Recombinant escherichia coli producing strain for efficiently producing O-acetyl-L-homoserine as well as construction method and application of recombinant escherichia coli producing strain

Abstract

The invention relates to the technical field of microbial metabolism engineering, in particular to recombinant escherichia coli for efficiently producing O-acetyl-L-homoserine as well as a construction method and application of the recombinant escherichia coli. The invention relates to recombinant escherichia coli for efficiently producing O-acetyl-L-homoserine, which is characterized in that a transport protein encoding gene rhtA is knocked out in a chassis strain Escherichia coli W3110, a homoserine O-acetyltransferase encoding gene metXcm from marine cyclobacter is over-expressed, an acetyl coenzyme A synthetase encoding gene acs is over-expressed, pantothenic acid kinase coXpp from pseudomonas putida is over-expressed, and the recombinant escherichia coli can be used for efficiently producing O-acetyl-L-homoserine. And knocking out the malate synthetase coding gene aceB to obtain the recombinant escherichia coli for efficiently producing the O-acetyl-L-homoserine. The strain provided by the invention does not carry plasmids, does not need to additionally add antibiotics and inducers, and is lower in production cost and more stable. And the yield of the O-acetyl-L-homoserine of the plasmid-free strain is increased to 16.85 g / L from 0 g / L. Therefore, the recombinant escherichia coli provided by the invention has important industrial application value.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial metabolic engineering, and in particular to a recombinant Escherichia coli capable of efficiently producing O-acetyl-L-homoserine, and a construction method and application thereof. Background Art

[0002] O-acetyl-L-homoserine (OAH) is an acetylated amino acid with a molecular formula of C6H11NO4 and a molecular weight of 161.16. Since there is no homoserine acetyltransferase MetX in Escherichia coli, O-acetyl-L-homoserine is not accumulated. In Escherichia coli, O-succinyl-L-homoserine is obtained through homoserine O-succinyltransferase MetA, and methionine is further synthesized, rather than through O-acetyl-L-homoserine. As a strain with a clear background and simple gene editing, Escherichia coli is an ideal synthetic chassis for O-acetyl-L-homoserine. O-acetyl-L-homoserine can be used as a key synthetic precursor for L-methionine. It can synthesize L-methionine in a greener and simpler way.

[0003] There are few reports on O-acetyl-L-homoserine. In Escherichia coli, Yang Jing et al. from the Tiangong Institute used a threonine-producing bacterium as the chassis strain, optimized the expression levels of homoserine dehydrogenase (ThrA) and acetyltransferase (MetX) using promoter combinations of different strengths, and finally achieved an O-acetyl-L-homoserine yield of 1.98 g / L in a 24-deep-well plate through medium optimization. Liu Peng et al. from Zhejiang University of Technology introduced the glycerol pathway and optimized the fermentation medium to achieve a shake flask yield of 9.42 g / L. In addition, Li Ning et al. from Jiangnan University chose to ferment and produce O-acetyl-L-homoserine in Corynebacterium glutamicum, introduced different acetyl-CoA synthesis pathways, and tried to add exogenous substances to increase the yield of O-acetyl-L-homoserine. Subsequently, a CRSIPR dCas9 suitable for Corynebacterium glutamicum was constructed, key genes of the pathway were screened, and the expression intensity of citrate synthase was weakened, the yield was improved, and the fermentation cycle was shortened.

[0004] The existing work of producing O-acetyl-L-homoserine by microbial fermentation is mainly carried out in Escherichia coli and Corynebacterium glutamicum. These studies have achieved remarkable results, but the above studies are all strains with plasmids, and additional inducers and antibiotics need to be added during fermentation. In addition, the presence of plasmids will burden the metabolism of the strains and have instability. This undoubtedly brings a great burden to industrial production. The production capacity of engineering strains, especially the production capacity of plasmid-free strains, still needs to be improved. Therefore, improving the production performance of O-acetyl-L-homoserine engineering bacteria is a goal of those skilled in the art. Summary of the invention

[0005] The purpose of the present invention is to overcome the problems of low yield, high fermentation cost and instability of O-acetyl-L-homoserine production strains in the prior art in fermenting O-acetyl-L-homoserine, and to provide a recombinant Escherichia coli for efficiently producing O-acetyl-L-homoserine, a construction method and application thereof.

[0006] In order to achieve the above object, the present invention is implemented by the following technical solutions: In the first aspect, the present invention first provides a recombinant Escherichia coli for efficiently producing O-acetyl-L-homoserine. The transporter encoding gene rhtA is knocked out in the chassis strain Escherichia coli W3110, the homoserine O-acetyltransferase encoding gene metXcm from Cyclobacterium maritima is overexpressed, the acetyl-CoA synthetase encoding gene acs is overexpressed, the pantothenate kinase coaXpp from Pseudomonas putida is overexpressed, and the malate synthase encoding gene aceB is knocked out, so as to obtain the recombinant Escherichia coli for efficiently producing O-acetyl-L-homoserine.

[0007] The production performance of plasmid-free O-acetyl-L-homoserine engineering bacteria can be improved by reducing the export of L-homoserine, overexpressing homoserine O-acetyltransferase, and enhancing the synthesis of acetyl-CoA. In W3110 (i.e., Escherichia coli OAH7, disclosed in patent application number CN202410775092.4 and application publication number CN118531032A, and provided by the Microbial Culture Collection of Zhejiang University of Technology), the transporter encoding gene rhtA was knocked out to reduce the efflux of the precursor L-homoserine and provide more precursors for the synthesis of O-acetyl-L-homoserine; the homoserine O-acetyltransferase encoding gene metXcm from Marine Cyclobacterium was overexpressed to promote the combination of L-homoserine with the acetyl group provided by a molecule of acetyl-CoA to obtain O-acetyl-L-homoserine, the acetyl-CoA synthetase encoding gene acs was overexpressed to promote the synthesis of acetyl-CoA, the pantothenate kinase coaXpp from Pseudomonas putida was overexpressed to increase the intracellular CoA pool and promote the synthesis of acetyl-CoA, and the malate synthase encoding gene aceB was knocked out to reduce the consumption of the precursor acetyl-CoA except for the synthesis of O-acetyl-L-homoserine. Through the combination of the above transformation strategies, the present invention successfully obtains a recombinant Escherichia coli strain that efficiently produces O-acetyl-L-homoserine.

[0008] The genes encoding transporter, homoserine O-acetyltransferase, acetyl-CoA synthetase, pantothenate kinase, and malate synthetase are generally represented as rhtA, metXcm, acs, coaXpp, and aceB. The gene sequences can be obtained from the public database National Center for Biotechnology Information (NCBI). For example, GenBank ID. No. 4062377 of rhtA, GenBank ID. No. 503788769 of metXcm, GenBank ID. No. 1932754253 of acs, GenBank ID. No. 2744743370 of coaXpp, and GenBank ID. No. 1932759898 of aceB.

[0009] In a second aspect, the present invention provides a method for constructing a recombinant Escherichia coli that efficiently produces O-acetyl-L-homoserine, which specifically comprises the following steps: 1. Steps for knocking out the transporter encoding gene rhtA; 2. Overexpression of metX, a gene encoding homoserine O-acetyltransferase from Cyclobacter marinus, in the genome cm Steps; 3. Steps of overexpressing the acetyl-CoA synthetase encoding gene acs at the fliK locus; 4. Overexpression of pantothenate kinase coaX from Pseudomonas putida pp Steps; 5. Steps for knocking out the gene aceB encoding malate synthase.

[0010] Preferably, one copy of the metXcm gene is added in the genome to enhance its expression.

[0011] Preferably, the metXcm, acs, and coaXpp genes are expressed by a strong promoter.

[0012] Preferably, the strong promoter is Ptrc, and the nucleotide sequence of the promoter is SEQ ID NO.1.

[0013] Preferably, the metXcm is integrated into the rhtA gene locus, the acs is integrated into the fliK gene locus, and the coaXpp is integrated into the aceB gene locus.

[0014] Preferably, the metXcm is from Cyclobacterium maritima and the coaXpp is from Pseudomonas putida.

[0015] In a third aspect, the present invention provides a recombinant Escherichia coli for efficiently producing O-acetyl-L-homoserine, characterized by its application in the fermentation production of O-acetyl-L-homoserine.

[0016] Preferably, the application is to first perform slant activation and seed culture on the recombinant Escherichia coli, inoculate the seed solution into a fermentation medium for fermentation culture, and separate and purify to obtain O-acetyl-L-homoserine.

[0017] Preferably, slant activation and seed culture are performed before the fermentation culture, and the seed liquid is inoculated into the fermentation medium.

[0018] The seed culture method of the present invention is: pick a single bacterial colony on the slant and inoculate it into LB liquid culture medium, culture it overnight at 37°C and 200rpm to obtain seed liquid, and inoculate the seed liquid into the fermentation medium at an inoculation amount of 2% by volume.

[0019] Preferably, the slant activation method comprises inoculating the recombinant E. coli on an LB plate and culturing at 37° C. overnight to obtain slant bacteria.

[0020] Compared with the prior art, the present invention has the following beneficial effects: (1) Compared with the wild-type and chassis strains, the modified recombinant Escherichia coli provided by the present invention can better utilize carbon sources such as glucose to produce O-acetyl-L-homoserine.

[0021] (2) The strain provided by the present invention does not carry a plasmid, does not require the addition of antibiotics and inducers, has lower production costs, and is more stable.

[0022] (3) The O-acetyl-L-homoserine production of the plasmid-free strain increased from 0 to 16.85 g / L.

[0023] (4) The recombinant Escherichia coli provided by the present invention has important industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a fermentation result diagram of shake flask fermentation of all strains in the present invention. DETAILED DESCRIPTION

[0025] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments of the specification. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only embodiments of a part of the present invention, rather than all embodiments. Therefore, based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of the present invention.

[0026] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0027] The test materials used in the following examples are conventional biochemical reagents unless otherwise specified. The term "enhancement" refers to increasing the activity of an enzyme encoded by a corresponding polynucleotide. The number of copies of a gene can be increased by expressing it in the genome or using a plasmid.

[0028] LB liquid culture medium composition: peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, solvent is deionized water, pH value is natural.

[0029] LB plates were prepared by adding agar to LB liquid medium at a final concentration of 2 g / L.

[0030] Example 1 Construction of recombinant Escherichia coli for efficient production of O-acetyl-L-homoserine (1) Knockout of rhtA gene and metX cm Knock-in In order to produce O-acetyl-L-homoserine with more precursor L-homoserine, the transporter encoding gene rhtA was knocked out in the genome. In order to produce O-acetyl-L-homoserine from L-homoserine, the homoserine-O-acetyltransferase encoding gene metX from Cyclobacter maritima was deleted. cm Integrated into the genome. Using the CRISPR-Cas9 system, see Jiang Y, Chen B, Duan C, et al. Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System [J]. Applied & Environmental Microbiology, 2015, 81 (7): 2506.

[0031] The pTargetF vector (plasmid from Addgene) was diluted and used as a template. Primers 1 and 2 were used to construct the pTarget-ΔrhtA mutant vector that can express the sgRNA targeting the target gene rhtA by PCR. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, 30 cycles; 72 ℃ 5 min. The PCR product was transformed into E. coli In the DH5α competent state, the pTarget-ΔrhtA vector with correct sequencing was obtained by screening on a plate with spectinomycin hydrochloride (SD) resistance.

[0032] Subsequently, primers 3 and 4 were used to amplify the upstream homologous sequence of rhtA according to the rhtA gene of Escherichia coli published on NCBI. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 5 min. In the same way, primers 5 and 6 were used to amplify the downstream homologous sequence of rhtA. The PCR product was purified using a purification kit.

[0033] By PCR, the Cyclobacterium marinum genome was used as a template, primers 7 and 8 were used to introduce the Ptrc strong promoter, and metX from Corynebacterium glutamicum was amplified. cm Gene (GenBank ID.No.503788769), PCR reaction conditions are as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, 30 cycles; 72 ℃ 5 min. PCR products were purified using a purification kit. The purified upstream and downstream homologous fragments of rhtA and metX cm The gene fragment was subjected to fusion PCR using primers 3 and 6 to obtain the knock-in frame. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 5 min.

[0034] The process of preparing competent cells by chemical transformation is as follows: pick a single colony of Escherichia coli W3110 and inoculate it into a test tube containing 5 mL LB medium, and culture it overnight at 37°C and 200 rpm in a constant temperature shaker. Pipette 1 mL of the overnight culture solution and transfer it to a 250 mL conical flask containing 40 mL LB medium, and culture it at 37°C and 200 rpm in a constant temperature shaker for 1-2 hours until the OD value of the culture solution reaches 1.5. 600The concentration of the cultured bacterial solution is between 0.4 and 0.6. Place the cultured bacterial solution on ice to cool for about 10 minutes, pour it into a 50 mL centrifuge tube, centrifuge it at 4°C, 5500 rpm for 5 minutes, remove the supernatant and retain the bacteria in a clean bench, add about 40 mL of pre-sterilized and pre-cooled 0.1 MCaCl2 solution, resuspend it in an ice-water bath, and ice-bath it for 30 minutes. After centrifugation at 6000 rpm for 5 minutes, add 1 mL of pre-cooled solution containing 0.1 MCaCl2 and 15% glycerol, resuspend it in an ice-water bath, and dispense it into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for later use, and store the rest at -80°C.

[0035] The process of chemical transformation of pCas plasmid is as follows: take a competent cell and place it on ice, add 1 μL of plasmid to the competent cell in a clean bench, mix well and then place it on ice for 30 min. Then place the EP tube containing competent cells in a 42 ℃ constant temperature water bath for 90 s, and quickly insert it into ice to cool for 5 min. Add 700 μL of pre-cooled LB medium to the EP tube in the clean bench and culture it in a constant temperature shaker at 37 ℃ and 200 rpm for 1-2 h. Pipette 200 μL of bacterial solution and spread it on the LB solid plate of the corresponding resistance, invert it in a 37 ℃ constant temperature incubator and culture it overnight to obtain the Escherichia coli W3110 strain containing the pCas vector.

[0036] The electroporation competent cell preparation process is as follows: pick a single colony from the Escherichia coli W3110 pCas streak plate, inoculate it into a 5 mL LLB tube (kan resistance), add 100 μL of L-Ara stock solution, and culture it at 30°C, 180 rpm overnight as seed solution. Inoculate 500 μL of the seed solution into a 50 mL shake flask LLB (kan resistance), add 500 μL of L-Ara stock solution, and culture it at 30°C, 180 rpm for 3-4 h until the OD reaches 0. 600 = 0.6. Precool the shake flask and centrifuge tube in an ice bath for 10 min, pour the bacterial solution into the centrifuge tube in the clean bench, and centrifuge at 4℃, 6000 rpm for 5 min. Discard the supernatant in the clean bench and add 40 mL of precooled sterile ultrapure water. Gently resuspend the cells in an ice water bath, centrifuge at 4℃, 6000 rpm for 6 min, and repeat once. Discard the supernatant in the clean bench (pay attention to the loss of bacteria), add 20 mL of precooled 10% glycerol to a centrifuge tube, and resuspend in an ice water bath. Centrifuge at 4℃, 6000 rpm for 5 min. Discard the supernatant in the clean bench (pay attention to the loss of bacteria), add 1 mL of precooled 10% glycerol, resuspend in an ice water bath, and dispense 100 μL into sterile 2mL EP tubes in each tube, keep one tube for later use, and store the rest at -80℃.

[0037] The electroporation process is as follows: Take an electroporation competent cell and place it in an ice bath. Add 2 μL of pTarget-ΔrhtA vector and 2 μL of knock-in frame PCR purification product in the clean bench, mix gently with a medium gun, and place on ice for 1 minute. Use a medium gun to transfer to a pre-cooled 2mm electroporation cup and place on ice for 1 minute. Use a paper towel to wipe off the water mist on the outside of the electroporation cup, place it in the electroporator, and use ECO 2 for electroporation. In the clean bench, add 1 mL of pre-cooled LLB medium to the groove of the electroporation cup, tilt the electroporation cup, absorb all the bacterial liquid from the mouth of the electroporation cup, and transfer it to a 2 mL sterile ep tube. Resuscitate at 30°C, 180 rpm for 3 hours. Take 400 μL and spread it on LLB solid medium (SD+kan resistance) and culture it at 30°C overnight.

[0038] A single colony was selected as a template for colony PCR verification to confirm the knockout of rhtA and metX cm Knock-in of the gene. The strain confirmed by this was cultured overnight at 30°C in LB medium containing 50 mg / L of kanamycin and 5 mM IPTG to remove the pTarget-ΔrhtA vector. The strain from which the pTarget-ΔrhtA vector had been removed was then cultured overnight in LB medium at 37°C to remove the pCas vector. The strain thus constructed was recorded as Escherichia coli OAHY1.

[0039] (2) Overexpression of ACS In order to enhance the synthesis of intracellular acetyl-CoA, the acs gene encoding acetyl-CoA synthetase in the genome of the OAHY1 strain was overexpressed by the CRISPR-Cas9 system. The pTargetF vector was diluted and used as a template. Primers 9 and 10 were used to construct the pTarget-ΔfliK mutant vector that can express sgRNA targeting the target gene fliK by PCR. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, 30 cycles; 72 ℃ 5min. The PCR product was transformed into E. coli In the DH5α competent state, the pTarget-ΔfliK vector with correct sequencing was obtained by screening on a plate with spectinomycin hydrochloride (SD) resistance.

[0040] Subsequently, primers 11 and 12 were used to amplify the upstream homologous sequence of fliK according to the fliK gene of Escherichia coli published on NCBI. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, 30 cycles; 72 ℃ 5 min. In the same way, primers 13 and 14 were used to amplify the downstream homologous sequence of fliK. The PCR product was purified using a purification kit.

[0041] By PCR, the Escherichia coli genome was used as a template, primers 15 and 16 were used to introduce the Ptrc strong promoter, and the acs gene (GenBank ID.No.1932754253) was amplified. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, 30 cycles; 72 ℃ 5 min. The PCR product was purified using a purification kit. The purified fliK upstream and downstream homologous fragments and acs gene fragments were fused PCR using primers 11 and 14 to obtain the knock-in frame. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, 30 cycles; 72 ℃ 5 min.

[0042] The process of preparing competent cells by chemical transformation is as follows: pick a single colony of OAHY1 and inoculate it into a test tube containing 5 mL of LB medium, and culture it overnight at 37°C and 200 rpm in a constant temperature shaker. Pipette 1 mL of the overnight culture solution and transfer it to a 250 mL conical flask containing 40 mL of LB medium, and culture it at 37°C and 200 rpm in a constant temperature shaker for 1-2 hours until the OD value of the bacterial solution reaches 0. 600 The concentration of the cultured bacterial solution is between 0.4 and 0.6. Place the cultured bacterial solution on ice to cool for about 10 minutes, pour it into a 50 mL centrifuge tube, centrifuge it at 4 °C and 5500 rpm for 5 minutes, remove the supernatant and retain the bacteria in a clean bench, add about 40 mL of pre-sterilized and pre-cooled 0.1 M CaCl2 solution, resuspend it in an ice water bath, and ice bath it for 30 minutes. After centrifugation at 6000 rpm for 5 minutes, add 1 mL of pre-cooled 0.1 M CaCl2 and 15% glycerol, resuspend it in an ice water bath, and dispense it into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for use, and store the rest at -80 °C.

[0043] The process of chemical transformation of pCas plasmid is as follows: take a competent cell and place it on ice, add 1 μL of plasmid to the competent cell in a clean bench, mix well and then place it on ice for 30 min. Then place the EP tube containing competent cells in a 42 ℃ constant temperature water bath for 90 s, and quickly insert it into ice to cool for 5 min. Add 700 μL of pre-cooled LB medium to the EP tube in the clean bench, and culture it in a constant temperature shaker at 37 ℃ and 200 rpm for 1-2 h. Pipette 200 μL of bacterial solution and spread it on the LB solid plate of the corresponding resistance, invert it in a 37 ℃ constant temperature incubator and culture it overnight to obtain the OAHY1 strain containing the pCas vector.

[0044] The electroporation competent preparation process is as follows: pick a single colony from the OAHY1 pCas streak plate, inoculate it into a 5 mL LLB tube (kan resistance), add 100 μL of L-Ara stock solution, and culture it at 30°C, 180 rpm overnight as seed solution. Inoculate 500 μL of the seed solution into a 50 mL shake flask LLB (kan resistance), add 500 μL of L-Ara stock solution, and culture it at 30°C, 180 rpm for 3-4 h until the OD reaches 0. 600 = 0.6. Precool the shake flask and centrifuge tube in an ice bath for 10 min, pour the bacterial solution into the centrifuge tube in the clean bench, and centrifuge at 4℃, 6000 rpm for 5 min. Discard the supernatant in the clean bench and add 40 mL of precooled sterile ultrapure water. Gently resuspend the cells in an ice water bath, centrifuge at 4℃, 6000 rpm for 6 min, and repeat once. Discard the supernatant in the clean bench (pay attention to the loss of bacteria), add 20 mL of precooled 10% glycerol to a centrifuge tube, and resuspend in an ice water bath. Centrifuge at 4℃, 6000 rpm for 5 min. Discard the supernatant in the clean bench (pay attention to the loss of bacteria), add 1 mL of precooled 10% glycerol, resuspend in an ice water bath, and dispense 100 μL into sterile 2mL EP tubes in each tube, keep one tube for later use, and store the rest at -80℃.

[0045] The electroporation process is as follows: Take an electroporation competent cell and place it in an ice bath. Add 2 μL of pTarget-ΔfliK vector and 2 μL of knock-in frame PCR purification product in the clean bench, mix gently with a medium gun, and place on ice for 1 minute. Use a medium gun to transfer to a pre-cooled 2mm electroporation cup and place on ice for 1 minute. Use a paper towel to wipe off the water mist on the outside of the electroporation cup, place it in the electroporator, and use ECO 2 for electroporation. In the clean bench, add 1 mL of pre-cooled LLB medium to the groove of the electroporation cup, tilt the electroporation cup, absorb all the bacterial liquid from the mouth of the electroporation cup, and transfer it to a 2 mL sterile ep tube. Resuscitate at 30°C, 180 rpm for 3 hours. Take 400 μL and spread it on LLB solid medium (SD+kan resistance) and culture it at 30°C overnight.

[0046] A single colony was picked as a template for colony PCR verification to confirm the knock-in of the acs gene. The strain that passed this confirmation was cultured overnight at 30°C in LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-ΔfliK vector. The strain from which the pTarget-ΔfliK vector had been removed was then cultured overnight at 37°C in LB medium to remove the pCas vector. The strain constructed in this way was recorded as E. coli OAHY2.

[0047] (3) Knockout of aceB and coaX pp Knock-in To enhance the intracellular CoA pool and thus increase the total amount of acetyl-CoA, the pantothenate kinase encoding gene coaX pp In addition, to reduce the extra consumption of acetyl-CoA, the gene encoding malate synthase, aceB, was knocked out. The aceB gene encoding malate synthase in the genome of the OAHY2 strain was knocked out using the CRISPR-Cas9 system, and the pantothenate kinase encoding gene coaX from Pseudomonas putida was overexpressed. pp The pTargetF vector was diluted and used as a template. Primers 17 and 18 were used to construct the pTarget-ΔaceB mutant vector that can express the sgRNA targeting the target gene aceB. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 1 min, 30 cycles; 72 ℃ for 5 min. The PCR product was transformed into E. coli In the DH5α competent state, the pTarget-ΔaceB vector with correct sequencing was obtained by screening on a plate with spectinomycin hydrochloride (SD) resistance.

[0048] Subsequently, primers 19 and 20 were used to amplify the upstream homologous sequence of aceB according to the aceB gene of Escherichia coli published on NCBI. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 5 min. In the same way, primers 21 and 22 were used to amplify the downstream homologous sequence of aceB. The PCR product was purified using a purification kit.

[0049] By PCR, the Pseudomonas putida genome was used as a template, primers 23 and 24 were used to introduce the Ptrc strong promoter, and coaX ppGene (GenBank ID.No.2744743370), PCR reaction conditions are as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, 30 cycles; 72 ℃ 5 min. PCR products were purified using a purification kit. The purified aceB upstream and downstream homologous fragments and coaX pp The gene fragment was subjected to fusion PCR using primers 19 and 22 to obtain the knock-in frame. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 5 min.

[0050] The process of preparing competent cells by chemical transformation is as follows: pick a single colony of OAHY2 and inoculate it into a test tube containing 5 mL LB medium, and culture it overnight at 37°C and 200 rpm in a constant temperature shaker. Pipette 1 mL of the overnight culture solution and transfer it to a 250 mL conical flask containing 40 mL LB medium, and culture it at 37°C and 200 rpm in a constant temperature shaker for 1-2 hours until the OD value of the culture solution reaches 0. 600 The concentration of the cultured bacterial solution is between 0.4 and 0.6. Place the cultured bacterial solution on ice to cool for about 10 minutes, pour it into a 50 mL centrifuge tube, centrifuge it at 4 °C and 5500 rpm for 5 minutes, remove the supernatant and retain the bacteria in a clean bench, add about 40 mL of pre-sterilized and pre-cooled 0.1 M CaCl2 solution, resuspend it in an ice water bath, and ice bath it for 30 minutes. After centrifugation at 6000 rpm for 5 minutes, add 1 mL of pre-cooled 0.1 M CaCl2 and 15% glycerol, resuspend it in an ice water bath, and dispense it into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for use, and store the rest at -80 °C.

[0051] The process of chemical transformation of pCas plasmid is as follows: take a competent cell and place it on ice, add 1 μL of plasmid to the competent cell in a clean bench, mix well and then place on ice for 30 min. Then place the EP tube containing competent cells in a 42 ℃ constant temperature water bath for 90 s, and quickly insert it into ice to cool for 5 min. Add 700 μL of pre-cooled LB medium to the EP tube in the clean bench, and culture it in a constant temperature shaker at 37 ℃ and 200 rpm for 1-2 h. Pipette 200 μL of bacterial solution and spread it on the LB solid plate of the corresponding resistance, invert it in a 37 ℃ constant temperature incubator and culture it overnight to obtain the OAHY2 strain containing the pCas vector.

[0052] The electroporation competent cell preparation process is as follows: pick a single colony from the OAHY2 pCas streak plate, inoculate it into a 5 mL LLB tube (kan resistance), add 100 μL of L-Ara stock solution, and culture it at 30°C, 180 rpm overnight as seed solution. Inoculate 500 μL of the seed solution into a 50 mL shake flask LLB (kan resistance), add 500 μL of L-Ara stock solution, and culture it at 30°C, 180 rpm for 3-4 h until the OD reaches 0. 600 = 0.6. Precool the shake flask and centrifuge tube in an ice bath for 10 min, pour the bacterial solution into the centrifuge tube in the clean bench, and centrifuge at 4℃, 6000 rpm for 5 min. Discard the supernatant in the clean bench and add 40 mL of precooled sterile ultrapure water. Gently resuspend the cells in an ice water bath, centrifuge at 4℃, 6000 rpm for 6 min, and repeat once. Discard the supernatant in the clean bench (pay attention to the loss of bacteria), add 20 mL of precooled 10% glycerol to a centrifuge tube, and resuspend in an ice water bath. Centrifuge at 4℃, 6000 rpm for 5 min. Discard the supernatant in the clean bench (pay attention to the loss of bacteria), add 1 mL of precooled 10% glycerol, resuspend in an ice water bath, and dispense 100 μL into sterile 2mL EP tubes in each tube, keep one tube for later use, and store the rest at -80℃.

[0053] The electroporation process is as follows: Take an electroporation competent cell and place it in an ice bath. Add 2 μL of pTarget-ΔaceB vector and 2 μL of knock-in frame PCR purification product in the clean bench, mix gently with a medium gun, and place on ice for 1 minute. Use a medium gun to transfer to a pre-cooled 2mm electroporation cup and place on ice for 1 minute. Use a paper towel to wipe off the water mist on the outside of the electroporation cup, place it in the electroporator, and use ECO 2 for electroporation. In the clean bench, add 1 mL of pre-cooled LLB culture medium to the groove of the electroporation cup, tilt the electroporation cup, absorb all the bacterial liquid from the mouth of the electroporation cup, and transfer it to a 2 mL sterile ep tube. Resuscitate at 30°C, 180 rpm for 3 hours. Take 400 μL and spread it on LLB solid culture medium (SD+kan resistance) and culture it at 30°C overnight.

[0054] A single colony was selected as a template for colony PCR verification to confirm the knockout of aceB and coaX pp Knock-in of the gene. The strain confirmed by this was cultured overnight at 30°C in LB medium containing 50 mg / L of kanamycin and 5 mM IPTG to remove the pTarget-ΔaceB vector. The strain from which the pTarget-ΔaceB vector had been removed was then cultured overnight in LB medium at 37°C to remove the pCas vector. The strain thus constructed was recorded as E. coli OAHY3.

[0055] Table 1 Primer list Primer 1 TAATACTAGTGAAACGCCGTAAAACAACAGGTTTTAGAGCTAGAAATAGC Primer 2 GCTCTAAAACCTGTTGTTTTACGGCGTTTCACTAGTATTATACCTAGGAC Primer 3 TCAGGTTGAAACCGCCCATT Primer 4 GTGACCACACATTATACGAGCCGGATGATTAATTGTCAACCTTTCTCCCACAAATATCT Primer 5 ATTTACATTTCTGCATGGTT Primer 6 CATCCAGCATTTCATGTACG Primer 7 GCTCGTATAATGTGTGGTCACAAAGGAGATATACATGAACCTCCAGTCTCCGC Primer 8 AACCATGCAGAAATGTAAATTTAACCGTTGTTTTCCAGGT Primer 9 TAATACTAGTGACACCACCACATTGCCTGGGTTTTAGAGCTAGAAATAGC Primer 10 GCTCTAAAACCCAGGCAATGTGGTGGTGTCACTAGTATTATACCTAGGAC Primer 11 TCCAGGGGCTGGAGCGTATT Primer 12 GTGACCACACATTATACGAGCCGGATGATTAATTGTCAATCATTCAGGTTTCCTCATGG Primer 13 CGTCAGAGGTAGCACCGTAA Primer 14 GGTGGAAAGTGTGGTTTTAA Primer 15 CTCGTATAATGTGTGGTCACAAAGGAGATATACATGAGCCAAATTCACAAACA Primer 16 TTACGGTGCTACCTCTGACGTTACGATGGCATCGCGATAG Primer 17 TAATACTAGTCATATTGTTGGTCTGAACTGGTTTTAGAGCTAGAAATAGC Primer 18 GCTCTAAAACCAGTTCAGACCAACAATATGACTAGTATTATACCTAGGAC Primer 19 GCATCGACAGAACGACACCA Primer 20 GTGACCACACATTATACGAGCCGGATGATTAATTGTCAACGTGCAGCTCCCTCGTCATGG Primer 21 ACCACCACATAACTATGGAG Primer 22 CGGCAGGAAGTAATCGACAT Primer 23 CTCGTATAATGTGTGGTCACAAAGGAGATATACATGATTCTTGAGCTCGATTG Primer 24 CTCCATAGTTATGTGGTGGTTCAATCCAATGGACAAGCCA Example 2 Shake flask fermentation experiment The above-mentioned bacteria were tested in a fermentation experiment in a shake flask to compare the ability of each genotype strain to produce O-acetyl-L-homoserine. The shake flask fermentation experiment was carried out according to the following scheme: each strain was streaked on an LB plate, cultured in a 37°C incubator overnight, a single colony was picked and inoculated into 5 ml of LB medium, and cultured in a 37°C incubator at a speed of 200 rpm overnight to obtain a seed solution.

[0056] 50 ml of fermentation medium was added to a 500 ml shake flask, and 1 ml of seed solution of each strain was inoculated into the fermentation medium. The final concentration of the fermentation medium was as follows: glucose 30 g / L, potassium dihydrogen phosphate 2 g / L, ammonium sulfate 20 g / L, yeast powder 4 g / L, calcium carbonate 20 g / L, L-threonine 0.20 g / L, vitamin B1 0.0001 g / L, vitamin B12 0.0001 g / L, L-isoleucine 0.2 g / L, MgSO4 2 g / L, FeSO4 0.005 g / L, MnSO4 0.005 g / L, ZnSO4 0.005 g / L, the solvent was deionized water, and the pH value was 6.8. Cultivate at 200 rpm in a 30°C incubator for 48 hours, take a certain amount of fermentation broth from the shake flask, dilute it 100 times with ultrapure water, filter it through a membrane, and use an amino acid analyzer to detect the content of O-acetyl-L-homoserine in the fermentation broth. Finally, compare the amount of O-acetyl-L-homoserine obtained by strains of different genotypes. The results of the shake flask fermentation experiment of the metabolically modified strains are shown in Figure 2. Figure 1 shown.

[0057] according to Figure 1 It can be seen that the metabolically modified OAHY3 strain does not carry a plasmid, has the ability to produce and accumulate O-acetyl-L-homoserine extracellularly, and can better utilize carbon sources such as glucose to produce O-acetyl-L-homoserine than the wild type. The strain with the best performance after modification increased the level of O-acetyl-L-homoserine fermentation from 0 g / L to 16.85 g / L compared with the starting strain, and does not carry a plasmid, does not require additional antibiotics and inducers, and the fermentation is more stable. The other modified strains have different degrees of improvement in the production of O-acetyl-L-homoserine compared with the original strain.

Claims

1. A recombinant Escherichia coli for efficiently producing O-acetyl-L-homoserine, characterized in that: The transporter encoding gene rhtA is knocked out in the chassis strain Escherichia coli W3110, the homoserine O-acetyltransferase encoding gene metXcm from Cyclobacterium maritima is overexpressed, the acetyl-CoA synthetase encoding gene acs is overexpressed, the pantothenate kinase coaXpp from Pseudomonas putida is overexpressed, and the malate synthase encoding gene aceB is knocked out, so as to obtain the recombinant Escherichia coli that efficiently produces O-acetyl-L-homoserine.

2. The recombinant Escherichia coli for efficiently producing O-acetyl-L-homoserine according to claim 1, characterized in that: The metXcm gene is added in one copy in the genome to enhance its expression.

3. The recombinant Escherichia coli for efficiently producing O-acetyl-L-homoserine according to claim 1, characterized in that: The metXcm, acs, and coaXpp genes are expressed by a strong promoter.

4. The recombinant Escherichia coli for efficiently producing O-acetyl-L-homoserine according to claim 3, characterized in that: The strong promoter is Ptrc, and the nucleotide sequence of the promoter is SEQ ID NO.

1.

5. The recombinant Escherichia coli for efficiently producing O-acetyl-L-homoserine according to claim 1, characterized in that: The metXcm is integrated into the rhtA gene site, the acs is integrated into the fliK gene site, and the coaXpp is integrated into the aceB gene site.

6. A recombinant Escherichia coli for efficiently producing O-acetyl-L-homoserine as claimed in claim 1, 2, 3 or 5, characterized in that: The metXcm is from Cyclobacter maritima, and the coaXpp is from Pseudomonas putida.

7. Use of the recombinant Escherichia coli for efficiently producing O-acetyl-L-homoserine according to any one of claims 1 to 6 in fermentation production of O-acetyl-L-homoserine.

8. The use according to claim 7, characterized in that The application is to first perform slant activation and seed culture on the recombinant Escherichia coli, inoculate the seed liquid into the fermentation medium for fermentation culture, and separate and purify to obtain O-acetyl-L-homoserine.

9. The use according to claim 8, characterized in that Before the fermentation culture, slant activation and seed culture are first performed, and the seed liquid is inoculated into the fermentation medium.

10. The use according to claim 9, characterized in that The slant activation method is as follows: the recombinant E. coli is inoculated on an LB plate, and cultured overnight at 37° C. to obtain slant bacteria.

Images