Method for synthesizing silphinene in saccharomyces cerevisiae by using sesquiterpene cyclase SilpS

Abstract

The invention relates to the technical field of biology, in particular to a method for synthesizing silphinene in saccharomyces cerevisiae by sesquiterpene cyclase SilpS. According to the invention, a novel sesquiterpene synthase SilpS is obtained through genome mining, a recombinant plasmid expressed by a SilpS gene is constructed, a SilpS gene expression cassette is transferred to a saccharomyces cerevisiae chromosome, and the obtained saccharomyces cerevisiae recombinant strain can realize high-level expression of silphinene; the yield of silphinene in the recombinant strain is 139.2 + / -2.2 mg / L, and the recombinant strain has a wide application prospect.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for synthesizing silphinene in saccharomyces cerevisiae by using sesquiterpene cyclase SilpS. Background Art

[0002] In the biosynthesis pathway of sesquiterpenoid natural products, the most critical enzyme that catalyzes the formation of sesquiterpenoid skeletons is sesquiterpenoid cyclase. Silphinene is a 5-5-5 tricyclic sesquiterpenoid skeleton molecule and an important precursor of the new biopesticide penifulvinA. In addition, the silphinane molecule generated by hydrogenation reduction of silphinene has a high density and calorific value, and is a high-density fuel with great application prospects.

[0003] Natural silphinene exists in the plant silphium sphaerocephalum, but the content is extremely low. In addition, due to its complex three-dimensional structure, chemical synthesis of silphinene is also difficult. With the rapid development of genome sequencing technology and bioinformatics analysis methods, it provides a great opportunity to construct high-yield silphinene strains by exploring new sesquiterpene synthases.

[0004] In summary, it is necessary to develop a biosynthetic method for silphinene to overcome the above technical problems. Summary of the invention

[0005] One object of the present invention is to provide a sesquiterpene cyclase SilpS, by constructing a recombinant plasmid for expressing the SilpS gene, transferring the SilpS gene expression frame to the chromosome of Saccharomyces cerevisiae, and obtaining a recombinant Saccharomyces cerevisiae that can achieve high-level expression of silphinene.

[0006] The technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a sesquiterpene cyclase SilpS, wherein the sesquiterpene cyclase SilpS is as follows 1) or 2):

[0008] 1) the amino acid sequence shown in SEQ ID No. 2 in the sequence listing, and at least includes the amino acid sequence shown in SEQ ID No. 2 in the sequence listing;

[0009] 2) A protein derived from SEQ ID No. 2 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added and the amino acid sequence is the same as SEQ ID No. 2.

[0010] Preferably, in order to facilitate the purification of the amino acid sequence in 1), a tag as shown in Table 1 is connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing.

[0011] Table 1 Tag sequences

[0012] Label Number of residues sequence Poly-Arg 5-6 5-6 Rs Poly-His 2-10 2~10 hours FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0013] Furthermore, the above amino acid sequence can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0014] Preferably, the gene encoding the amino acid sequence in 2) above is obtained by deleting the codons of one or several amino acid residues in the DNA sequence shown in SEQ ID No. 1 in the sequence list, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0015] In a second aspect, the present invention provides a DNA molecule encoding a sesquiterpene cyclase SilpS, specifically comprising any one of the following DNA molecules (1)-(3):

[0016] (1) The coding region is the DNA molecule shown in SEQ ID No. 1 in the sequence listing, and at least includes the DNA molecule shown in SEQ ID No. 1 in the sequence listing;

[0017] (2) a DNA molecule that hybridizes with the DNA sequence defined in (1) and encodes a protein with the same function;

[0018] (3) A DNA molecule that has at least 70% homology with the DNA sequence defined in (1) and encodes a protein with the same function.

[0019] In a third aspect, the present invention provides a method for preparing a recombinant strain expressing sesquiterpene cyclase SilpS, which specifically comprises the following steps:

[0020] The DNA molecule containing the SilpS described in the second aspect, the promoter sequence SEQ ID No.3, the terminator sequence SEQ ID No.4, the upstream homologous sequence SEQ ID No.5, and the downstream homologous sequence SEQ ID No.6 are cloned into a vector to obtain a recombinant plasmid, and then transferred into an expression strain.

[0021] Preferably, the expression strain is Saccharomyces cerevisiae.

[0022] Preferably, the expression strain also includes sgRNA sequence SEQ ID No.7, KlURA3 expression sequence SEQ ID No.8 and pCAS sequence SEQ ID No.9, which are used to promote SilpS expression.

[0023] In a fourth aspect, the present invention provides a recombinant Saccharomyces cerevisiae prepared by the method described in the third aspect.

[0024] The strain is the recombinant strain LSc180 obtained by expressing the above-mentioned SilpS protein;

[0025] The SilpS protein is as follows 1) or 2):

[0026] 1) The protein shown in sequence 2 in the sequence listing;

[0027] 2) A protein derived from the amino acid sequence shown in Sequence 2 in the sequence listing, in which one or more amino acid residues are replaced and / or deleted and / or added and which has the same function as that of Sequence 2.

[0028] The substance expressing the SilpS protein is a DNA molecule used for homologous recombination or a recombinant vector containing the DNA molecule, including a promoter, a terminator and upstream and downstream homologous arm sequences used for expression.

[0029] The nucleotide sequence of the above promoter is SEQ ID No.3 in the sequence list;

[0030] The nucleotide sequence of the terminator is SEQ ID No. 4 in the sequence list;

[0031] The upstream homologous nucleotide sequence is SEQ ID No. 5 in the sequence list;

[0032] The aforementioned downstream homologous nucleotide sequence is SEQ ID No. 6 in the sequence listing.

[0033] In a fifth aspect, the present invention provides a use of the recombinant Saccharomyces cerevisiae described in the fourth aspect in producing silphinene.

[0034] Beneficial effects achieved by the present invention:

[0035] The invention discloses a sesquiterpene cyclase SilpS, and expresses SilpS in saccharomyces cerevisiae to obtain a recombinant bacterium; the yield of silphinene in the recombinant bacterium is 139.2±2.2 mg / L, and the recombinant bacterium has development potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is a sequence alignment of the SilpS protein.

[0037] Figure 2 Schematic diagram of SilpS expression vector (A, B) and restriction enzyme digestion map (C).

[0038] Figure 3 Schematic diagram of the construction of the recombinant Saccharomyces cerevisiae strain LSc180 (A) and PCR verification (B).

[0039] Figure 4 Identification of silphinene products in the recombinant Saccharomyces cerevisiae strain LSc180 (A) and fermentation yield diagram (B). DETAILED DESCRIPTION

[0040] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0041] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0042] The following examples further illustrate the present invention so that those skilled in the art can better understand the present invention and implement it, but the examples are not intended to limit the present invention.

[0043] Example 1. Obtaining the Silps protein encoding gene Silps

[0044] By analyzing the whole genome sequence of the black shank fungus (Plenodomus lingam), a possible sesquiterpene synthase encoding gene Tps1 with unknown function was obtained.

[0045] The protein encoded by Tps1 was analyzed and a codon-optimized Tps1 gene for expression in Saccharomyces cerevisiae was obtained by gene synthesis. The nucleotide sequence is SEQ ID No. 1 in the sequence list, and the encoded protein is SEQ ID No. 2 in the sequence list. The protein is named SilpS and the encoding gene is Silps. The SilpS protein is compared with the known silphinene synthase PeniA protein sequence as shown in the following figure. Figure 1 As shown. Figure 1 It can be seen that the homology between SilpS and protein PeniA is low, with a consistency of only 24.78%.

[0046] Example 2: Expression of Gene Silps in Saccharomyces cerevisiae and Product Analysis

[0047] 1. Construction of plasmids pLJJ243 and pLJJ5 for Silps expression

[0048] 1) Amplification of upstream and downstream homologous recombination arms of pLJJ243

[0049] Using the genomic DNA of Saccharomyces cerevisiae CENPK.113-5D as a template, under the action of a high-fidelity enzyme (Phanta), primers 1-F / 1-R and 2-F / 2-R were used to amplify the upstream and downstream homologous arms, respectively, to obtain a DNA fragment of 972 bp (denoted as LB) (SEQ ID No. 5) and a DNA fragment of 1021 bp (denoted as RB) (SEQ ID No. 6), respectively.

[0050] Primer sequence (5′-3′):

[0051] 1-F: gtcatgtagccgcctagcgagcctgggt

[0052] 1-R: gttttgggacgctcgaaggctttaatttgcgtagtgctgtctgaacagaataaatg

[0053] 2-F:tatactttaacgtcaaggagaaaaaactataatcttaatagacgaatggaccgctcaag

[0054] 2-R: gagaaactaggctagttttagcggtgacc

[0055] 2) Amplification of pLJJ243 promoter, terminator and Silps gene

[0056] Using the gene synthesized after optimization of Saccharomyces cerevisiae as a template, primers 3-F / 3-R were used to amplify the 1131bp Silps expression gene (SEQ ID No.1); using the Saccharomyces cerevisiae genome as a template, primers 4-F / 4-R were used to amplify the 722bp promoter sequence (SEQ ID No.3); using the Saccharomyces cerevisiae genome as a template, primers 5-F / 5-R were used to amplify the 325bp terminator sequence (SEQ ID No.4).

[0057] Primer sequence (5′-3′):

[0058] 3-F:tcacaagaccaacttgaaagcgaaac

[0059] 3-R: atgttgtcttttttgtctaacttggtcc

[0060] 4-F: gaccaagttagacaaaaaagacaacatttatattgaattttcaaaaattcttacttt

[0061] 4-R: ttgagcggtccattcgtctattaagattatagttttttctccttgacgttaaa

[0062] 5-F: catttattctgttcagacagcactacgcaaattaaagccttcgagcgtcccaa

[0063] 5-R: gtttcgctttcaagttggtcttgtgaacaggccccttttcctttgtcgatat

[0064] 3) Recombinant vector pLJJ243

[0065] The upstream and downstream homology arm fragments, promoter, terminator and Silps gene fragment were connected together by OE PCR and cloned into the commercial vector pEASY-Blunt. The plasmid map is shown in Figure 2 (A) shown.

[0066] 4) Construction of pLJJ5

[0067] The synthesized sequence was used as a template and 6-F / 6-R as primers to obtain the sgRNA sequence (SEQ ID No. 7) by PCR. The plasmid KlURA3 was used as a template and 7-F / 7-R as primers to amplify the KlURA3 expression sequence (SEQ ID No. 8) by PCR. The plasmid pCAS (SEQ ID No. 9), the sgRNA sequence, and the KlURA3 expression sequence were GoldenGate connected with the endonuclease BsaI to obtain the plasmid pLJJ5. The plasmid map is shown in FIG. Figure 2 (B) pLJJ5 was used to transform into Saccharomyces cerevisiae JCR27 to enhance the expression of the recombinant vector pLJJ243.

[0068] Primer sequence (5′-3′):

[0069] 6-F: ggtctcggatctgttcagacagcactaccacgttttagagctagaaatagca

[0070] 6-R: ggtctcttgcgcaagcccggaatcgaacc

[0071] 7-F:ggtctcacgcatttttttggatccatctaaagtcatttca

[0072] 7-R:ggtctcaaaacctttttcgatgatgtagtttctgg

[0073] 2. Construction of genetically engineered strain LSc180 for expressing silphinene

[0074] The recombinant plasmid pLJJ243 was digested with endonuclease MssI to a size of 8120 bp. Figure 2 As shown in (C, 1. Marker 1Kb plus; 2. MssI digestion 8120bp), the linearized fragment was recovered and introduced into the competent cell of Saccharomyces cerevisiae JCR27, and cultured on a medium lacking uracil at 28°C for three days until transformants grew out.

[0075] The obtained transformants were numbered and transferred to uracil-deficient culture medium plates for further culture for one day. Transformants that could grow normally were screened and then the strains were verified by PCR.

[0076] The above recombinant bacteria LSc180 were verified by PCR using 8-F / 8-R and 9-F / 9-R.

[0077] Primer sequence (5′-3′):

[0078] 8-F:tcaacctgcaaatattgctttgctt

[0079] 8-R:ttaacgtcaaggagaaaaaactataatgttgtcttttttgtctaacttgg

[0080] 9-F: tctatcgatttcaattcaattcaattcacaagaccaacttgaaagcgaaa

[0081] 9-R: attaaacaggagccaaatgcataaat

[0082] The results are as follows Figure 3 As shown, A is a schematic diagram of the construction strategy of the recombinant bacteria LSc180, and B is a PCR verification diagram of LSc180 (1. Marker1Kb plus; 2. Primer 8-F / 8-R verification, 2462bp; 3. Primer 9-F / 9-R verification, 2917bp). It can be seen that LSc180 successfully introduced the expression frame of the gene Silps.

[0083] Example 3: Fermentation of Genetic Engineering Bacteria LSc180 with Heterologous Expression of Silps and Product Detection

[0084] A single clone of the engineered bacteria LSc180 on the plate was picked and inoculated into 3 ml of YPD medium and cultured at 30°C overnight as seed solution; the seed medium was diluted to measure OD, and transferred to 50 ml of fermentation medium with a final OD of 0.1; when the OD grew to 0.8, 1% galactose and 5 ml of n-decane were added, marked, and cultured at 30°C and 220 rpm for three days.

[0085] Then, take out the fermented sample, pour the bacterial solution into a 50ml centrifuge tube, centrifuge at 4000rpm for 7min, collect the upper organic phase in a 10ml centrifuge tube, dilute the organic phase with n-hexane according to the expected yield, centrifuge the diluted solution at 13000rpm at 4 degrees for 10min, perform GC-MS detection, and calculate the yield. Figure 4 As shown in the figure, the fermentation product of LSc180 is relatively simple, and its main peak is consistent with the peak time and mass spectrum data of the silphinene standard, which indicates that the product of sesquiterpene cyclase SilpS is silphinene. Through calculation, the yield of silphinene in LSc180 is 139.2±2.2mg / L, indicating that the enzyme activity of SilpS is high and has good applicability.

Claims

1. A sesquiterpene cyclase SilpS, characterized in that The sesquiterpene cyclase SilpS is as follows 1) or 2): 1) the amino acid sequence shown in SEQ ID No. 2 in the sequence listing, and at least includes the amino acid sequence shown in SEQ ID No. 2 in the sequence listing; 2) A protein derived from SEQ ID No. 2 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added and which has the same function as SEQ ID No.

2.

2. The sesquiterpene cyclase SilpS according to claim 1, characterized in that A tag is connected to the amino terminal or carboxyl terminal of the protein composed of the amino acid sequence shown in SEQ ID No. 2 in the sequence list; The tags include Poly-Arg, which is connected by 5 to 6 Rs; Poly-His, which is connected by 2 to 10 Hs; FLAG, whose sequence is DYKDDDDK; Strep-tag II, whose sequence is WSHPQFEK; and c-myc, whose sequence is EQKLISEEDL.

3. The sesquiterpene cyclase SilpS according to claim 1 or 2, characterized in that The amino acid sequence in 2) above is artificially synthesized, or its encoding gene is first synthesized and then biologically expressed.

4. The sesquiterpene cyclase SilpS according to claim 3, characterized in that The coding gene of the amino acid sequence in the above 2) is obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID No. 1 in the sequence list, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

5. A DNA molecule encoding a sesquiterpene cyclase SilpS, characterized in that: Specifically, it includes any one of the following DNA molecules (1)-(3): (1) The coding region is the DNA molecule shown in SEQ ID No. 1 in the sequence listing, and at least includes the DNA molecule shown in SEQ ID No. 1 in the sequence listing; (2) a DNA molecule that hybridizes with the DNA sequence defined in (1) and encodes a protein with the same function; (3) A DNA molecule that has at least 70% homology with the DNA sequence defined in (1) and encodes a protein with the same function.

6. A method for preparing a recombinant strain expressing sesquiterpene cyclase SilpS, characterized in that: The specific steps include: The DNA molecule containing the SilpS of claim 5, the promoter sequence SEQ ID No. 3, the terminator sequence SEQ ID No. 4, the upstream homologous sequence SEQ ID No. 5, and the downstream homologous sequence SEQ ID No. 6 are cloned into a vector to obtain a recombinant plasmid, and then transferred into an expression strain.

7. The method for preparing a recombinant strain expressing sesquiterpene cyclase SilpS according to claim 6, characterized in that: The expression strain is Saccharomyces cerevisiae.

8. The method for preparing a recombinant strain expressing sesquiterpene cyclase SilpS according to claim 6 or 7, characterized in that: The expression strain also includes an sgRNA sequence SEQ ID No. 7, a KlURA3 expression sequence SEQ ID No. 8 and a pCAS sequence SEQ ID No. 9, which are used to promote the expression of SilpS.

9. A recombinant Saccharomyces cerevisiae prepared by the method according to any one of claims 6 to 8.

10. Use of the recombinant Saccharomyces cerevisiae according to claim 9 in producing silphinene.

Images