An interfering engineering bacterium for blocking early infection of animal parasitic nematodes and its application

Abstract

The present invention discloses an interfering engineering bacterium for blocking early infection of animal parasitic nematodes and its application, belonging to the field of animal parasitic disease prevention and treatment. The interfering engineering bacterium in the present application specifically silences the contorted nematode HCON_00038080 ( cyp‑22a1 ) gene, inhibiting the biosynthesis of endogenous bile acid-like steroid hormones in the worm, affecting the activation of infective larvae, and blocking the infection establishment process. The present invention can be used to prevent early infection of haemonchus nematodes in ruminants such as cattle, sheep, and camels, as well as the "spring / perinatal climax" phenomenon, and has a high application value for the prevention and control of haemonchus nematodes, and has a reference value for the prevention and control of parasitic nematodes in other animals.

Description

Technical Field

[0001] The present invention relates to the field of animal parasitic disease prevention and treatment, and in particular to an interfering engineered bacterium for blocking early infection of animal parasitic nematodes and its application. Background Art

[0002] Animal parasites include both external and internal parasites. Internal parasites include flukes, tapeworms, and nematodes. These diverse species feed on the host's blood, tissue fluids, and chyme, often causing tissue damage, inflammation and secondary infection, anemia, emaciation, developmental delay, and even death. Some parasitic nematodes can infect a wide range of animals and humans, making their prevention and control of these nematodes of great veterinary and public health importance.

[0003] Animal parasitic nematode infections cause tens of billions of dollars in direct economic losses to the global livestock industry annually, and also pose a significant threat to the high-quality breeding of important economic animals in my country, such as cattle, sheep, pigs, and chickens. Due to the current lack of effective vaccines against major livestock and poultry parasitic nematodes, chemical deworming remains the mainstay of animal nematode control. However, long-term, large-scale, and unregulated drug use has led to the development of drug resistance in animal parasitic nematodes. Among these, drug resistance in animal parasitic nematodes is the most serious. For example, Haemonchus contortus—a highly pathogenic parasitic nematode that is widespread in ruminants such as cattle, sheep, and camels—can develop resistance to new antiparasitic drugs within two years. Globally, Haemonchus contortus exhibits significant multidrug resistance to commonly used anthelmintics such as ivermectin and albendazole, making it a model organism for research on drug resistance in animal parasitic nematodes and drug development.

[0004] The eggs of many animal parasitic nematodes are excreted in feces. In the environment, they develop through the first and second larval stages into the infective third larval stage. Once inside an animal, the infective larvae must activate, developing through the fourth larval stage into adults. Due to seasonal and immune factors, the infective larvae of some animal parasitic nematodes (e.g., Haemonchus contortus and Toxocara canis) fail to fully activate after entering the host, resulting in a "diapause" phenomenon. These diapause larvae activate in large numbers in spring, during the perinatal period, or during the lactation period, causing widespread disease in animals, a phenomenon known as the "spring / perinatal surge." "Deep winter deworming" was once used to eliminate diapause larvae in animals, but the emergence of drug resistance has made the prevention and control of this "spring / perinatal surge" increasingly difficult, posing a significant challenge to the prevention and control of animal parasitic diseases.

[0005] RNA interference (RNAi) technology is a common method for gene knockdown in eukaryotes. It has been widely used in reverse genetics (gene function) studies of animals, plants, and pathogens (bacteria, viruses, and parasites). It has also had a positive impact on therapeutic strategies for a wide range of diseases, including pathogenic infections, inflammation, and cancer. Electroporation, microinjection, feeding, and immersion methods have enabled the introduction of interfering agents (double-stranded RNA, small interfering RNA, etc.) into animal parasitic nematodes, resulting in specific RNAi effects. Based on the phenotypic information (decreased activity, developmental delay, decreased virulence, and death) observed in RNAi-induced nematodes, the underlying function of the target gene can be deduced and its potential as an intervention target. Currently, RNAi targeting specific target genes is emerging as a new approach for preventing and controlling parasitic nematode infections in animals.

[0006] Cytochromes P450s (CYPs) are a class of heme proteins widely found in organisms including animals, plants, bacteria, fungi, and parasites. They are essential components of the multifunctional oxidase system in living organisms. Numerous cross-species studies have demonstrated that CYPs, as essential components of the oxidase system, play a crucial role in the metabolism, decomposition, and detoxification of exogenous harmful substances such as drugs, pesticides, and environmental pollutants. Furthermore, numerous studies using model organisms have revealed that CYPs are involved in the synthesis and metabolism of numerous endogenous bioactive substances, including fatty acids, steroid hormones, and pheromones. Some CYPs have been found to play a crucial role in the tolerance of animal parasitic nematodes to anthelmintic drugs and in their development. Currently, broad-spectrum CYP inhibitors have been used in research on the prevention and control of strongyloidiasis autoinfection in mice.

[0007] Currently, there is a lack of effective vaccine immunization programs for animal parasitic nematode infections. Chemical anthelmintics remain the main means of controlling animal parasitic nematode infections, but drug resistance is serious and does not conform to the advocacy of "reducing and banning antibiotics." In addition, chemical anthelmintics are basically ineffective against diapausing larvae. Although in vitro screening studies have been conducted on RNAi target genes for animal parasitic nematodes, in vivo animal experiments are lacking for verification, and there are no specific feasible technical solutions. In particular, there are currently no RNAi targets for intervening in the activation of diapause larvae in vivo. Although broad-spectrum CYP inhibitors can have a certain anthelmintic effect by intervening in the development process of nematodes, they are also toxic to host animals and humans, and are not suitable for promotion and use in livestock and poultry farming. Summary of the Invention

[0008] The present invention aims to address the deficiencies of the existing technology and propose an interfering engineered bacterium and its application for blocking early infection of animal parasitic nematodes. The invention is based on a bacterium that plays a key role in the activation and infection of infective larvae of Haemonchus contortus (including diapause larvae in the host). cypGenes are detected, specific double-stranded RNA (dsRNA) amplification primers are designed, and engineered bacteria that can express specific interfering RNA are constructed. These bacteria are introduced into infective nematode larvae through feeding, effectively knocking down target genes and intervening in the activation process of infective or diapause larvae in the host, thereby blocking nematode infection and preventing and controlling nematode diseases.

[0009] The purpose of the present invention is achieved through the following technical solutions: an interference engineering bacterium for blocking early infection of animal parasitic nematodes, constructing an expression vector for Haemonchus contortus cyp-22A1 The L4440 vector plasmid of the homologous gene double-stranded RNA was transformed into competent Escherichia coli to obtain interference engineering bacteria;

[0010] Express cyp-22A1 The primers for amplifying double-stranded RNA of homologous genes are:

[0011] Upstream primer: 5′–CATCATCCAAGATTTCGTGTTAGGC–3′ (SEQ ID No. 1);

[0012] Downstream primer: 5′–TGGCTGCTCGTCTCCGAACACCTGG–3′ (SEQ ID No. 2).

[0013] Furthermore, the expression cyp-22A1 The double-stranded RNA of the gene is 480 bp in length.

[0014] Furthermore, the cyp-22A1 The homologous gene is a target molecule that plays a key role in the activation of infective larvae of Haemonchus contortus.

[0015] Furthermore, the interference engineering bacteria are used to feed the second-stage larvae of animal parasitic nematodes, reducing cyp-22A1 It can also reduce the transcription level of genes, inhibit the activation and development of the third-stage infective larvae, and block the infection process.

[0016] Furthermore, the biological information of Helicoverpa polymorpha, Angiostrongylus annularis, Nippostrongylus brasiliensis, Angiostrongylus cantonensis, Dictyocaulus viviparus, Hookworm, Gaultier's Cup nematode, Oesophagostomum dentata, and Strongyloides were mined and analyzed, and the contorted Haemonchus contortus was identified. cyp-22A1 orthologous genes.

[0017] Furthermore, the construction method of the interference engineering bacteria includes the following steps:

[0018] (1) Collect and purify infective larvae of Haemonchus contortus, and perform RNA extraction and reverse transcription reaction;

[0019] (2) Hc-18sThe gene was used as an internal reference, and the specific primers were used for qPCR reaction to analyze the expression of cyp Transcription levels of genes at various developmental stages of nematodes;

[0020] (3) Screening of key genes involved in nematode activation and infection through host serum stimulation test and relative transcription level analysis cyp Gene cyp-22A1 , and validate them as intervention targets;

[0021] (4) Design of Haemonchus contortus cyp-22A1 Gene double-stranded RNA amplification primers were used to construct the interference plasmid L4440- cyp-22A1 , transformed into Escherichia coli HT115 competent cells to obtain interfering engineered bacteria for blocking early infection of animal parasitic nematodes.

[0022] On the other hand, the present invention also provides a use of the interfering engineered bacteria in blocking early infection of animal parasitic nematodes.

[0023] Furthermore, the drug is introduced into the body of infective nematode larvae through feeding to prevent the "spring / perinatal climax" phenomenon of ruminant Haemonchus nematode disease caused by the activation of diapause larvae.

[0024] The present invention provides a biological technology solution that effectively blocks and controls parasitic nematode infections in animals, independent of chemical anthelmintics. This solution leverages the development-infection process of animal parasitic nematodes and targets RNAi genes for parasitic nematodes that have been validated in in vivo animal studies. It exhibits high specificity and poses no potential threat to the health of livestock, poultry, or humans.

[0025] Among them, it will be possible to express cyp-22A1 After the engineered bacteria containing dsRNA gene were fed to the second-stage larvae of Haemonchus contortus in the external environment, the third-stage infective larvae cyp-22A1 The transcription level of the gene decreased by more than 50%; cyp-22A1 After gene knockdown, the third-stage infective larvae were developmentally arrested after desheathing in vitro (artificial activation); cyp-22A1 After the knockdown of the gene, the third-stage infective larvae were fed to 4 Hu sheep for 21-63 days, the number of eggs in the feces was 0, and the number of adults was 0 after autopsy; this proves that the gene constructed by the present invention can express cyp-22A1 The double-stranded RNA interference engineered bacteria significantly reduced the number of infective third-stage larvae. cyp- 22A1 The transcription level of the gene is reduced, and its infection-development process in the host is 100% blocked. The method of the present invention is expected to serve as a new strategy for the prevention and control of animal parasitic nematode infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0027] Figure 1 The developmental stages of Haemonchus contortus cyp Schematic diagram of gene transcription levels;

[0028] Figure 2 It is the key to the activation and infection establishment of Haemonchus contortus larvae. cyp Schematic diagram of gene screening;

[0029] Figure 3 Schematic diagram showing that Dafadine A is a nonspecific CYP inhibitor, where (A) is the molecular docking of CYP-22A1 protein and dafadine A; (B) is the effect of Dafadine A on the biosynthesis of dafamic acid DA in Haemonchus contortus; (C) is the effect of Dafadine A on other CYPs in Haemonchus contortus. cyp Effects on gene transcription levels;

[0030] Figure 4 This is a schematic diagram of the process by which feeding engineered bacteria to second-stage larvae can block the infection of Haemonchus contortus in vivo, where (A) shows the effect of feeding on Haemonchus contortus. cyp-22a1 Knockdown analysis of gene transcription; (B) Effect of feeding the second-stage larvae of Haemonchus contortus with engineered bacteria on the in vitro development of the infective third-stage larvae; (C) Effect of feeding the second-stage larvae of Haemonchus contortus with engineered bacteria on the number of feces eggs of infective third-stage larvae 21-63 days after gavage in Hu sheep; (D) Effect of feeding the second-stage larvae of Haemonchus contortus with engineered bacteria on the number of adults of infective third-stage larvae 63 days after gavage in Hu sheep.

[0031] Figure 5 yes cyp-22A1 Genes in Haemonchus contortus and Helicoverpa polymorpha ( Heligmosomoides polygyrus ), Annular Band Nematode ( Teladorsagia circumcincta ), Nippostrongylus brasiliensis ( Nippostrongylus brasiliensis ), Angiostrongylus cantonensis ( Angiostrongylus cantonensis )、Dictyocaulus viviparus( Dictyocaulus viviparus ),hookworm( Ancylostoma sp.with Necator americanus ), Gouldian nematode ( Cylicostephanus goldi ), Oesophagostomum dentata ( Oesophagostomum dentatum ), Strongyloides ( Strongylus vulgaris) is a schematic diagram of the identification results. DETAILED DESCRIPTION

[0032] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described below with reference to the accompanying drawings and examples. It should be understood that the specific examples described herein are only used to explain the present invention and are not intended to limit the present invention.

[0033] Cytochrome P450s (CYPs) are involved in important biological processes such as parasitic nematode metabolism and degradation of xenobiotics, drug resistance formation, nematode development, and lifespan regulation. This study uses Haemonchus contortus as a model organism (using Haemonchus contortus as a model organism for screening new anthelmintic drug targets is a well-known technical method in the art) to screen for key CYPs encoding genes involved in the activation of infectivity / diapause larvae of animal parasitic nematodes ( cyp ), and attempted to conduct RNAi analysis of target genes through feeding method to block larval activation and subsequent infection and development processes, so as to achieve the purpose of preventing and controlling nematode infection.

[0034] The present invention provides an interference engineering bacterium for blocking early infection of animal parasitic nematodes, and constructs an expression vector for Haemonchus contortus cyp-22A1 The L4440 vector plasmid of the homologous gene double-stranded RNA was transformed into competent Escherichia coli to obtain interference engineering bacteria;

[0035] Express cyp-22A1 The primers for amplifying double-stranded RNA of homologous genes are:

[0036] Upstream primer: 5′–CATCATCCAAGATTTCGTGTTAGGC–3′ (SEQ ID No. 1);

[0037] Downstream primer: 5′–TGGCTGCTCGTCTCCGAACACCTGG–3′ (SEQ ID No. 2).

[0038] The expression cyp-22A1 The double-stranded RNA of the gene is 480 bp in length.

[0039] First, 23 species of Haemonchus contortus were analyzed. cyp The transcriptional levels of most genes in various developmental stages of nematodes were found cyp The genes are highly expressed in the infective larval stage ( Figure 1 Through host serum stimulation test and relative transcription level analysis, we further screened out the key genes that may be involved in nematode activation and infection. cyp Gene – HCON_00038080 / cyp-22A1 ( Figure 2 ).

[0040] Secondly, the binding characteristics of the known CYP inhibitor dafadine-A and the protein structure of the model organism Caenorhabditis elegans CYP-22A1 were analyzed through molecular docking technology based on structural biology. It was confirmed that dafadine-A can also bind to the CYP-22A1 of Haemonchus contortus. The addition experiment of the CYP inhibitor dafadine-A was carried out to further analyze the function of CYP-22A1 in Haemonchus contortus (taking dafamic acid biosynthesis as an example). It was confirmed that dafadine-A can inhibit the biosynthesis of dafamic acid, but it also affects many other cyp The transcription level of the gene suggests that dafadine-A is not a specific inhibitor of a certain CYP ( Figure 3 ).

[0041] To clarify the role of CYP-22A1 in larval activation, we designed a nematode worm, Haemonchus contortus. cyp-22A1 The double-stranded RNA amplification primers (upstream primer: 5'-tcaagcttatcgataccgCATCATCCAAGATTTCGTGTTAGGC-3' (SEQ ID No. 3); downstream primer: 5'-ccgggccccccctcgaggTGGCTGCTCGTCTCCGAACACCTGG-3' (SEQ ID No. 4)) were used. sal Ⅰ Construction can express cyp-22A1 The L4440 plasmid containing double-stranded RNA of the gene was transformed into competent Escherichia coli HT115. The transformed engineered bacteria were fed to the second-stage larvae of Haemonchus contortus (it is a well-known technique in the art that the second-stage larvae of Haemonchus contortus feed on bacteria in the external environment). The infective larvae that developed to the third stage were collected and gene knockdown analysis was performed to confirm that the engineered bacteria feeding method can significantly reduce the infective larvae. cyp-22A1 The transcription level of genes. When the infective larvae fed with the engineered bacteria were infected with Hu sheep, it was found that compared with the control group, they failed to establish infection in the Hu sheep and failed to develop into adults and lay eggs (the third-stage larvae of Haemonchus contortus establish infection after entering the host, develop into adults, mate and lay eggs, which is a well-known technical means in the field), indicating that the infection process of Haemonchus contortus has been blocked ( Figure 4 ).

[0042] Finally, if Figure 5 As shown in the figure, the biological information of common nematodes in livestock and poultry, such as Helicoverpa polymorpha, Angiostrongylus annularis, Nippostrongylus brasiliensis, Angiostrongylus cantonensis, Dictyocaulus viviparus, Hookworm, Corynebacterium gaultieri, Oesophagostomum dentata, and Strongyloides, was mined and analyzed, and Haemonchus contortus was identified. cyp-22A1 The orthologous genes of cyp-22A1It and its analogs are relatively conserved target genes in animal parasitic nematodes and can be widely used in the activation of animal parasitic nematode larvae and the blocking of early infection.

[0043] In summary, the present invention uses the screened nematodes that play a key role in the activation of infective larvae of Haemonchus contortus cyp-22A1 Gene is the target molecule, and the construct can express cyp-22A1 The engineered bacteria expressing double-stranded RNA were used to feed the second-stage larvae of Haemonchus contortus in the environment, which significantly reduced the incidence of infective third-stage larvae. cyp-22A1 The researchers used a single-stranded nematode gene to knock down the transcription level of the gene, completely blocking its infection-development process in the host. This method is expected to serve as a new strategy for preventing and controlling parasitic nematode infections in animals.

[0044] Based on the above design process, the specific embodiments provided by the present invention are as follows:

[0045] Example 1: Analysis of CYPs transcription levels at various developmental stages of Haemonchus contortus

[0046] (1) Collecting parasitic nematodes at various developmental stages

[0047] Feces infected with Haemonchus contortus were collected and eggs were enriched by flotation in saturated saline. The eggs were resuspended in D-Hank's medium and incubated on agar plates at 28°C. L1 larvae were collected after 24 hours, L2 larvae after 72 hours, and L3 (infective) larvae after 168 hours. L4 larvae and adults were obtained by dissecting the abomasum of infected animals. Collected worms were snap-frozen in liquid nitrogen and stored at -80°C until further use.

[0048] (2) Total RNA extraction (TRIzol method) and reverse transcription reaction

[0049] Transfer an appropriate amount of collected parasites to a 1.5 mL grinding tube, add 1 mL of trizol and 3 grinding beads, grind at 60 Hz for 180 seconds, and let stand at room temperature for 10 minutes to fully lyse. Add 0.2 mL of chloroform, shake vigorously for 10 seconds, let stand for 10 minutes, and then centrifuge at 12,000 rpm / 4°C for 10 minutes. Carefully aspirate the upper aqueous phase into a fresh centrifuge tube, add an equal volume of isopropanol, mix, let stand at room temperature for 10 minutes, and then centrifuge at 12,000 rpm / 4°C for 10 minutes to precipitate RNA. Discard the supernatant and wash the RNA precipitate two to three times with 1 mL of 75% (v / v) ethanol. Centrifuge to remove the ethanol and dry for 10 minutes until the white RNA precipitate becomes transparent. Dissolve the precipitate in an appropriate amount of RNase-free water, analyze the quality of the precipitate using a micro-nucleic acid analyzer, and then perform reverse transcription using FSQ-301 reagent.

[0050] (3) Fluorescence quantitative PCR

[0051] by Hc-18s The gene was used as an internal reference, and qPCR reactions were performed using specific primers.

[0052] The qPCR reaction system was as follows: pre-denaturation at 95°C for 30 sec, denaturation at 95°C for 10 sec, annealing at 60°C for 10 sec, and fluorescence information was collected for 40 cycles; denaturation at 95°C for 15 sec, annealing at 60°C for 60 sec, and denaturation at 95°C for 15 sec, and melting curve information was collected.

[0053] The obtained CT values ​​were converted into 2 -ΔCT The relative quantitative analysis was performed by comparing the values, the significance was analyzed by t-test and one-way analysis of variance, and the software GraphPad Prism 8.0 was used to draw graphs to analyze the transcription levels of CYPs genes at different developmental stages of the insect body. The results are shown in Figure 2. Figure 1 shown.

[0054] Example 2: Key factors involved in infecting the host cyp Filter

[0055] (1) Preparation of exocyst L3 (xL3) larvae

[0056] Collect L3 larvae of Haemonchus contortus and add 1 mL of 0.9% (w / v) sodium hypochlorite (NaClO) solution. Shake at 190 rpm at 37°C for 20 minutes to allow for complete desheathing. Wash the larvae five times with 1 mL of saline, centrifuging at 800 g for 5 minutes each time to fully remove the NaClO.

[0057] (2) Serum stimulation of larvae

[0058] Dilute the cells with DMEM supplemented with 10% (v / v) sheep serum to a density of approximately 6 cells / μL and transfer them to a 96-well plate for culture (50 μL / well). A serum-free control group should also be established. Incubate the 96-well plate in a 38°C, 10% CO2 incubator for 48 hours.

[0059] (3) qPCR reaction detection cyp Changes in gene transcription levels.

[0060] The culture medium in the experimental and control groups was collected and centrifuged at 800 g for 5 min, and the supernatant was discarded to enrich the worms. qPCR primers for different CYPs encoding genes were designed and amplified. The results are shown in Figure 2. Figure 2 shown.

[0061] Example 3: Further validation of CYP-22A1 as an intervention target

[0062] (1) Molecular docking of CYP-22A1 (HCON_00038080) and dafadine A

[0063] The 3D protein structure of CYP-22A1 was previously obtained through AlphaFold2 simulation. The protein was preprocessed using the "Prepwiz" module of Schrödinger's software. This involves modeling calculations, bond order assignment, charge assignment, hydrogen atom addition, and creation of missing side chains or ring atoms, converting the target protein into a form suitable for ligand docking.

[0064] The chemical structure of dafadine A was downloaded from PubChem. The ligand file was converted to the lowest-energy three-dimensional structure using the "LigPrep" module of the Schrödinger software. Standardization processes such as hydrogenation, charge addition, and molecular conformation generation were performed to facilitate subsequent docking.

[0065] Protein-molecule docking was performed using the prepared CYPs protein as the receptor and the dafadine A molecule as the ligand using the software Maestro V11.8. The "Glide" module in the software was used to generate a receptor grid containing docking sites and possible conformations of the ligand. The Monte Carlo method was used to minimize the energy score and output a docking score table. The docking results were visualized and analyzed using the software PyMOL V2.5 (Schrödinger) (Delano, 2002). The results are shown in Figure 2. Figure 3 As shown in A.

[0066] (2) Analysis of differences in dafadine A metabolism in larvae after treatment with dafadine A

[0067] The lipids of the larval samples were extracted after appropriate treatment. The extracted lipids were homogenized by adding 40% (v / v) methanol and zirconium oxide beads. Chloroform twice the volume of methanol was added and centrifuged at 10,000 × g for 10 minutes at room temperature to separate the aqueous and organic phases. The organic phase was retained, dried, and resuspended in methanol. Subsequent mass spectrometry analysis was performed using an Orbitrap Fusion Lumos mass spectrometer. The results are shown in Figure 2. Figure 3 As shown in B.

[0068] (3) Differential expression analysis of larval CYPs-encoding genes after Dafadine A treatment

[0069] The real-time fluorescence quantitative PCR operation steps and data analysis methods in Example 2 were used to analyze the changes in the transcription levels of the genes encoding CYPs after treatment with dafadine A. The results are shown in Figure 2. Figure 3 As shown in C.

[0070] Example 4: RNA interference cyp-22A1 Verification of post-target blocking effect

[0071] (1) cyp-22A1 (HCON_00038080) Interference strain construction and feeding

[0072] The interference plasmid L4440- cyp-22A1 , respectively, L4440 no-load, L4440- cyp- 22A1 Transform into E. coli HT115 competent cells and perform PCR identification using universal primers L4440 F / R. Expand the positive clones and add them to the culture plate to feed the larvae. After culture, collect the larvae and extract RNA for qPCR reaction to confirm the interference effect, such as Figure 4 As shown in A.

[0073] (2) Phenotypic identification after interference

[0074] After the interference, the development of nematodes was continuously observed. It was found that the oral sac of infected larvae was not developed and the worm body was curled up compared with the control group (e.g. Figure 4 B in the figure); feeding the disturbed strain to Hu sheep showed a significant decrease in EPG compared to the control group (e.g. Figure 4 C in the figure); at the same time, the number of adult worms in the abomasum was significantly decreased compared with the control group (e.g. Figure 4 D in the figure).

[0075] Example 5: Bioinformatics Analysis of Nematode CYPs

[0076] Based on Caenorhabditis elegans cyp Gene information, using the EnsemblCompara GeneTrees pipeline tool to identify dozens of selected nematode species and Caenorhabditis elegans cyp Gene 1-to-1 (red dots) and 1-to-many (orange dots) orthologs. Amino acid sequences were obtained from the WormBase ParaSite database and analyzed using InterProScan software. cyp -family structure can be considered as CYP candidate sequences. Candidate sequences were corrected by bidirectional optimal BLAST. cyp Orthologs were considered valid identifications. Orthologs that were not identified and classified into a nematode clade were manually aligned.

[0077] The above embodiments are used to illustrate the present invention rather than to limit the present invention. Any modifications and changes made to the present invention within the spirit of the present invention and the protection scope of the claims shall fall within the protection scope of the present invention.

Claims

1. An interfering engineering bacterium for blocking early infection of animal parasitic nematodes, characterized in that: The selected genes play a key role in the activation of infective larvae of Haemonchus contortus cyp-22A1 Gene as the target molecule, construct expression of Haemonchus contortus cyp-22A1 The L4440 vector plasmid of the double-stranded RNA of the gene was transformed into competent Escherichia coli to obtain the interference engineering bacteria; it was used to feed the second-stage larvae of the contorted nematode in the environment to reduce the infectiousness of the third-stage larvae. cyp-22A1 The transcription level of the gene blocks its infection-development process in the host; Express cyp-22A1 The primers for double-stranded RNA amplification are: Upstream primer: 5′–CATCATCCAAGATTTCGTGTTAGGC–3′ (SEQ ID No. 1); Downstream primer: 5'-TGGCTGCTCGTCTCCGAACACCTGG-3' (SEQ ID No. 2).

2. The interfering engineering bacteria for blocking early infection of animal parasitic nematodes according to claim 1, characterized in that: The expression cyp-22A1 The length of the double-stranded RNA gene is 480 bp.

3. The interfering engineering bacteria for blocking early infection of animal parasitic nematodes according to claim 1, characterized in that: The biological information of Helicoverpa polymorpha, Annularia spp., Nippostrongylus brasiliensis, Angiostrongylus cantonensis, Dictyocaulus viviparus, Corynebacterium gonioli, and Oesophagostomum dentata was mined and analyzed, and Haemonchus contortus was identified. cyp-22A1 orthologous genes.

4. The interfering engineering bacteria for blocking early infection of animal parasitic nematodes according to claim 1, characterized in that: The construction method of the interference engineering bacteria comprises the following steps: (1) Collect and purify infective larvae of Haemonchus contortus, extract RNA and perform reverse transcription reaction; (2) Hc-18s The gene was used as an internal reference, and the specific primers were used for qPCR reaction to analyze the expression of cyp Transcription levels of genes at various developmental stages of nematodes; (3) Screening out key genes involved in nematode activation and infection through host serum stimulation test and relative transcription level analysis cyp Gene cyp-22A1 , and validate them as intervention targets; (4) Design of Haemonchus contortus cyp-22A1 Gene double-stranded RNA amplification primers were used to construct the interference plasmid L4440- cyp-22A1 , transformed into Escherichia coli HT115 competent cells to obtain interfering engineered bacteria for blocking early infection of animal parasitic nematodes.

5. The interfering engineering bacteria for blocking early infection of animal parasitic nematodes according to claim 1, characterized in that: The interfering engineered bacteria are introduced into the body of the infective larvae of nematodes by feeding, and are used to prevent the "spring / perinatal climax" phenomenon of ruminant haemonchus disease caused by the activation of a large number of infective larvae.

Images