocognitive disorder, with mild impairment of memory or certain cognitive functions, which does not affect daily living ability. It is a state of cognitive damage between normal aging and dementia.

[0004] Therefore, if intervention can be carried out at the MCI stage to delay or even prevent the progression to AD, the incidence of AD can be greatly reduced.

[0005] Through previous studies, researchers have found that the key mechanism for the progression of MCI to AD is Aβ 1-42 The GSDMD pathway activates pyroptosis of astrocytes in the brain, which leads to the release of a large number of inflammatory factors, such as IL-1β and IL-18. The inflammatory factors then activate vascular endothelial cells, leading to the release of a large number of vasoconstrictor substances and increased blood pressure. Hypertension itself is one of the risk factors for AD. The interaction between the two forms a vicious cycle and accelerates the progression to AD. Researchers have been trying various methods to deliver drugs or genes to brain tissue. However, since the blood-brain barrier is a barrier between blood and brain tissue, it can prevent certain substances from entering brain tissue from the blood, such as pathogens and bacteria. At the same time, this barrier also prevents drugs from effectively passing through the barrier to enter the brain, which seriously limits the treatment effect of central nervous system diseases.

[0006] Therefore, there is an urgent need in the art for a drug capable of sustained-release of GSDMD. Summary of the invention

[0007] The purpose of the present invention is to provide an intracerebral injection hydrogel for delaying the progression of MCI and slowly releasing viral plasmids.

[0008] In a first aspect of the present invention, a composite drug delivery system is provided, comprising a plasmid and a hydrogel loaded with the plasmid.

[0009] wherein the plasmid includes a plasmid as an active ingredient;

[0010] The hydrogel is formed by mixing chitosan, sodium β-glycerophosphate, sodium hydroxyethyl cellulose and hyaluronic acid;

[0011] The plasmid is integrated with a nucleic acid sequence for expressing a protein sequence for treating Alzheimer's disease, and the sequence is shown in SEQ ID NO:4.

[0012] In another preferred embodiment, in the system, the mass ratio of plasmid to hydrogel is 1-100:100-10000000.

[0013] In another preferred embodiment, in the system, the mass ratio of plasmid to hydrogel is 1-50:1000-8000000.

[0014] In another preferred embodiment, the hydrogel comprises: 100-400 parts by weight of chitosan, 200-500 parts by weight of sodium β-glycerophosphate, 1-50 parts by weight of sodium hydroxyethyl cellulose, and 100-300 parts by weight of hyaluronic acid;

[0015] Preferably, the hydrogel comprises: 100-300 parts by weight of chitosan, 200-400 parts by weight of sodium β-glycerophosphate, 1-40 parts by weight of sodium hydroxyethyl cellulose, and 100-200 parts by weight of hyaluronic acid;

[0016] More preferably, the hydrogel comprises: 150-250 parts by weight of chitosan, 250-350 parts by weight of sodium β-glycerophosphate, 10-30 parts by weight of sodium hydroxyethyl cellulose and 120-180 parts by weight of hyaluronic acid.

[0017] In another preferred embodiment, the water content of the composite drug delivery system is ≥85%, preferably ≥90%, and more preferably ≥92%.

[0018] In another preferred embodiment, the internal structure of the composite drug delivery system is a three-dimensional porous network structure.

[0019] In another preferred embodiment, the composite drug delivery system has an elastic modulus of 100-200 Pa at an oscillation frequency of 100 rad / s.

[0020] In another preferred embodiment, the composite drug delivery system can pass through the blood-brain barrier.

[0021] In another preferred embodiment, the compound drug delivery system is prepared by the following method:

[0022] providing a first dispersion of the plasmid in deionized water;

[0023] Adding hyaluronic acid (HA) powder to the first dispersion to form a dispersion;

[0024] Adding sodium hydroxyethylcellulose (HEC) powder to the second dispersion to form a third dispersion;

[0025] Adding chitosan (CS) powder to the third dispersion to form a fourth dispersion;

[0026] An aqueous solution of sodium β-glycerophosphate is added to the fourth dispersion and mixed evenly to obtain the composite drug delivery system.

[0027] In another preferred embodiment, the concentration of the plasmid in the first dispersion is 1-3 ug / ml.

[0028] In another preferred embodiment, in the first dispersion, the weight ratio of hyaluronic acid to plasmid is 130000-150000:10-20.

[0029] In another preferred embodiment, in the second dispersion, the weight ratio of hyaluronic acid to sodium hydroxyethyl cellulose is 5-10:1.

[0030] In another preferred embodiment, in the third dispersion, the weight ratio of hyaluronic acid to chitosan is 5-10:5-15.

[0031] In another preferred embodiment, in the fourth dispersion, the weight ratio of hyaluronic acid to sodium β-glycerophosphate is 5-10:20-40.

[0032] In another preferred embodiment, the gelation time of the hydrogel is ≤10 min.

[0033] In another preferred embodiment, the water content of the hydrogel is ≥90wt%.

[0034] In another preferred embodiment, the hydrogel is immersed in artificial cerebrospinal fluid at 37° C. for 28 days, and the weight difference before and after immersion is calculated. The mass of the remaining hydrogel is 60%-80% of the original mass.

[0035] The second aspect of the present invention provides the use of the composite drug delivery system as described in the first aspect of the present invention for preparing a preparation, a drug or a pharmaceutical composition; the preparation, drug or pharmaceutical composition is used to treat Alzheimer's disease and / or mild cognitive impairment.

[0036] In another preferred embodiment, the preparation, medicine or pharmaceutical composition is also used for a purpose selected from the following group:

[0037] (a1) Reduce brain cell pyroptosis;

[0038] (a2) Reduce the expression of IL-1β and IL-18 in brain tissue;

[0039] (a3) Reduce the expression of P-tau.

[0040] The third aspect of the present invention provides a preparation comprising the composite drug delivery system as described in the first aspect of the present invention.

[0041] In another preferred embodiment, the concentration of the plasmid in the preparation is 0.5-10 ug / ul, preferably 1-5 ug / ul, and more preferably 1-3 ug / ul.

[0042] In a fourth aspect, the present invention provides a method for preparing the composite drug delivery system according to the first aspect of the present invention, comprising the steps of:

[0043] (s1) providing plasmid, chitosan, sodium hydroxyethylcellulose and hyaluronic acid;

[0044] (s2) mixing the plasmid, chitosan, sodium hydroxyethyl cellulose and hyaluronic acid to obtain a first solution;

[0045] (s3) slowly adding the above-mentioned sodium β-glycerophosphate to the first solution and mixing well to obtain the composite drug delivery system;

[0046] Wherein, the plasmid is as described in the first aspect of the present invention;

[0047] The hydrogel material is selected from the group consisting of chitosan, sodium β-glycerophosphate, sodium hydroxyethylcellulose and hyaluronic acid.

[0048] In another preferred embodiment, the plasmid includes a GSDMD suppression plasmid.

[0049] In another preferred embodiment, the weight portions of chitosan, sodium β-glycerophosphate, sodium hydroxyethyl cellulose and hyaluronic acid are 100-400 parts, 200-500 parts, 1-50 parts and 100-300 parts respectively, preferably 100-300 parts, 200-400 parts, 1-40 parts and 100-200 parts, more preferably 150-250 parts, 250-350 parts, 10-30 parts, 120-180 parts.

[0050] In another preferred embodiment, the mass ratio of the plasmid for treating AD to the hydrogel material is 1-100:100-1,000,000, preferably 1-50:1,000-8,000,000, and more preferably 1-30:10,000-8,000,000.

[0051] In another preferred embodiment, the compound drug delivery system is prepared by the following method:

[0052] providing a first dispersion of the plasmid in deionized water;

[0053] Adding hyaluronic acid (HA) powder to the first dispersion to form a dispersion;

[0054] Adding sodium hydroxyethylcellulose (HEC) powder to the second dispersion to form a third dispersion;

[0055] Adding chitosan (CS) powder to the third dispersion to form a fourth dispersion;

[0056] An aqueous solution of sodium β-glycerophosphate is added to the fourth dispersion and mixed evenly to obtain the composite drug delivery system.

[0057] In another preferred embodiment, the concentration of the plasmid in the first dispersion is 1-3ug / ml; and / or

[0058] In the first dispersion, the weight ratio of hyaluronic acid to plasmid is 130000-150000:10-20;

[0059] In the second dispersion, the weight ratio of hyaluronic acid to sodium hydroxyethyl cellulose is 5-10:1;

[0060] In the third dispersion, the weight ratio of hyaluronic acid to chitosan is 5-10:5-15;

[0061] In the fourth dispersion, the weight ratio of hyaluronic acid to sodium β-glycerophosphate is 5-10:20-40.

[0062] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 A plasmid map of the GSDMD plasmid is shown.

[0064] Figure 2 A graph showing the hydrogel retention results is shown.

[0065] Figure 3 A graph showing the expression results of GSDMD in mouse brain.

[0066] Figure 4 The graph shows the expression results of IL-1β and IL-18 in mouse brain.

[0067] Figure 5A diagram of the mouse water maze experiment path is shown.

[0068] Figure 6 The results of the expression of AD-related indicators in the mouse brain are shown in the figure. DETAILED DESCRIPTION

[0069] After extensive and in-depth research, a large number of experiments and screening, the inventor unexpectedly discovered for the first time a composite drug delivery system, including a plasmid and a hydrogel loaded with the plasmid, wherein the plasmid includes a plasmid as an active ingredient; the hydrogel is formed by mixing chitosan, sodium β-glycerophosphate, sodium hydroxyethyl cellulose and hyaluronic acid; and the plasmid is integrated with a nucleic acid sequence for expressing a protein sequence for treating Alzheimer's disease, and the sequence is shown in SEQ ID NO: 4. The composite drug delivery system of the present invention can pass through the blood-brain barrier and can slowly release drugs for treating AD. The present invention was completed on this basis.

[0070] the term

[0071] In order to more easily understand the present invention, some technical and scientific terms are specifically defined below. Unless otherwise clearly defined in this article, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention belongs. Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions, because such methods and conditions can be changed. It should also be understood that the terms used herein are intended only to describe specific embodiments, and are not intended to be restrictive, and the scope of the present invention will be limited only by the appended claims.

[0072] As used herein, the term “comprise” or variations thereof such as “include” or “comprising”, etc., are understood to include the stated elements or components but do not exclude other elements or components.

[0073] Combined drug delivery system

[0074] The composite drug delivery system of the present invention comprises a plasmid and a hydrogel loaded with the plasmid.

[0075] wherein the plasmid includes a plasmid as an active ingredient;

[0076] The hydrogel is formed by mixing chitosan, sodium β-glycerophosphate, sodium hydroxyethyl cellulose and hyaluronic acid;

[0077] The plasmid is integrated with a nucleic acid sequence for expressing a protein sequence for treating Alzheimer's disease, and the sequence is shown in SEQ ID NO: 4. The composite drug delivery system of the present invention can pass through the blood-brain barrier, deliver the drug for treating AD to the brain, and slowly release the drug for treating AD.

[0078] In a preferred embodiment, in the system, the mass ratio of plasmid to hydrogel is 1-100:100-10000000, preferably 1-50:1000-8000000, more preferably 1-30:10000-8000000.

[0079] In a preferred embodiment, the hydrogel comprises: 100-400 parts by weight of chitosan, 200-500 parts by weight of sodium β-glycerophosphate, 1-50 parts by weight of sodium hydroxyethyl cellulose, and 100-300 parts by weight of hyaluronic acid;

[0080] Preferably, the hydrogel comprises: 100-300 parts by weight of chitosan, 200-400 parts by weight of sodium β-glycerophosphate, 1-40 parts by weight of sodium hydroxyethyl cellulose, and 100-200 parts by weight of hyaluronic acid;

[0081] More preferably, the hydrogel comprises: 150-250 parts by weight of chitosan, 250-350 parts by weight of sodium β-glycerophosphate, 10-30 parts by weight of sodium hydroxyethyl cellulose and 120-180 parts by weight of hyaluronic acid.

[0082] In a preferred embodiment, the water content of the composite drug delivery system is ≥85%, preferably ≥90%, and more preferably ≥92%.

[0083] In a preferred embodiment, the internal structure of the composite drug delivery system is a three-dimensional porous network structure.

[0084] In a preferred embodiment, the composite drug delivery system has an elastic modulus of 100-200 Pa at an oscillation frequency of 100 rad / s.

[0085] In a preferred embodiment, the composite drug delivery system can pass through the blood-brain barrier.

[0086] Preparation method of composite drug delivery system

[0087] In the present invention, the composite drug delivery system can be prepared by the following method:

[0088] providing a first dispersion of the plasmid in deionized water;

[0089] Adding hyaluronic acid (HA) powder to the first dispersion to form a dispersion;

[0090] Adding sodium hydroxyethylcellulose (HEC) powder to the second dispersion to form a third dispersion;

[0091] Adding chitosan (CS) powder to the third dispersion to form a fourth dispersion;

[0092] An aqueous solution of sodium β-glycerophosphate is added to the fourth dispersion and mixed evenly to obtain the composite drug delivery system.

[0093] In a preferred embodiment, the concentration of the plasmid in the first dispersion is 1-3ug / ml. In a preferred embodiment, the concentration of the plasmid in the first dispersion is 2ug / ml.

[0094] In a preferred embodiment, in the first dispersion, the weight ratio of hyaluronic acid to plasmid is 130000-150000:10-20. In a preferred embodiment, in the first dispersion, the weight ratio of hyaluronic acid to plasmid is 140000:16.

[0095] In a preferred embodiment, in the second dispersion, the weight ratio of hyaluronic acid to sodium hydroxyethyl cellulose is 5-10: 1. In a preferred embodiment, in the second dispersion, the weight ratio of hyaluronic acid to sodium hydroxyethyl cellulose is 7:1.

[0096] In a preferred embodiment, in the third dispersion, the weight ratio of hyaluronic acid to chitosan is 5-10:5-15. In a preferred embodiment, in the third dispersion, the weight ratio of hyaluronic acid to chitosan is 7:10.

[0097] In a preferred embodiment, in the fourth dispersion, the weight ratio of hyaluronic acid to sodium β-glycerophosphate is 5-10:20-40.

[0098] In a preferred embodiment, the gelation time of the hydrogel is ≤10 min.

[0099] In a preferred embodiment, the water content of the hydrogel is ≥90 wt%.

[0100] In a preferred embodiment, the hydrogel is immersed in artificial cerebrospinal fluid at 37° C. for 28 days, and the weight difference before and after immersion is calculated. The mass of the remaining hydrogel is 60%-80% of the original mass.

[0101] The main advantages of the present invention include:

[0102] (1) The combined drug delivery system of the present invention can cross the blood-brain barrier and deliver the active ingredients to the brain tissue.

[0103] (2) The composite drug delivery system of the present invention has a sustained release effect.

[0104] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0105] Material

[0106] CS: Chitosan (CS)

[0107] GP: β-glycerophosphate (GP)

[0108] HEC: Hydroxyethyl cellulose (HEC)

[0109] HA: hyaluronic acid (HA)

[0110] Inhibitory target sequence: ShRNA sequence: CAAGCTCATGGTTCTGGAAAC (SEQ ID NO: 1)

[0111] Control target sequence: Scramble sequence: AACTCAGATCAAGCTCTGGTG (SEQ ID NO: 2)

[0112] Mouse GSDMD mRNA sequence: Mus musculus gasdermin D (Gsdmd), mRNA, the specific sequence is as follows:

[0113] gtgtcctgccgcctgagttccgctcttggtcgtggctcccgttgctcccgggttgagcagacaatagacccctccccggcatcccagcaggtcctcgcttcgcttggtgg

[0114] acccagatacctcggcaggggtgaaaaatcgaggaccatgccatcggcctttgagaaagtggtcaagaatgtgatcaaggaggtaagcggcagcagaggcgatctc

[0115] attccggtggacagcctgcggaactccaccagcttcaggccctactgccttctgaacaggaaattttcaagctcaaggttctggaaaccccgttattcatgtgtcaacctg

[0116] tcaatcaaggacatcctggagcccagtgctccagaaccagaaccggagtgttttggctccttcaaagtctctgatgtcgtcgatgggaacattcagggcagagtgatgtt

[0117] gtcaggcatgggagaagggaaaatttctggtggggctgcagtgtctgacagttccagtgcctccatgaatgtgtgtatactgcgtgtgactcagaagacctgggagacc

[0118] atgcagcatgaaaggcaccttcagcagcctgagaacaaaatcctgcaacagcttcggagtcgtggggatgacctgtttgtggtgaccgaggtgctgcagacaaagga

[0119] ggaagtgcagatcactgaggtccacagccaagagggctcaggccagtttacgctgcctggagctttatgcttgaagggtgaaggcaagggccaccaaagccggaa

[0120] gaagatggtgaccattcctgcaggcagcatcctggcattccgagtggcccaactgcttattggctctaaatgggatatccttctcgtctcagatgagaaacagaggacctt

[0121] tgagccctcctcaggtgacagaaaagcagtgggccagaggcaccatggcctcaatgtgcttgctgcgctttgttccatcggaaagcagctcagtctcctgtcagatggg

[0122] attgatgaggaggaattaattgaggcggcagacttccagggcctgtatgctgaggtgaaggcttgctcctcagaactggagagcttggaaatggagttgagacaacag

[0123] atactggtgaacatcggaaagattttacaggaccagcccagcatggaagccttagaggcctcactagggcagggcctgtgcagtggcggccaggtggagcctctgg

[0124] acggcccagctggctgcatccttgagtgtctggtgcttgactctggagaactggtgccggaactcgcagcccctatcttctacctgctgggagcactggctgtgctgagt

[0125] gaaacccagcagcagctgctagctaaggctctggagacaacggtgctgtcaaagcagctggagttggtgaagcacgtcttggaacagagcaccccgtggcaggag

[0126] cagagttctgtgtccctgcccaccgtgctccttggggactgctgggatgaaaagaatcccacctgggtcttgctagaagaatgtggcctaaggctgcaggtagaatccc

[0127] cccaggtgcactgggaaccaacgtctctgatccccacaagtgcgctctatgcctccctgttcctattgtcaagtctaggccagaaaccttgttagcctgtgggcctccctt

[0128] cccacaacatctccatgtcctaccctccagccaaggtagaatcttgccaagcctagcctttgggaagccaagaaccatactcagtcacagggttataatgcactgagatccagaagttgggaaaactcaataaatgtacaaaggaaagc(SEQ ID NO:3)

[0129] The constructed inhibitory plasmid (Plko-GSDMD-shRNA) has the following sequence:

[0130] CGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGC

[0131] CACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGG

[0132] TGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGG

[0133] CGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACA

[0134] GATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTC

[0135] TCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAG

[0136] CGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCG

[0137] GCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCC

[0138] CGGTGCCTGACGCCCGCCCCACGACCCGCAGCGCCCGACCGAAAGGAGCGCACGACCCCATGCATC

[0139] GGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGG

[0140] GGACTGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTG

[0141] GTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAA

[0142] AGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCT

[0143] CAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTT

[0144] ATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTAC

[0145] AAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTT

[0146] GTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCATCCC

[0147] GCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGA

[0148] GGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGG

[0149] ACGTACCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGT

[0150] GACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCG

[0151] TAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGAC

[0152] GCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTG

[0153] CCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCC

[0154] GTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAA

[0155] AAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGAC

[0156] GTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGG

[0157] TCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAAC

[0158] AAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAAT

[0159] GTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATA

[0160] ACCCTGATAAATGCTTCAATAAT(SEQ ID NO:4)

[0161] Example 1 Preparation of GSDMD-containing hydrogel

[0162] The inhibitory plasmid (such as Figure 1 The above samples were dissolved in deionized water at a concentration of 2ug / ml.

[0163] Preparation of CS-HEC-HA / GP hydrogel: Preparation of CS-HEC-HA mixture: weigh 140 mg HA powder, dissolve it in 8 ml of 2 ug / ml GSDMD plasmid solution, then add 20 mg HEC powder, continue stirring until HEC is completely dissolved, add 200 mg CS powder to the mixed solution, stir evenly, add 1 ml of 1 mol / L hydrochloric acid solution, continue stirring until CS is completely dissolved, and store at 4°C for later use.

[0164] Preparation of 30% GP solution: Dissolve 300 mg of GP powder in 1 ml of distilled water using an ultrasonic oscillator and store at 4°C after complete dissolution.

[0165] 1 mL of 30% GP solution was slowly added dropwise to 9 mL of the above CS-HEC-HA solution under ice bath and stirring. After the addition was completed, stirring was continued for 10 minutes under ice bath to ensure uniform mixing. The mixture was then stored at 4°C.

[0166] The standards for qualified hydrogels are as follows:

[0167] 1. Gelation time: within 10 minutes;

[0168] 2. The water content is above 90%;

[0169] 3. It has good degradability. The hydrogel is immersed in artificial cerebrospinal fluid at 37℃ for 28 days. The weight difference before and after immersion is calculated. The mass of the remaining hydrogel is 60%-80% of the original mass.

[0170] 4. Scanning electron microscopy showed that the internal structure of the hydrogel showed a three-dimensional porous network structure;

[0171] 5. Test results of hydrogel elastic modulus: When the oscillation frequency is 100 rad / s, the elastic modulus needs to be maintained in the range of 100-200 Pa.

[0172] Comparative Example 1

[0173] In order to study the effect of the hydrogel system on plasmid delivery, the applicant prepared HAD hydrogel as a comparative example, and the preparation method is as follows:

[0174] The HAD precursor was made by grafting 3,4-dihydroxyphenylalanine (DA) and 2-aminoethyl methacrylate (AEMA) on the HA (hyaluronic acid) chain. DA and AEMA were used as wet binders and photocurable groups, respectively. Specific steps: 45 mg of HAD lyophilized powder (w / v) was dissolved in 1 mL of deionized water at a concentration of 4.5%. EDC (ethyl (dimethylaminopropyl) carbodiimide) (4 mmol), NHS (N-hydroxysuccinimide) (4 mmol) and AEMA were slowly added to the solution and stirred for 30 to 40 minutes. Subsequently, dopamine hydrochloride was added to the mixture for 24 hours. All solutions were kept under nitrogen protection and stored in the dark at room temperature to prevent oxidation. The pH value was monitored and adjusted between 5 and 6 with 0.1 mol / L hydrochloric acid and sodium hydroxide. After the reaction was completed, the unreacted monomers were removed by dialysis (MWCO = 8000 to 12000 Da) under acidic conditions for 72 hours, and then lyophilized. The freeze-dried extract foam was stored in a sealed container and protected from light until use. A solution with a concentration of 2ug / ml GSDMD plasmid was used to dissolve the HAD hydrogel powder, and the hydrogel was dissolved at 30mg / mL to obtain 3% HAD. Finally, HAD hydrogel containing GSDMD plasmid was obtained.

[0175] Example 2 Hydrogel retention experiment

[0176] After the gel is formed, the mass of the hydrogel is weighed and recorded as Wo, and then it is placed in artificial cerebrospinal fluid (ACSF) and immersed at a constant temperature of 37°C. On the 3rd, 7th, 14th, 21st, and 28th days, the hydrogel is taken out and the surrounding moisture is absorbed with filter paper. The mass of the hydrogel is recorded again as Wn, and the hydrogel mass retention rate L is calculated by the formula, L = (Wn / Wo) x 100%.

[0177] like Figure 2 As shown in the figure, through the detection of hydrogel retention rate, it can be seen that CS-HEC-HA / GP hydrogel has better swelling property than HA hydrogel, is stable within 14-28 days+, and degrades slower than HA hydrogel. After immersion for 28 days, the remaining weight of CS-HEC-HA / GP hydrogel is 80% of the original weight, while HA hydrogel has been degraded to 50%.

[0178] Example 3 Animal Experiment

[0179] 3.1 Animal model induction

[0180] APP / PS1+ / + mice (APP mice for short) with an average body weight of about 40 g were used. After the mice were raised for 7 months, a water maze test was used to screen mice with cognitive and memory dysfunction (simulating lesions in the human MCI stage) for the following experiment.

[0181] The experiment was divided into two groups, one group was injected with control hydrogel (Group A), and the other group was injected with experimental hydrogel (Group B).

[0182] The hydrogel was injected into the lateral ventricle. Before the injection, the mice were anesthetized by intraperitoneal injection of a sodium pentobarbital solution with a concentration of 20 mg / ml.

[0183] Take 5ul of the above gel solution and inject it into the lateral ventricle of the mouse for no less than 1min. After the injection, keep the needle in place for 10s, then slowly withdraw the needle and continue to culture the mice until they are 10 months old for testing.

[0184] 3.2 WB experiment to detect GSDMD expression in brain tissue

[0185] like Figure 3 As shown, brain tissues from the gray matter and white matter regions were taken to detect the expression of GSDMD. In the experimental group (Group B), the expression of GSDMD in brain tissue decreased in the intervention group, indicating that the plasmid continuously released by the hydrogel inhibited the expression of GSDMD, and also indicated that the number of pyroptotic brain cells decreased.

[0186] 3.3ELISA detection of IL-1β and IL-18 expression in brain tissue

[0187] like Figure 4 As shown, in the experimental group (Group B), the inflammatory factors IL-1β and IL-18 related to pyroptosis in the brain tissue were reduced, indicating that after the hydrogel injection in the experimental group, it played a role and inhibited the pyroptosis of astrocytes in the brain.

[0188] 3.4 Water maze test to detect memory impairment in mice

[0189] like Figure 5 The results showed that at the time of enrollment (before intervention), the two groups of mice had comparable water maze scores and both showed a certain learning ability, able to find the platform within 60 seconds; in follow-up after the intervention, after the hydrogel injection in the control group (Group B), the mice were still able to show a certain learning ability, while the experimental group (Group A) showed a decline in memory ability and were unable to find the platform within 60 seconds.

[0190] 3.5WB detection of AD related indicators

[0191] The pathological hallmarks of Alzheimer's disease (AD) are tangles formed by phosphorylated tau (P-tau) and plaques formed by Aβ peptides. In the present application, brain tissue was taken to detect the expression of P-tau, an indicator related to AD.

[0192] like Figure 6The results showed that the expression of P-tau was significantly reduced in the brain tissue of the control group (Group B) after hydrogel injection, indicating that the hydrogel in the control group (Group B) slowed down or even stopped the progression of MCI to AD.

[0193] The above experiments show that the hydrogel containing the GSDMD inhibitory plasmid prepared in the present application is significantly better than the HAD hydrogel.

[0194] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A composite drug delivery system, characterized in that: comprising a plasmid, and a hydrogel loaded with the plasmid, wherein the plasmid includes a plasmid as an active ingredient; The hydrogel is formed by mixing chitosan, sodium β-glycerophosphate, sodium hydroxyethyl cellulose and hyaluronic acid; The plasmid is integrated with a nucleic acid sequence for expressing a protein sequence for treating Alzheimer's disease, and the sequence is shown in SEQ ID NO:

4.

2. The compound drug delivery system according to claim 1, characterized in that: In the system, the mass ratio of plasmid to hydrogel is 1-100:100-10000000.

3. The compound drug delivery system according to claim 1, characterized in that: In the system, the mass ratio of plasmid to hydrogel is 1-50:1000-8000000.

4. The compound drug delivery system according to claim 1, characterized in that: The hydrogel comprises: 100-400 parts by weight of chitosan, 200-500 parts by weight of sodium beta-glycerophosphate, 1-50 parts by weight of sodium hydroxyethyl cellulose and 100-300 parts by weight of hyaluronic acid.

5. The compound drug delivery system according to claim 1, characterized in that: The composite drug delivery system is prepared in the following manner: providing a first dispersion of the plasmid in deionized water; Adding hyaluronic acid (HA) powder to the first dispersion to form a dispersion; Adding sodium hydroxyethylcellulose (HEC) powder to the second dispersion to form a third dispersion; Adding chitosan (CS) powder to the third dispersion to form a fourth dispersion; An aqueous solution of sodium β-glycerophosphate is added to the fourth dispersion and mixed evenly to obtain the composite drug delivery system.

6. The use of the combined drug delivery system according to claim 1, characterized in that: Used for preparing a preparation, a medicine or a pharmaceutical composition; the preparation, the medicine or the pharmaceutical composition is used for treating Alzheimer's disease and / or mild cognitive impairment.

7. A preparation, characterized in that Comprising the composite drug delivery system as claimed in claim 1.

8. A method for preparing the composite drug delivery system according to claim 1, characterized in that: The method comprises the step (s1) of providing a plasmid, chitosan, sodium hydroxyethyl cellulose and hyaluronic acid; (s2) mixing the plasmid, chitosan, sodium hydroxyethyl cellulose and hyaluronic acid to obtain a first solution; (s3) slowly adding the above-mentioned sodium β-glycerophosphate to the first solution and mixing well to obtain the composite drug delivery system; Wherein, the plasmid is as described in claim 1; The hydrogel material is selected from the group consisting of chitosan, sodium β-glycerophosphate, sodium hydroxyethylcellulose and hyaluronic acid.

9. The preparation method according to claim 8, characterized in that: The composite drug delivery system is prepared in the following manner: providing a first dispersion of the plasmid in deionized water; Adding hyaluronic acid (HA) powder to the first dispersion to form a dispersion; Adding sodium hydroxyethylcellulose (HEC) powder to the second dispersion to form a third dispersion; Adding chitosan (CS) powder to the third dispersion to form a fourth dispersion; An aqueous solution of sodium β-glycerophosphate is added to the fourth dispersion and mixed evenly to obtain the composite drug delivery system.

10. The preparation method according to claim 9, characterized in that: The concentration of the plasmid in the first dispersion is 1-3ug / ml; and / or In the first dispersion, the weight ratio of hyaluronic acid to plasmid is 130000-150000:10-20; In the second dispersion, the weight ratio of hyaluronic acid to sodium hydroxyethyl cellulose is 5-10:1; In the third dispersion, the weight ratio of hyaluronic acid to chitosan is 5-10:5-15; In the fourth dispersion, the weight ratio of hyaluronic acid to sodium β-glycerophosphate is 5-10:20-40.

Images