Recombinant mycobacterium smegmatis expressing Rv0222 and application thereof

Abstract

The invention discloses recombinant mycobacterium smegmatis expressing Rv0222 and application of the recombinant mycobacterium smegmatis, and belongs to the technical field of biology. The recombinant mycobacterium smegmatis is constructed by transferring an Rv0222 gene into the mycobacterium smegmatis, and the nucleotide sequence of the Rv0222 gene is as shown in SEQ ID No: 1. The recombinant vector is constructed through the shuttle expression vector, the mycobacterium smegmatis is electrically transformed to obtain the recombinant mycobacterium smegmatis, the mechanism of the Rv0222 for regulating inherent immunity is explored by using the recombinant mycobacterium smegmatis, and a theoretical basis is provided for screening of new anti-tuberculosis drugs targeting the Rv0222.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a recombinant Mycobacterium smegmatis expressing Rv0222 and an application thereof. Background Art

[0002] Tuberculosis remains a major threat to public health security, and the development of new anti-tuberculosis drugs is urgently needed. Rv0222 is a key virulence factor of Mycobacterium tuberculosis (Mtb). The virulence of Mtb without Rv0222 is significantly reduced. Rv0222 can be used as a target for new anti-tuberculosis drugs. Exploring the regulatory mechanism of Rv0222 on host immunity is the key to the development of anti-tuberculosis drugs targeting Rv0222.

[0003] Mycobacterium smegmatis (M. smegmatis) is a non-tuberculous mycobacterium that is highly homologous to Mtb. It has the characteristics of fast growth and non-pathogenicity, and its application range is wider. At present, Mtb proteins have been expressed in M. smegmatis; for example, the recombinant Mycobacterium smegmatis disclosed in patent CN108384739A contains the nudC gene and can be used to produce nicotinic acid; patent CN117070436A discloses an immune-activated recombinant Mycobacterium smegmatis, containing anti-PD-L1scfv and IL-15 fusion protein gene fragments, which can be used to prepare protein vaccines and immune adjuvants. For example, recombinant Mycobacterium smegmatis expressing IL-2 and GLS can enhance the immune response of mice against tuberculosis infection (Vaccine, 2007, 25 (4): 638-648). However, there has been no report on recombinant Mycobacterium smegmatis expressing Rv0222. Summary of the invention

[0004] The purpose of the present invention is to provide a recombinant Mycobacterium smegmatis expressing Rv0222 and its application, so as to solve the problems existing in the above-mentioned prior art. By expressing Rv0222 in Mycobacterium smegmatis to construct a recombinant bacterium, the Rv02222 / miR-9 / SIRT1 regulatory pathway is clarified, and a new target is found for the development of anti-tuberculosis drugs targeting Rv0222, which is of great significance for the prevention and treatment of tuberculosis.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a recombinant Mycobacterium smegmatis expressing Rv0222. The recombinant Mycobacterium smegmatis is constructed by transferring the Rv0222 gene into Mycobacterium smegmatis. The nucleotide sequence of the Rv0222 gene is shown in SEQ ID No: 1.

[0007] The present invention also provides a method for constructing a recombinant Mycobacterium smegmatis expressing Mycobacterium smegmatis, comprising the following steps:

[0008] Cloning the Rv0222 gene and connecting it with an expression vector to construct a recombinant vector;

[0009] The recombinant vector is electrotransformed into Mycobacterium smegmatis to construct the recombinant Mycobacterium smegmatis expressing Rv0222.

[0010] Preferably, the nucleotide sequence of the Rv0222 gene is as shown in SEQ ID NO:1.

[0011] Preferably, the primers for cloning the Rv0222 gene are shown in SEQ ID NO: 2-3.

[0012] Preferably, the expression vector comprises pMV261.

[0013] The present invention also provides the use of the recombinant Mycobacterium smegmatis in preparing a cell model or an animal model for screening anti-tuberculosis drugs.

[0014] The present invention also provides the use of the recombinant Mycobacterium smegmatis in the preparation of an anti-tuberculosis drug targeting Rv0222.

[0015] The present invention also provides the use of the recombinant Mycobacterium smegmatis in screening targets for inhibiting the innate immunity regulated by Rv0222 in host cells or targets of anti-tuberculosis drugs targeting Rv0222.

[0016] Preferably, the host cell comprises a macrophage.

[0017] The present invention also provides the use of the recombinant Mycobacterium smegmatis in preparing a drug for preventing or treating tuberculosis.

[0018] The present invention discloses the following technical effects:

[0019] The present invention constructs Mycobacterium smegmatis expressing Rv0222, which helps to clarify the mechanism of Rv0222 regulating the host's innate immunity, and provides preliminary evidence for the research and development of new anti-tuberculosis drugs targeting Rv0222. Animal experiments show that compared with the control group, the degree of lung inflammation in mice infected with Ms_Rv0222 is significantly deepened, further revealing the toxicity of Rv0222. Using Ms_Rv0222 to act on macrophages and mice can induce miR-9 and its target SIRT1 expression changes, thereby inhibiting the host's innate immunity. The innate immune suppression effect of Rv0222 protein can be reversed by intervening miRNA and its target, that is, the present invention studies the role of Mycobacterium tuberculosis secretory protein in regulating innate immunity through the constructed recombinant bacteria Ms_Rv0222, revealing the mechanism of Rv0222 protein innate immunity and the target of inhibiting the action of Rv0222 protein.

[0020] Mycobacterium smegmatis has a high degree of homology with Mycobacterium tuberculosis and can be used as an alternative strain for anti-tuberculosis drugs. Mycobacterium smegmatis is a fast-growing and non-pathogenic bacterium with better application prospects. The recombinant bacteria Ms_Rv0222 constructed by the present invention utilizes the non-pathogenic characteristics of Mycobacterium smegmatis to show the role of Rv0222 in pathogenicity alone. The virulence of the recombinant mycobacterium is enhanced, and miRNA and its target protein are regulated to inhibit the host's inherent immunity, providing basic evidence for the research and development of new anti-tuberculosis drugs targeting Rv0222 drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 It is the PCR amplification product of Rv0222 gene; M: DNAMarker IV, 1: PCR product of Rv0222 gene;

[0023] Figure 2 The PCR analysis results of the recombinant plasmid pMV261-Rv0222; M: DNAMarker 2000, 1: positive control (Mtb H37Rv DNA as template), 2: negative control (pMV261 plasmid as template), 3: recombinant pMV261-Rv0222 plasmid;

[0024] Figure 3The expression results of Rv0222 protein in recombinant M. smegmatis; Lanes 1-3 are DNA Marker, recombinant bacteria Ms_Rv0222 cell lysate and Ms_Vec cell lysate containing empty vector. DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0028] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0029] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0030] In the embodiment of the present invention, Rv0222 gene, Escherichia coli-mycobacterium shuttle expression vector pMV261 and Mycobacterium smegmatis mc 2 155 strain as an example to construct the recombinant Mycobacterium smegmatis Ms_Rv0222.

[0031] Example 1 Preparation method of recombinant Mycobacterium smegmatis Ms_Rv0222 expressing Rv0222

[0032] 1. Experimental Materials

[0033] Mouse, M. smegmatis mc 2 155 strain (provided by Beijing Tuberculosis Prevention and Treatment Institute), pMV261 vector (provided by the School of Life Sciences of Sichuan University), Escherichia coli (purchased from Tiangen Biochemical Technology Co., Ltd.).

[0034] 2. Experimental methods

[0035] 2.1 Construction of recombinant vector

[0036] 2.1.1 Amplification of Rv0222 gene

[0037] (1) Primer design

[0038] According to the Rv0222 gene sequence, the primers of Rv0222 were designed using Primer Premier 5.0 software, and protective bases and restriction sites were added to the 5' end of the primers. The restriction sites are HindⅢ and EcoRⅠ contained in the pMV261 vector (underlined). Because the pMV261 plasmid does not have a protein tag sequence, a 6×His tag coding sequence (lowercase) was added downstream of the gene during the primer design process. The results of the primer design are shown in Table 1 below. The primers were synthesized by Shanghai Bioengineering Co., Ltd.

[0039] Table 1 Primer sequences

[0040]

[0041] (2) PCR amplification of the Rv0222 gene with 6×His

[0042] Using Rv0222 primers and Mtb H37Rv genomic DNA as a template, PCR amplified the Rv0222 gene fragment. The PCR amplification system is shown in Table 2 below:

[0043] Table 2 Amplification system

[0044]

[0045] After the 20 μL amplification system is prepared, it is centrifuged instantaneously and PCR is performed. The reaction procedure is shown in Table 3 below:

[0046] Table 3 Reaction procedure

[0047]

[0048] The length of the PCR product was determined by agarose gel (1%) electrophoresis. Figure 1 As shown, the Rv0222 gene fragment (SEQ ID NO: 1) was successfully amplified.

[0049] (3) Gel recovery and purification of PCR products

[0050] use Gel Extraction Kit column gel recovery linearized vector fragment. The operation method is as follows:

[0051] Under UV light, use a surgical blade to quickly cut off the strip of gel with the target band. Use tweezers to move the gel strip into a 1.5mL EP tube and weigh it to estimate the volume of the gel strip. (The gel density is about 1g / mL. If the mass of the gel strip is 0.5g, the volume is 500μL.) Add an equal volume of Binding buffer to the gel strip and place it at 50℃ for 7min to dissolve the gel. Add the DNA gel mixture in the recovery tube to the Hi Bind centrifuge column, centrifuge at 12000rpm for 2min at room temperature, and discard the waste liquid. Then put the column back into the recovery tube. Add 300μL of Binding buffer to the column, centrifuge (12000rpm, 1min), and discard the waste liquid. Add 700μL of Wash buffer, centrifuge (12000rpm, 1min), and discard the waste liquid. Centrifuge the empty centrifuge column at 13000rpm for 2min and discard the residual Wash buffer. Place the centrifugal column in a 1.5 mL EP tube and leave it at room temperature for 3 minutes to allow the alcohol to evaporate completely. Add 30 μL of Elution buffer (65°C), leave it at room temperature for 2 minutes, centrifuge (13000 rpm, 1 minute), and collect the DNA solution.

[0052] Agarose gel (1%) electrophoresis was used to observe the purification effect of the recovered and purified PCR products. If qualified, the products were transferred to new EP tubes, marked and stored in a -20°C refrigerator.

[0053] 2.1.2 Recombinant vector construction

[0054] The Rv0222 gene expression fragment obtained by the above amplification was cloned into the vector pMV261 (the nucleotide sequence is shown as SEQ ID NO: 4) to obtain a recombinant vector.

[0055] (1) Activation of pMV261 plasmid

[0056] The pMV261 seed solution was taken out of the -80℃ refrigerator and thawed. The solution was picked up with an inoculation loop and streaked onto a kanamycin-resistant (50μg / mL) LB plate. The plate was inverted and placed in a 37℃ bacterial incubator for overnight culture. A single colony was picked up with a 10μL pipette tip and inoculated into a kanamycin-resistant (50μg / mL) LB medium (liquid). The plate was shaken and cultured on a shaker for 12h (37℃, 220rpm). The pMV261 plasmid was extracted according to the method provided in the instructions of the plasmid extraction kit. The operation steps are as follows: 5mL of logarithmic growth phase bacterial solution was collected, centrifuged at room temperature (12000rpm, 1min) to collect the bacteria, and the supernatant was discarded. 250μL of Solution I reagent was added to the EP tube and the bacteria were resuspended. 250μL of Solution II reagent was added to the EP tube and slowly flipped several times to fully lyse the bacteria until the solution became clear. 350μL of Solution III reagent was added and slowly flipped several times until a white precipitate appeared. Then centrifuge (12000rpm, 10min). Use a pipette to transfer the supernatant to the HiBind Miniprep column (placed in the collection tube in advance), centrifuge (13000rpm, 1min), and discard the liquid in the collection tube. Add 500μL of HB buffer, centrifuge (13000rpm, 1min), and discard the liquid in the collection tube. Add 700μL of DNAWash buffer, centrifuge (13000rpm, 1min), and discard the liquid in the collection tube. Repeat the operation once. Centrifuge the empty column (13000rpm, 2min) and let it stand for 3min to facilitate ethanol evaporation. Place the HiBind Miniprep column in a 1.5mL EP tube, add 30μL of Elution buffer at 65℃ in the middle position, let it stand for 2min, and obtain the plasmid after centrifugation (13000rpm, 5min).

[0057] The extracted plasmids were detected by agarose gel (1%) electrophoresis, and the qualified plasmids were transferred to -20℃ for storage.

[0058] (2) Enzyme digestion of pMV261 and target gene Rv0222

[0059] The pMV261 plasmid and the Rv0222 gene fragment were double-digested with EcoR I and HindⅢ, respectively, and the system is shown in Table 4 below:

[0060] Table 4 Enzyme digestion system

[0061]

[0062] After the system is prepared, mix gently and react in a 37°C water bath for 3 hours.

[0063] Take 2 μL of the reaction product and observe the enzyme cleavage effect by agarose gel (1%) electrophoresis. Then prepare a large-pore agarose gel, add the obtained enzyme cleavage product into the well for electrophoresis separation, and recover and purify after gel cutting. The operation steps are the same as before, and the recovered product is transferred to a -20°C refrigerator for storage for later use.

[0064] (3) Ligation and transformation of pMV261 and target gene Rv0222 fragment

[0065] The purity and concentration of the pMV261 plasmid and the Rv0222 gene were determined using an ultraviolet spectrophotometer, followed by ligation. The system is shown in Table 5 below:

[0066] Table 5 Connection system

[0067]

[0068] After the system is prepared, mix gently and place it in a PCR instrument at 22°C for 2 hours to complete the connection. Then, transform the connection product into E. coli DH5α competent cells. The operation steps are as follows:

[0069] Take out the frozen DH5α competent cells, thaw them on ice, take 8 μL of ligation product or 2 μL of plasmid and add them to the competent cells, mix slowly and gently, ice bath for 30 min, then heat shock at 42°C for 90 s, transfer to ice for 2 min, add 500 μL of LB liquid culture medium with a pipette, move to a 37°C incubator and shake for 45 min (200 r / min), take 100 μL of bacterial solution and evenly spread it on an LB plate with kanamycin resistance (50 μg / mL), invert the plate and culture at 37°C for 18-22 h, until a single colony appears.

[0070] (4) Screening and identification of pMV261 positive recombinant plasmid

[0071] Larger and rounder single colonies were picked, positive colonies were identified by colony PCR method, plasmids were extracted and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, and the plasmid with correct sequence was named pMV261-Rv0222.

[0072] PCR identification:

[0073] Use a sterilized 10μL pipette tip to pick up a single colony and transfer it into an EP tube containing 50μL ddH2O. After slowly blowing away the colony with a pipette, take 5μL of liquid as a template and complete PCR identification using the screening primers of Rv0222.

[0074] Table 6 PCR identification system

[0075]

[0076] The reaction conditions were the same as those in Tables 2 and 3. The length of the PCR product was determined by agarose gel (1%) electrophoresis.

[0077] Sequencing identification:

[0078] The correct transformants identified by PCR were cultured with an appropriate amount of medium and then preserved with 50% glycerol medium. A portion of the bacterial culture was sent to Shanghai Bioengineering for sequencing. When the homology between the original sequence and the measured sequence reached 99% and the amino acid homology reached 100%, the recombinant plasmid was successfully constructed.

[0079] (5) Preservation of recombinant plasmid

[0080] Plasmid storage: Extract the plasmid from E. coli containing the correct recombinant plasmid and store it at -20℃.

[0081] Storage of bacterial solution: Add sterilized glycerol to the E. coli bacterial solution containing the correct recombinant plasmid in a ratio of 1:1, mix well and store at -80℃.

[0082] 2.2 Construction of recombinant Mycobacterium smegmatis Ms_Rv0222

[0083] 2.2.1 Preparation of M. smegmatis competent cells

[0084] Thawing cryopreserved M.smegmatis mc 2 155 bacterial liquid, use an inoculation loop to pick up the bacterial liquid, streak inoculation on M7H10 solid plate (i.e., Michaelis 7H10 agar medium, purchased from BD Company, USA), invert and place in a bacterial incubator for 4 days. Use a 10μL gun tip to pick up a single colony and transfer it to M7H9 medium (i.e., Michaelis 7H9 liquid medium, purchased from BD Company, USA), place it in an incubator and shake and culture for 48h (37°C, 180rpm), and then use a medium containing 15% glycerol for seed preservation. The preparation of competent cells is as follows:

[0085] Take 100 μL of M. smegmatis mc 2 155% seed culture solution was added to 5 mL M7H9 medium and placed in an incubator for shaking culture for 48 h (37°C, 180 rpm). Then 1 mL of the culture solution was added to 100 mL M7H9 liquid medium and cultured with shaking until OD 600 Between 0.6 and 0.8. Place 100 mL of bacterial solution in an ice bath for 30 min, then centrifuge at 4°C, 4500 rpm for 10 min, discard the supernatant, and resuspend the cells in 100 mL of pre-cooled 10% glycerol.

[0086] Centrifuge at 4°C, 4500rpm for 15min, discard the supernatant, and resuspend the cells in 50mL of pre-cooled 10% glycerol; Centrifuge at 4°C, 4500rpm for 15min, discard the supernatant, and resuspend the cells in 20mL of pre-cooled 10% glycerol; Centrifuge at 4°C, 4500rpm for 20min, discard the supernatant, and resuspend the cells in an appropriate amount of pre-cooled 10% glycerol, with a final concentration of approximately 1-3×10 9 / mL; distribute the prepared competent cells into 200 μL / tube and store them at -80℃.

[0087] 2.2.2 Electroporation transformation of M. smegmatis

[0088] Take the M. smegmatis competent cells out of the refrigerator and slowly thaw them on ice, and pre-cool the electrode cup.

[0089] Add 1-2μg pMV261-Rv0222 plasmid to the competent cells, mix them by blowing gently and slowly, add them to the electrode cup with an electrode spacing of 0.2cm, and place them in an ice bath for 1min. Adjust the electroporator, set the voltage to 2.5KV, the capacitance to 25μF, and the resistance to 100Ω; wipe off the moisture on the electrode cup and place it in the designated position in the electroporator, and start electroporation. After the electroporation is completed, immediately add 1mL of 10% OADCM7H9 culture medium (purchased from BD Company, USA) and gently blow to disperse the bacteria. Aspirate the mixed bacterial solution into a 1.5mL EP tube and shake and culture in a bacterial incubator for 2h (37℃, 180rpm); take 100μL of bacterial solution and evenly spread it on the kanamycin-resistant M7H10 plate, invert it and place it in a 37℃ bacterial incubator for 4d. In addition, take 1 tube of competent cells, add 1mL M7H9 culture medium and gently blow the bacteria away, then take 100μL of bacterial solution and plate it as a negative control.

[0090] 2.2.3 Identification of Ms_Rv0222

[0091] (1) Identification of recombinant M. smegmatis

[0092] Pick a single colony of M.smegmatis and inoculate it in 10mL M7H9 liquid medium containing kanamycin (25μg / mL), and culture it at 37℃, 180rpm shaking for 48h. Collect the bacteria by centrifugation at 12000rpm for 2min at room temperature, wash twice with sterile distilled water, resuspend the bacteria with 200μL sterile distilled water, place in a metal bath (99℃) for 30min, and then centrifuge at 12000rpm for 1min, and take the supernatant for PCR identification. The PCR reaction system and conditions are detailed in the above identification method, and the empty plasmid is used as the negative control group.

[0093] The results are as follows Figure 2As shown, the present invention obtains a gene amplification product consistent with the expected size, that is, the Rv0222 gene is correctly cloned into the Mycobacterium smegmatis.

[0094] (2) Protein level detection of Rv0222 recombinant protein

[0095] Ms_Rv0222 and Ms_Vec (empty vector recombinant Mycobacterium smegmatis) were cultured in 100 mL of 10% OADC M7H9 medium until OD 600 Approximately equal to 0.6. Place the culture bottle in a 42℃ water bath, heat induce for 4 hours, centrifuge at 8000rpm for 5 minutes to collect the bacteria, and wash with PBS three times. Resuspend the bacteria with 10ml PBS, and lyse the bacteria with an ultrasonic disruptor in an ice water bath. Centrifuge at 10000rpm for 10 minutes, and collect the supernatant for later use.

[0096] 20 μL of Ms_Rv0222 and Ms_Vec supernatants were taken as samples to be tested. Since the recombinant bacteria already carried 6×His histidine tag protein, Mouse His-tag antibody was selected as the primary antibody, and the expression of Rv0222 protein was identified by Western-Bolt experiment.

[0097] Western-Bolt identification results are as follows Figure 3 As shown, the recombinant bacteria Ms_Rv0222 showed a positive band at about 29 kDa, while the wild-type Mycobacterium smegmatis strain had no positive band at this location, indicating that the recombinant Mycobacterium smegmatis successfully expressed the target protein that can specifically bind to the antibody.

[0098] Example 2 Functional Verification

[0099] The function of the target product expressed by the recombinant bacterium Ms_Rv0222 constructed in Example 1 was verified.

[0100] 1. Rv0222 enhances the virulence of M. smegmatis

[0101] Macrophages RAW264.7 were infected with wild-type M.smegmatis and Ms_Rv0222, and bacterial survival in macrophages was recorded after 6, 24, and 48 hours. RAW264.7 cells were infected with wild-type M.smegmatis and Ms_Rv0222, and the mRNA expression levels of proinflammatory cytokines IL-1β, IL6, and TNFα were detected using conventional corresponding commercial detection kits after infection.

[0102] Ms_Rv0222 was injected intraperitoneally into mice, with 5×10 7CFU Mycobacterium smegmatis was used to detect the number of bacteria in the lungs, livers and spleens of mice after 3, 6 and 9 days. The lung, liver and spleen tissues of mice were obtained and pathological sections were made to observe the pathological changes.

[0103] The results showed that the survival rate of Ms_Rv0222 in RAW264.7 cells was significantly higher than that in the control group, and the expression of IL-1β, IL6, and TNFα mRNA in RAW264.7 cells was inhibited, revealing the role of Rv0222 in inhibiting macrophage innate immunity and promoting bacterial survival in cells. The survival rate of Ms_Rv0222 in various organs of mice was significantly higher than that in the control group. Pathological section results showed that the degree of inflammation in the lungs, livers, and spleens of mice infected with Ms_Rv0222 was significantly deeper than that in the control group.

[0104] 2. Ms_Rv0222 regulates miRNA expression levels

[0105] After Ms_Rv0222 infected Raw264.7 cells, wild-type M.smegmatis was used as the control group to detect changes in cellular miRNA expression levels; Ms_Rv0222 infected mice, and wild-type M.smegmatis was used as the control group, and mouse lung tissues were collected to detect miRNA expression levels. Wild-type M.smegmatis infected macrophages, and the survival of intracellular bacteria was detected in Raw264.7 cells with overexpression and inhibition of miR-9. Wild-type M.smegmatis infected macrophages, and the mRNA expression levels of pro-inflammatory cytokines IL-1β, IL6, and TNFα were detected in Raw264.7 cells with overexpression and inhibition of miR-9.

[0106] The results showed that compared with the control group, Ms_Rv0222 induced changes in the expression of multiple miRNAs in Raw264.7 cells, among which the expression level of miR-9 was significantly downregulated. Compared with the control group, Ms_Rv0222 induced downregulation of miR-9 expression in mouse lung tissue. In macrophages overexpressing miR-9, the levels of proinflammatory cytokines increased, and the survival rate of intracellular bacteria decreased significantly; in macrophages with inhibited miR-9 expression, the levels of proinflammatory cytokines decreased, and the survival rate of intracellular bacteria increased significantly. This suggests that Rv0222 can intervene in host innate immunity by regulating miR-9.

[0107] 3. Ms_Rv0222 regulates miRNA target protein levels

[0108] After Ms_Rv0222 infected Raw264.7 cells, wild-type M.smegmatis was used as the control group. Cells were collected at 2h, 4h, and 8h after infection to detect the expression level of miR-9 target protein SIRT1. Wild-type M.smegmatis was used to infect Raw264.7 cells transfected with si-SIRT1 (purchased from Shanghai Jima Pharmaceutical Technology Co., Ltd.) to detect bacterial intracellular survival and pro-inflammatory cytokine levels.

[0109] The results showed that compared with the control group, the expression level of SIRT1 in cells was upregulated after Ms_Rv0222 infection. In macrophages treated with si-SIRT1, the levels of proinflammatory cytokines increased and the intracellular survival rate of bacteria decreased. This suggests that SIRT1 is involved in regulating host innate immunity and si-SIRT1 is a potential means to target the virulence of Rv0222.

[0110] Therefore, Ms_Rv0222 of the present invention verifies the toxic effect of Rv0222 and can be used to study the host innate immune mechanism regulated by Rv0222. Ms_Rv0222 of the present invention clarifies the Rv02222 / miR-9 / SIRT1 regulatory pathway and finds a new target for the development of anti-tuberculosis drugs targeting Rv0222, which is of great significance for the prevention and treatment of tuberculosis.

[0111] Sequence shown in SEQ ID NO: 1:

[0112] atgagcagcgaaagcgacgcagccaacaccgaacctgaggttctggtagaacagcgggatcggattttgatcatcacgatcaaccgcccgaaagccaagaacgcggtcaacgccgcagtcagccggggcttggccgatgcgatggatcagcttgacggcgatgccggcctgtcggtggcaatcctgaccggtgggggcggttcgttctgcgcgggcatggacctcaaggcgttcgcccggggcgagaatgtcgtcgtcgaaggtcgcggccttggctttaccgaacgtccgccgaccaagccgctcattgctgcggtggaaggctacgcgttggcgggtggcaccgagctggcgcttgctgccgacctgatcgtggcggccagggattcggcgttcgggattcctgaagtcaagcggggtctggttgccggcggcgggggattgctgcggttgccggagcgcatcccgtatgcgatagccatggagttggcgctgaccggtgacaacctaccggccgaacgcgcgcacgagctggggctcgtcaacgttttggccgagccggggaccgccctcgatgctgcgatcgcgttggcggagaagatcaccgccaatgggccgctggcggtggtggccaccaagcggattatcaccgagtcgcgtgggtggagtcccgacactatgttcgctgagcagatgaagatcctggtgccggtgttcacctccaacgacgcgaaggaaggtgcgatcgcgttcgccgagaggcgccggccccgttggacgggcacctag。

[0113] The sequence shown in SEQ ID NO: 4:

[0114]

[0115]

[0116]

[0129] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A recombinant Mycobacterium smegmatis expressing Rv0222, characterized in that: The recombinant Mycobacterium smegmatis is constructed by transferring the Rv0222 gene into Mycobacterium smegmatis. The nucleotide sequence of the Rv0222 gene is shown in SEQ ID No:

1.

2. A method for constructing a recombinant Mycobacterium smegmatis expressing Mycobacterium smegmatis, characterized in that: The following steps are involved: Cloning the Rv0222 gene and connecting it with an expression vector to construct a recombinant vector; The recombinant vector is electrotransformed into Mycobacterium smegmatis to construct the recombinant Mycobacterium smegmatis expressing Rv0222.

3. The construction method according to claim 2, characterized in that: The nucleotide sequence of the Rv0222 gene is shown in SEQ ID NO:

1.

4. The construction method according to claim 2, characterized in that: The primers for cloning the Rv0222 gene are shown in SEQ ID NO: 2-3.

5. The construction method according to claim 2, characterized in that: The expression vector includes pMV261.

6. Use of the recombinant Mycobacterium smegmatis as claimed in claim 1 in preparing a cell model or an animal model for screening anti-tuberculosis drugs.

7. Use of the recombinant Mycobacterium smegmatis as claimed in claim 1 in the preparation of an anti-tuberculosis drug targeting Rv0222.

8. Use of the recombinant Mycobacterium smegmatis as claimed in claim 1 in screening targets for inhibiting the regulation of innate immunity by Rv0222 in host cells or targets for anti-tuberculosis drugs targeting Rv0222.

9. The use according to claim 8, characterized in that The host cells include macrophages.

10. Use of the recombinant Mycobacterium smegmatis according to claim 1 in the preparation of a drug for preventing or treating tuberculosis.

Images