Chimeric promoter and application thereof

Abstract

The invention relates to a chimeric promoter and application thereof.The chimeric promoter comprises a PP-prGm17gTsf1 element and a CP-prGmUbi3 element, the PP-prGm17gTsf1 element is connected with the CP-prGmUbi3 element in a manipulatable mode, and the PP-prGm17gTsf1 element is located on the upstream of the CP-prGmUbi3 element, the PP-prGm17gTsf1 element is located on the upstream of the CP-prGmUbi3 element, the PP-prGm17gTsf1 element is located on the upstream of the CP-prGmUbi3 element, and the PP-prGm17gTsf1 element is located on the upstream of the CP-prGmUbi3 element. Wherein the nucleotide sequence of the PP-prGm17gTsf1 element and the nucleotide sequence of the CP-prGmUbi3 element are respectively as shown in SEQ ID NO: 3 and SEQ ID NO: 4. The chimeric promoter disclosed by the invention almost shows activity in most tissues and many types of cells of a plant, and particularly has wide application prospects in roots, stems, leaves, flowers, pod peels and fruits of the plant.

Description

Technical Field

[0001] The present invention relates to a chimeric promoter and uses thereof, and in particular to a chimeric promoter comprising a PP-prGm17gTsf1 element and a CP-prGmUbi3 element and uses thereof. Background Art

[0002] One of the goals of plant genetic engineering is to produce plants with desired characteristics or traits for agriculture, and the commonly desired traits include improving nutritional value quality, increasing yield, imparting resistance to pests and diseases, improving drought and stress tolerance, improving horticultural quality, and imparting herbicide resistance. Current technological advances have enabled researchers to obtain exogenous polynucleotide molecules (e.g., genes from heterologous or natural sources) and integrate the polynucleotide molecules into the plant genome, which are expressed in plant cells to exhibit the corresponding traits. It is important that appropriate regulatory signals must be present in a suitable structure to obtain expression of the coding sequence of the newly inserted gene in plant cells. These regulatory signals typically include a promoter region, a 5' untranslated guide sequence, and a 3' transcription terminator / polyadenylation sequence.

[0003] Based on the understanding of the structure and function of natural chimeric promoter subelements and in-depth research on the mechanism of promoter initiation of transcription, artificially synthesized chimeric promoters that do not exist in nature can be obtained by chimeric modification of related promoters. The ability of this artificially synthesized chimeric promoter to guide RNA synthesis is equivalent to or stronger than that of the natural "chimeric promoter".

[0004] Some chimeric promoters that work in plant cells have been described in the existing literature. These promoters include the enhancer element of mosaic virus operably connected to the promoter prAtTsf1 of Arabidopsis cell elongation factor gene or the promoter prBnTsf1 of rapeseed cell elongation factor gene, such as the repeat enhancer element e35S of the cauliflower mosaic virus CaMV 35S promoter and the repeat enhancer element eFMV of the figwort mosaic virus (FMV) 35S promoter. The chimeric promoter eFMV:prAtTsf1 has been used in transgenic expression plant constructs. The use of genetic engineering to improve multiple traits of commercial germplasm requires gene stacking to introduce multiple genes into crops. When multiple genes are introduced into crops, the key factor is to match each gene with a suitable promoter to obtain optimal expression, and different promoters need to be used to reduce the possibility of gene silencing. Therefore, optimal control of gene expression and promoter diversification are very important in plant genetic engineering technology. Although some chimeric promoters have been obtained, artificially modified chimeric promoters with stronger functions are still attracting much attention. These artificially synthesized chimeric promoters can control the expression of target genes at different levels and can be used for the expression of multiple genes in the same transgenic plants. Summary of the invention

[0005] The purpose of the present invention is to provide a novel chimeric promoter and its use, wherein the promoter can enable heterologous nucleotide sequences to be efficiently expressed in plant tissues.

[0006] To achieve the above object, the present invention provides a chimeric promoter, which comprises a PP-prGm17gTsf1 element and a CP-prGmUbi3 element, wherein the PP-prGm17gTsf1 element is operably linked to the CP-prGmUbi3 element, and the PP-prGm17gTsf1 element is located upstream of the CP-prGmUbi3 element;

[0007] The nucleotide sequences of the PP-prGm17gTsf1 element and the CP-prGmUbi3 element are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0008] Furthermore, the present invention provides a chimeric promoter, the chimeric promoter further comprising an enhancer element, wherein the enhancer element is selected from at least one of an eCsVMV element, an L-prGmUbi3 element, and an I-prGm17gTsf1 element;

[0009] The nucleotide sequences of the eCsVMV element, the L-prGmUbi3 element and the I-prGm17gTsf1 element are shown in SEQ ID NO: 2, SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

[0010] Furthermore, the present invention provides a chimeric promoter, wherein the enhancer element is selected from a combination of an eCsVMV element, an L-prGmUbi3 element and an I-prGm17gTsf1 element.

[0011] Furthermore, the enhancer element is located at the 5' end or the 3' end of the chimeric promoter.

[0012] Further, the eCsVMV element, PP-prGm17gTsf1 element, CP-prGmUbi3 element, L-prGmUbi3 element and I-prGm17gTsf1 element are operably linked in sequence from the 5' end to the 3' end.

[0013] Furthermore, the nucleotide sequence of the chimeric promoter is shown in SEQ ID NO:1.

[0014] To achieve the above object, the present invention also provides a recombinant DNA construct comprising the above chimeric promoter operably linked to a target heterologous nucleotide sequence.

[0015] Furthermore, the target heterologous nucleotide sequence encodes a target protein.

[0016] To achieve the above object, the present invention also provides an expression cassette comprising the above recombinant DNA construct.

[0017] To achieve the above object, the present invention also provides a recombinant vector comprising the above expression cassette.

[0018] To achieve the above object, the present invention also provides a method for expressing a target heterologous nucleotide sequence in a plant, comprising: stably integrating the target heterologous nucleotide sequence operably linked to the above chimeric promoter into a plant cell.

[0019] Furthermore, the plant is Arabidopsis, rapeseed, tobacco, soybean, cotton, pepper, beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato or peanut.

[0020] Preferably, the heterologous nucleotide sequence of interest is constitutively expressed in plant tissues.

[0021] Furthermore, the target heterologous nucleotide sequence encodes a target protein.

[0022] Preferably, the heterologous nucleotide sequence of interest encodes a herbicide tolerance protein.

[0023] Preferably, the heterologous nucleotide sequence of interest encodes an insect resistance protein.

[0024] To achieve the above object, the present invention also provides a plant or part thereof, comprising the above chimeric promoter.

[0025] To achieve the above object, the present invention also provides a method for obtaining processed agricultural products, comprising processing the harvested products of the above plants or parts thereof to obtain processed agricultural products.

[0026] To achieve the above object, the present invention also provides a use of the above chimeric promoter for constitutively expressing a target heterologous nucleotide sequence in plant tissues.

[0027] Preferably, the plant is Arabidopsis, rapeseed, tobacco, soybean, cotton, pepper, beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato or peanut.

[0028] Furthermore, the target heterologous nucleotide sequence encodes a target protein.

[0029] In the present invention, the terms "include" and "comprising" mean "including but not limited to".

[0030] The term "promoter" in the present invention refers to a DNA regulatory region, which usually contains a TATA box that can guide RNA polymerase II to initiate RNA synthesis at a suitable transcription start site of a specific coding sequence. The term "gene" in the present invention refers to any DNA fragment that contains a DNA region ("transcribed DNA region") that is transcribed into an RNA molecule (e.g., mRNA) in a cell under the control of a suitable regulatory region (e.g., a plant expressible promoter region). Therefore, a gene may contain several operably connected DNA fragments, such as a promoter, a 5' non-translated leader sequence, a coding region, and a 3' non-translated region containing a polyadenylation site. Endogenous plant genes are genes naturally found in plant species. Recombinant DNA constructs are any genes that are not usually found in plant species, or any genes whose promoters are unrelated to a partially or fully transcribed DNA region or to at least another regulatory region of the gene under natural conditions.

[0031] The term "chimeric promoter" in the present invention refers to an oligonucleotide having promoter activity. According to the present invention, "oligonucleotide" should be understood as a single-stranded or double-stranded DNA or RNA molecule containing 100-2500 nucleic acids, preferably 500-2300 nucleic acids, more preferably 1000-2100 nucleic acids, and most preferably 1600-2000 nucleic acids. The chimeric promoter of the present invention can be structurally modified by genetic engineering methods to an existing promoter, for example, by genetic engineering methods to operably connect two or more promoter elements to form the chimeric promoter of the present invention.

[0032] The term "enhancer element" in the present invention refers to a sequence element (e.g., a DNA sequence) that increases, improves, or improves transcription or translation of a nucleic acid sequence, regardless of its position and orientation relative to the nucleic acid sequence to be expressed. An enhancer can enhance transcription from a single promoter, or enhance transcription from more than one promoter at the same time. An enhancer can stimulate the activity of a promoter and can be an inherent element of the promoter or an inserted heterologous element to enhance the transcription level of the promoter. An enhancer can operate in two directions (normal or flipped) and can even function when moved upstream or downstream of the promoter. As long as this function of improving transcription is retained or substantially retained (e.g., at least 70%, at least 80%, at least 90%, or at least 95% of the wild-type activity, that is, the activity of the full-length sequence), any truncated, mutated, or other modified variant of the (naturally occurring) wild-type enhancer sequence is also within the scope of the above definition.

[0033] The term "constitutive expression" in the present invention refers to that a gene or target heterologous nucleotide sequence shows relatively stable and continuous expression in most or all tissues and / or growth and development stages of a plant. For example, the cauliflower mosaic virus CaMV35S promoter can initiate high-intensity expression of exogenous genes in most organs and different developmental stages in plants; the constitutive promoter can also ensure the widespread expression of gRNA in host cells, thereby improving the efficiency and accuracy of gene editing.

[0034] Isolated sequences that have promoter activity and hybridize to the promoter sequence of the present invention or fragments thereof under stringent conditions are included in the present invention. These sequences are at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to the sequences of the present invention. That is, the range of sequence identity is distributed over at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.

[0035] The present invention provides a chimeric promoter, comprising a PP-prGm17gTsf1 element and a CP-prGmUbi3 element, wherein the PP-prGm17gTsf1 element is operably linked to the CP-prGmUbi3 element, and the PP-prGm17gTsf1 element is located upstream of the CP-prGmUbi3 element;

[0036] The nucleotide sequences of the PP-prGm17gTsf1 element and the CP-prGmUbi3 element are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0037] The PP-prGm17gTsf1 promoter element and the CP-prGmUbi3 promoter element are key elements for the chimeric promoter of the present invention to exert its activity. The chimeric promoter comprising these two elements can promote the expression of the target heterologous nucleotide sequence in plant tissues.

[0038] Furthermore, the chimeric promoter of the present invention further comprises an enhancer element for enhancing the transcription level of the promoter, and the enhancer element may be located at the 5' end or the 3' end of the chimeric promoter. The enhancer element is selected from at least one of the eCsVMV element, the L-prGmUbi3 element and the I-prGm17gTsf1 element;

[0039] The nucleotide sequences of the eCsVMV element, the L-prGmUbi3 element and the I-prGm17gTsf1 element are shown in SEQ ID NO: 2, SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

[0040] The promoter sequence and fragments thereof of the present invention, when assembled into a DNA structure to operably connect the promoter sequence to the target heterologous nucleotide sequence, are used for genetic manipulation of any plant. The "operably connected" refers to the functional connection between the promoter sequence of the present invention and a second sequence, wherein the promoter sequence initiates and regulates the transcription of the DNA sequence corresponding to the second sequence. Generally, operably connected means that the nucleic acid sequence being connected is continuous, adjacently combines two protein coding regions when necessary, and is in the same reading frame. In this way, the promoter nucleotide sequence and the target heterologous nucleotide sequence constitute the recombinant DNA construct and are provided together in an expression cassette to be expressed in the target plant. This expression cassette provides a large number of restriction sites to insert the target heterologous nucleotide sequence, and the target heterologous nucleotide sequence will be subject to transcriptional regulation of the regulatory region containing the promoter sequence of the present invention. The expression cassette may additionally contain at least one additional gene that will be co-transformed into the organism. Alternatively, additional genes can be provided on multiple expression cassettes. In the present invention, the terms "operably connected" and "operably connected" are used interchangeably.

[0041] The expression cassette may additionally contain a selectable marker gene. Typically, the expression cassette will contain a selectable marker gene for selecting transformed cells. The selectable marker gene is used to select transformed cells or tissues. The selectable marker gene includes, but is not limited to, genes encoding antibiotic resistance (such as genes encoding neomycin phosphotransferase II (NPT)) and hygromycin phosphotransferase (HPT), and genes conferring herbicide resistance such as glufosinate, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D) resistance genes.

[0042] The expression cassette includes a promoter sequence of the present invention transcribed in the 5'-3' direction, a translation initiation region, a target heterologous nucleotide sequence, and a transcription and translation termination region that functions in plants. The target heterologous nucleotide sequence can be natural or foreign or heterologous to the plant host. Alternatively, the target heterologous nucleotide sequence can be a natural sequence or a selective synthetic sequence. "Foreign" means that the introduced transcription initiation region does not exist in the natural plant into which the transcription initiation region is introduced. For example, a recombinant DNA construct comprises a promoter sequence of the present invention, which is operably connected to a coding sequence different from the promoter sequence of the present invention.

[0043] The termination region can be derived from the promoter sequence of the present invention, can also be derived from the heterologous nucleotide sequence of interest that can be operably linked, or can be derived from another source. Traditional termination regions can be obtained from the Ti plasmid of Agrobacterium tumefaciens, such as the carnitine synthase and nopaline synthase (NOS) termination regions.

[0044] In the preparation of expression cassettes, the various DNA fragments may be manipulated to provide the DNA sequence in the proper orientation and, where appropriate, the proper reading frame. Thus, acceptors or linkers may be used to join the DNA fragments, or other manipulations may be performed to provide convenient restriction sites, remove excess DNA, remove restriction sites, etc. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitution, such as conversion and transformation, may be involved.

[0045] Where appropriate, the heterologous nucleotide sequence of interest can be optimized to increase expression in transformed plants, i.e., the gene can be synthesized using plant-preferred codons to improve expression.

[0046] As is well known in the art, other sequence modifications can improve the gene expression level in the cell host. These include, but are not limited to, removal of the repetitive sequences encoding false polyadenylation signals, exon-intron splicing site signals, transposons, and other fully characterized sequences that may be detrimental to gene expression. The GC content of the sequence can be adjusted to the average level of the specified host cell, citing the known gene expression level in the host cell for calculation. Possibly, the sequence is modified to avoid the predicted hairpin mRNA secondary structure.

[0047] In the expression cassette or recombinant vector, the expression cassette may additionally contain a 5' leader sequence. The leader sequence may serve to improve transcription efficiency. The leader sequence is known in the art and includes, but is not limited to, picornavirus leaders, such as the EMCV leader (encephalomyocarditis virus 5' non-coding region); Potatovirus leaders, such as the tobacco etch virus (TEV) leader, the maize dwarf mosaic virus (MDMV) leader, and the human immunoglobulin heavy chain binding protein (BiP); the non-translated leader from the alfalfa mosaic virus coat protein mRNA (AMV RNA4); the tobacco mosaic virus (TMV) leader; and the maize chlorosis virus (MCMV) leader. Other known elements that improve transcription efficiency, such as introns, etc., may also be used.

[0048] The promoter sequence of the present invention can be used to initiate transcription of an antisense structure that is at least partially complementary to the messenger RNA (mRNA) of the heterologous nucleotide sequence of interest. Antisense nucleotide sequences are constructed to hybridize with the corresponding mRNA. As long as the antisense sequence is long enough to hybridize with the corresponding mRNA and interfere with its expression, the antisense sequence can be modified. In this way, antisense structures having 80%, preferably 90%, and more preferably 95% sequence identity with the corresponding antisense sequence can be used. In addition, a portion of the antisense nucleotide sequence can be used to disrupt the expression of the target gene. Generally, sequences of at least 50 nucleotides, 100 nucleotides, 200 nucleotides, or more nucleotides can be used.

[0049] The promoter sequence of the present invention is used for constitutive expression of the heterologous nucleotide sequence of interest. "Heterologous nucleotide sequence" refers to a sequence that does not naturally exist with the promoter sequence. Although the nucleotide sequence is heterologous to the promoter sequence, it may be homologous or native or heterologous or exogenous to the plant host. The heterologous nucleotide sequence operably connected to the promoter of the present invention can encode the target protein. Examples of such heterologous nucleotide sequences include, but are not limited to, nucleotide sequences encoding polypeptides that confer resistance to abiotic stresses such as drought, temperature, salinity, ozone and herbicides, or biotic stresses such as pathogen attack, including insects, viruses, bacteria, fungi and nematodes, and prevent the production of diseases associated with these organisms.

[0050] The herbicide tolerance protein of the present invention can express resistance and / or tolerance to herbicides. These genes include, but are not limited to, hydroxyphenylpyruvate dioxygenase (HPPD) gene, protoporphyrinogen oxidase (PPO) gene, acetolactate synthase (ALS) gene, 5-enolpyruvyl-3-phosphate synthase (EPSPS) gene, glufosinate acetyltransferase (PAT) gene, glyphosate oxidoreductase (GOX) gene, GAT gene, etc.

[0051] In the present invention, "insect resistance" refers to the symptoms and damage caused by plant-insect interactions that plants avoid. That is, plant damage, crop damage, plant shape and plant diseases caused by insects are prevented, or alternatively, plant damage, crop damage, plant shape and plant diseases caused by insects are reduced to a minimum or alleviated. The insects may belong to Lepidoptera (such as corn borers), Hemiptera (such as stink bugs), Coleoptera (such as beetles), Orthoptera (such as locusts), Homoptera (such as aphids), Diptera (such as flies), etc. As is well known in the art, target insect resistance proteins include, but are not limited to, Bacillus toxic proteins; lectins, wherein lectins include snowdrop lectin, pea lectin, jack bean lectin, malt lectin, potato lectin, peanut lectin, etc.; lipoxygenases, wherein lipoxygenases include pea lipoxygenase 1 or soybean lipoxygenase; insect chitinase, etc.

[0052] Different pests transfer viruses from infected plants to healthy plants in different ways. Such viruses include, but are not limited to, rice tungro baculovirus, tobacco mosaic virus, sweet potato chlorotic stunt virus, and sweet potato feathery mottle virus, etc. Therefore, heterologous nucleotide sequences that constitutively express in plant tissues have anti-pathogenic activity or minimize the impact of viral pathogens can be selected.

[0053] The promoter sequences and methods of the present invention can be used for regulating the expression of any target heterologous nucleotide sequence in a plant host to change the phenotype of the plant. Various target phenotype changes include, but are not limited to, changing the fatty acid composition of the plant, changing the amino acid content of the plant, changing the defense mechanism of plant pathogens, etc. The above changes can be obtained by providing the expression of a heterologous product or increasing the expression of a plant endogenous product. Alternatively, the above changes can be obtained by reducing the expression of one or more endogenous products in the plant, particularly enzymes or cofactors. The above changes will result in a phenotypic change in the transformed plant.

[0054] Transformation protocols and protocols for introducing nucleotide sequences into plants vary depending on the type of plant or plant cell being transformed, i.e., monocots or dicots. Suitable methods for introducing nucleotide sequences into plant cells and subsequently inserting them into the plant genome include, but are not limited to, Agrobacterium-mediated transformation, microbead bombardment, direct DNA uptake into protoplasts, electroporation, or silicon whisker-mediated DNA introduction.

[0055] The transformed cells can be grown into plants in a conventional manner. These plants are grown and pollinated with the same transformed strain or different transformed strains, and the resulting hybrids express the desired identified phenotypic characteristics. Two or more generations can be grown to ensure stable maintenance and inheritance of the expression of the desired phenotypic characteristics, and then seeds that can ensure the expression of the desired phenotypic characteristics are harvested.

[0056] The term "plant" includes whole plants, including all plants and plant populations, such as desired and undesired wild plants or crop plants (including naturally occurring crop plants). Crop plants can be plants obtained by traditional breeding and optimization methods or by biotechnology and recombinant methods, or a combination of these methods, including transgenic plants.

[0057] The term "plant part" includes plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and intact plant cells in plants or plant parts. The plant parts are, for example, embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stalks, roots, root tips, anthers, etc. It should be understood that the parts of transgenic plants within the scope of the present invention include, but are not limited to, plant cells, protoplasts, tissues, calli, embryos, and flowers, stems, fruits, leaves and roots, which are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecules of the present invention and are therefore at least partially composed of transgenic cells.

[0058] In one aspect, the plant part is a plant cell. In yet another aspect, the plant part is a non-renewable cell or a renewable cell. In another aspect, the plant cell is a somatic cell.

[0059] Non-renewable cells refer to cells that cannot be regenerated into a whole plant by in vitro culture. Non-renewable cells can be in the plants of the present invention or plant parts (e.g., leaves). Non-renewable cells can be cells in seeds or the seed coat of the seeds. Mature plant organs (including mature leaves, mature stems, or mature roots) contain at least one non-renewable cell.

[0060] In another aspect, the plant cell is a reproductive cell, such as an ovule or a cell that is part of pollen. In one aspect, the pollen cell is a vegetative (non-reproductive) cell, or a sperm cell.

[0061] The present invention provides a processed agricultural product obtained by processing a harvested product of a plant or part thereof containing the chimeric promoter of the present invention. The term "processed agricultural product" refers to any composition or product composed of materials derived from a plant, seed, plant cell or plant part containing the chimeric promoter of the present invention. Specifically, the term "processed agricultural product" includes, but is not limited to, protein concentrates, protein isolates, starch, flour, biomass and seed oils.

[0062] The present invention provides a chimeric promoter and its use, which has the following advantages:

[0063] 1. The present invention artificially constructed a chimeric promoter comprising the PP-prGm17gTsf1 promoter element and the CP-prGmUbi3 promoter element.

[0064] 2. The chimeric promoter of the present invention exhibits activity in almost all tissues and many types of cells of plants, especially in roots, stems, leaves, flowers, pods and fruits of plants.

[0065] 3. The chimeric promoter of the present invention can drive the constitutive expression of exogenous genes in plant tissues.

[0066] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 This is a construction model of the chimeric promoter prDCP12 of the present invention.

[0068] Figure 2 The schematic diagram of the structure of the vector DBNBC-Dual_LUC containing LUC and REN reporter genes of the present invention;

[0069] Figure 3 It is a schematic diagram of the structure of the recombinant expression vector DBN11-O containing the prDCP12 promoter sequence of the present invention;

[0070] Figure 4This is a schematic diagram of the structure of the vector DBNBC-HTG containing the herbicide-resistant gene HTG of the present invention;

[0071] Figure 5 It is a schematic diagram of the structure of the recombinant expression vector DBN15-O containing the prDCP12 promoter sequence of the present invention. DETAILED DESCRIPTION

[0072] The technical scheme of the chimeric promoter and its application of the present invention is further illustrated by specific examples below.

[0073] First Example: Obtaining the Chimeric Promoter of the Present Invention

[0074] 1. Obtain the prDCP12 promoter sequence

[0075] The subelements eCsVMV (SEQ ID NO: 2), PP-prGm17gTsf1 (SEQ ID NO: 3), CP-prGmUbi3 (SEQ ID NO: 4), L-prGmUbi3 (SEQ ID NO: 5) and I-prGm17gTsf1 (SEQ ID NO: 6) constituting the chimeric promoter were synthesized at Nanjing GenScript Biotechnology Co., Ltd. and Figure 1 The chimeric promoter model shown operably links the subelements to obtain the chimeric promoter prDCP12.

[0076] 2. Synthesis of the above prDCP12 promoter sequence

[0077] The 5' and 3' ends of the above prDCP12 promoter sequence, prGm17gTsf1 control promoter sequence (SEQ ID NO: 7), pr35S control promoter sequence (SEQ ID NO: 8) and prAtH4A748:lTEV chimeric control promoter sequence (SEQ ID NO: 9) were connected to universal linker primer 1:

[0078] 5'-end universal linker primer 1: 5'-ctaaaaccaaaatccagtggactagt-3', as shown in SEQ ID NO: 10 in the sequence listing;

[0079] 3' end universal linker primer 1: 5'-atgtttttggcgtcttccat-3', as shown in SEQ ID NO: 11 in the sequence listing.

[0080] Second Example: Verification of the Effect of Promoter Elements Driving LUC Reporter Gene Expression in Transgenic Tobacco

[0081] 1. Introduce the dual-luciferase reporter system and construct a recombinant expression vector containing the prDCP12 promoter sequence.

[0082] The construction of vectors using conventional enzyme digestion methods is well known to those skilled in the art. The schematic diagram of the structure of the vector DBNBC-Dual_LUC (vector backbone: pCAMBIA2301 (provided by CAMBIA) with modified resistance tags) containing LUC and REN reporter genes is shown in FIG. Figure 2 As shown (Spec: spectinomycin gene; RB: right border; prAtAct2: Arabidopsis Act2 gene promoter (SEQ ID NO: 12); REN: Renilla luciferase gene (SEQ ID NO: 13); t35s: cauliflower virus 35s terminator (SEQ ID NO: 14); SpeI: restriction endonuclease SpeI recognition site; LUC: firefly luciferase gene (SEQ ID NO: 15); tPsE9: terminator of pea RbcS gene (SEQ ID NO: 16); prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO: 17); spAtCTP2: Arabidopsis chloroplast transit peptide (SEQ ID NO: 18); cEPSPS: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 19); tNos: terminator of nopaline synthase gene (SEQ ID NO: 20); NO:20); LB:left boundary).

[0083] The above-mentioned vector DBNBC-Dual_LUC was subjected to restriction endonuclease SpeI for restriction digestion reaction, thereby linearizing the vector DBNBC-Dual_LUC. The digestion product was purified to obtain a linearized DBNBC-Dual_LUC expression vector. The prDCP12 promoter sequence connected to the universal linker primer 1 was recombined with the linearized DBNBC-Dual_LUC expression vector. The operation steps were carried out according to the instructions of Takara's In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct a recombinant expression vector DBN11-O, whose structural schematic diagram is shown in the figure. Figure 3 shown.

[0084] The recombinant expression vector DBN11-O was transformed into Escherichia coli DH5α competent cells by heat shock method, and the heat shock conditions were as follows: 100 μL of Escherichia coli DH5α competent cells, 20 μL of recombinant plasmid DNA (recombinant expression vector DBN11-O), flicked to mix, heat-shocked in a 42°C water bath for 30 seconds, and immediately placed on ice for 2 minutes; 250 μL of antibiotic-free LB liquid medium (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH adjusted to 7.5 with NaOH) was added, and cultured at 37°C with shaking (200 rpm / min) for 1 hour. Then, the cells were inverted and cultured at 37°C for 12 hours on the LB solid plate containing 50 mg / L spectinomycin, and the positive clone colonies were picked and cultured overnight in LB liquid medium containing 50 mg / L spectinomycin at 37°C with shaking (200 rpm / min). The plasmid was extracted by alkaline lysis: the bacterial solution was centrifuged at 12000 rpm for 1 min, the supernatant was removed, and the precipitated bacteria were suspended with 100 μL of ice-cold solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH = 8.0); 200 μL of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 minutes; add 150 μL of ice-cold solution III (3M potassium acetate, 5M acetic acid), mix thoroughly immediately, and place on ice for 5-10 minutes; centrifuge at 4°C and 12000rpm for 5 minutes, transfer the supernatant to a new 2mL centrifuge tube, add 2 times the volume of anhydrous ethanol, mix and place at room temperature for 5 minutes; centrifuge at 4°C and 12000rpm for 5 minutes, discard the supernatant, wash the precipitate with 70% ethanol (V / V) and dry it; add 30 μL TE (10mM Tris-HCl, 1mM EDTA, pH=8.0) containing RNase (20 μg / mL) to dissolve the precipitate; water bath at 37°C for 30 minutes to digest RNA; store at -20°C for use. The extracted plasmid was sequenced and identified, and the results showed that the recombinant expression vector DBN11-O contained the nucleotide sequence shown in SEQ ID NO: 1 in the sequence table, namely the prDCP12 promoter sequence.

[0085] According to the above method for constructing a recombinant expression vector DBN11-O containing the prDCP12 promoter sequence, the prGm17gTsf1 control promoter sequence connected to the universal linker primer 1, the pr35S control promoter sequence connected to the universal linker primer 1, and the prAtH4A748:lTEV chimeric control promoter sequence connected to the universal linker primer 1 were respectively subjected to recombination reactions with the linearized DBNBC-Dual_LUC expression vector to obtain recombinant expression vectors DBN12-O to DBN14-O in turn, and sequencing verified that the above nucleotide sequences in the recombinant expression vectors DBN12-O to DBN14-O were correctly inserted.

[0086] 2. Transformation of Agrobacterium with recombinant expression vector

[0087] The correctly constructed recombinant expression vectors DBN11-O to DBN14-O were transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) by liquid nitrogen method, and the transformation conditions were: 100 μL Agrobacterium LBA4404, 3 μL plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 minutes, and bathed in 37°C warm water for 10 minutes; the transformed Agrobacterium LBA4404 was inoculated in an LB test tube and cultured at a temperature of 28°C and a rotation speed of 200 rpm for 2 hours, and then applied to the LB solid plate containing 50 mg / L rifampicin and 50 mg / L spectinomycin until a positive single clone grew out, picked a single clone for culture and extracted its plasmid, and the extracted plasmid was sequenced and identified. The results showed that the structure of the recombinant expression vectors DBN11-O to DBN14-O was completely correct.

[0088] 3. Instantaneous transformation of tobacco leaves

[0089] Tobacco leaves are biological cell reactors for efficient protein expression. The exogenous genes are introduced into tobacco leaves for expression by using the Agrobacterium injection and penetration method, and the effect of the chimeric promoter of the present invention is verified by using high-throughput protein expression.

[0090] The tobacco leaf transformation method is as follows:

[0091] Step 1, planting tobacco, culturing the tobacco under conditions of 14 h light / 10 h dark, 25° C., and 70% relative humidity for 4-5 weeks, and collecting tobacco leaves;

[0092] Step 2, sequentially pick the Agrobacterium strains transformed with the recombinant expression vector DBN11-O, the Agrobacterium strains transformed with the recombinant expression vector DBN12-O, the Agrobacterium strains transformed with the recombinant expression vector DBN13-O, and the Agrobacterium strains transformed with the recombinant expression vector DBN14-O in Part 2 of this embodiment, and clone them respectively in 1 mL of LB liquid culture medium containing antibiotics (tryptone 10 g / L, yeast extract 10 g / L, NaCl 5 g / L, rifampicin (Rifampicin) 50 mg / mL, spectinomycin 50 mg / mL, tetracycline 10 mg / mL), and culture at 28 ° C with shaking (200 rpm) until the logarithmic phase of Agrobacterium growth (OD 600 =0.5-0.6), take 1 mL of the logarithmic phase Agrobacterium culture and transfer it to 20 mL of LB liquid medium containing antibiotics (tryptone 10 g / L, yeast extract 10 g / L, NaCl 5 g / L, rifampicin 50 mg / mL, spectinomycin 50 mg / mL, tetracycline 10 mg / mL), and culture at 28°C with shaking (200 rpm) until the logarithmic phase of Agrobacterium (OD 600 =0.5-0.6), centrifuged at room temperature and 5000 rpm for 10 min, collected the cells, and suspended the Agrobacterium cells in an impregnation solution (containing 10 mM MgCl2, 10 mM MES, 150 uM acetosyringone, pH = 5.6) until OD 600 =0.8, and let stand at room temperature for 2-3 hours to obtain Agrobacterium bacterial liquids transformed with recombinant expression vectors DBN11-O to DBN14-O for injection;

[0093] Step 3, use a 1 mL needle to gently make a small hole on the back of the tobacco leaf obtained in step 1 of this example (be careful not to pierce it), and then use a syringe without the needle to draw the Agrobacterium solution transformed with the recombinant expression vectors DBN11-O to DBN14-O for injection in step 2 of this example, and inject it into the tobacco leaf from the small hole of the leaf to transfer the T-DNA (including the prAtAct2 promoter sequence, REN gene sequence, t35s terminator sequence) in the recombinant expression vectors DBN11-O to DBN14-O to the tobacco leaf. The prDCP12 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence and the prAtH4A748:lTEV chimeric control promoter sequence, the LUC gene sequence, the tPsE9 terminator sequence, the prAtUbi10 promoter sequence, the spAtCTP2 nucleotide sequence, the cEPSPS gene sequence and the tNos terminator sequence were transferred into tobacco leaves; wild-type tobacco leaves (CK1) were used as controls. The water-stained areas of the tobacco leaves were marked with a marker pen;

[0094] Step 4. Place the tobacco leaves and wild-type tobacco leaves injected in step 3 of this example in the dark for 12 hours, and then culture them in a constant temperature incubator at 21°C for 2 days. Cut the marked area of ​​the tobacco leaves, take three copies of the marked area leaves transferred with the recombinant expression vectors DBN11-O to DBN14-O and the wild-type tobacco leaves of the same mass as biological replicates, freeze-grind them in liquid nitrogen, and then add 1× Passive lysis buffer (PLB) buffer respectively, centrifuge at 12000 rpm for 10 minutes at 4°C, and aspirate the supernatant for use.

[0095] 4. Detection of the effect of the chimeric promoter of the present invention on driving LUC reporter gene expression in tobacco leaves

[0096] Step 5: Take 100 μL of the supernatant in step 4 above, add it to the ELISA plate, set up 3 replicates, add 100 μL of 1× firefly luciferase reaction solution LAR II (dissolve the freeze-dried powder luciferase assay substrate in luciferase assay buffer II (Promega, The luciferase activity was measured using a microplate reader BioTek-H1MF. The detection was completed within 30 min, and the unit of the detected luciferase activity was RLU (relative light unit).

[0097] Step 6. Add 100 μL 1× Renilla luciferase reaction solution Stop&Glo (obtained by dissolving 200 μL Stop&Glo Substrate (50×) in 10 mL Stop&Glo buffer and storing at -80°C in the dark), shake the plate to mix, and use the microplate reader BioTek-H1MF to detect the activity value of Renilla luciferase. The detection is completed within 30 minutes, and the unit of the detected Renilla luciferase (REN) activity value is RLU (relative light unit).

[0098] In order to eliminate the inter-group errors caused by factors such as different transformation efficiencies of plant tissues infected with Agrobacterium, the REN gene was used as an internal reference. The ratio of LUC / REN reflected the relative activity intensity of the promoter (LUC / REN ratio = (LUC value of tobacco leaves transformed with different recombinant expression vectors - LUC value of wild-type tobacco leaves) / (REN value of tobacco leaves transformed with different recombinant expression vectors - REN value of wild-type tobacco leaves)). The experimental results of LUC and REN enzyme activity detection of transiently transformed tobacco leaves are shown in Table 1.

[0099] Table 1. Enzyme activities of LUC and REN and the ratio of LUC / REN in transiently transformed tobacco leaves

[0100] Promoter LUC enzyme activity value / RLU REN enzyme activity value / RLU LUC / REN value prDCP12 350989.9±19768.9 319080.7±10769.8 1.1±0.1 prGm17gTsf1 440639.7±20376.5 338876.3±11236.1 1.3±0.1 pr35S 113598.0±3507.1 226874.3±9807.3 0.5±0.0 prAtH4A748:lTEV 1408.3±47.9 40674.7±2190.5 0.0±0.0 CK1 87.6±6.9 167.2±16.8 /

[0101] The results in Table 1 indicate that: (1) the promoter prDCP12 of the present invention is active and can drive LUC gene expression in tobacco leaves; (2) in tobacco leaves, prDCP12 has higher activity in driving LUC gene expression than the pr35S and prAtH4A748:lTEV control promoters.

[0102] Third Example: Verification of the Effect of Promoter Elements Driving LUC Reporter Gene Expression in Transgenic Arabidopsis

[0103] 1. Transformation of Agrobacterium with recombinant expression vector

[0104] The correctly constructed recombinant expression vectors DBN11-O to DBN14-O in Part 1 of the above-mentioned second embodiment were transformed into Agrobacterium GV3101 respectively by liquid nitrogen method, and the transformation conditions were as follows: 100 μL Agrobacterium GV3101, 3 μL plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 min, and bathed in 37°C warm water for 10 min; the transformed Agrobacterium GV3101 was inoculated into an LB test tube and cultured at 28°C and 200 rpm for 2 h, and then coated on the LB solid plate containing 50 mg / L rifampicin and 50 mg / L spectinomycin until a positive single clone grew out, and a single clone was picked for culture and its plasmid was extracted, and the extracted plasmid was sequenced and identified, and the results showed that the structure of the recombinant expression vectors DBN11-O to DBN14-O was completely correct.

[0105] 2. Obtaining transgenic Arabidopsis plants

[0106] Wild-type Arabidopsis seeds were suspended in a 0.1% (w / v) agarose solution. The suspended seeds were stored at 4°C for 2 days to complete the dormancy requirement to ensure synchronous germination of the seeds. Horse manure soil was mixed with vermiculite and bottom irrigated with water until moist, and the soil mixture was allowed to drain for 24 hours. The pretreated seeds were planted on the soil mixture and covered with a moisture-retaining cover for 7 days. The seeds were allowed to germinate and kept at a constant temperature (22°C) and constant humidity (40-50%) with a light intensity of 120-150 μmol / m 2 Plants were grown in a greenhouse under long-day conditions (16 h light / 8 h dark) of 1 s-1. Plants were initially irrigated with Hoagland's nutrient solution, followed by deionized water, keeping the soil moist but not soaking wet.

[0107] Arabidopsis thaliana was transformed using the flower soaking method. One or more 15-30 mL pre-cultures of LB broth (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH adjusted to 7.5 with NaOH) containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) were inoculated with selected Agrobacterium colonies. The pre-cultures were incubated overnight at 28 ° C with constant shaking at 220 rpm. Each pre-culture was used to inoculate two 500 ml cultures of the LB broth containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) and the cultures were continuously incubated overnight at 28 ° C with shaking. The cells were precipitated by centrifugation at room temperature at a speed of about 4000 rpm for 20 min, and the resulting supernatant was discarded. The cell pellet was gently resuspended in 500 mL of infiltration medium containing 1 / 2×MS salts / B5 vitamins, 10% (w / v) sucrose, 0.044 μM benzylaminopurine (10 μL / L (stock solution in 1 mg / mL DMSO)), and 300 μL / L Silwet L-77. Arabidopsis plants about 1 month old were soaked in the infiltration medium containing the resuspended cells for 5 min, ensuring that the newest inflorescences were immersed. The Arabidopsis plants were then turned on their sides and covered, and moisturized in the dark for 24 h. Arabidopsis plants were cultured normally at a temperature of 22°C with a photoperiod of 16 h light / 8 h dark. Seeds were harvested after about 4 weeks.

[0108] Freshly harvested T1 seeds (containing prDCP12 promoter sequence, prGm17gTsf1 control promoter sequence, pr35S control promoter sequence, prAtH4A748:lTEV chimeric control promoter sequence) were dried at room temperature for 7 days. The seeds were planted in 26.5 cm × 51 cm germination trays, each tray receiving 200 mg of T1 seeds (about 10,000 seeds), which had been previously suspended in distilled water and stored at 4°C for 2 days to complete the need for dormancy to ensure synchronous germination of seeds.

[0109] Horse manure soil was mixed with vermiculite and bottom irrigated with water until moist, and gravity drainage was used. Pretreated seeds were evenly planted on the soil mixture with a pipette and covered with a moisture-retaining cover for 4-5 days. The cover was removed one day before the initial transformant selection using post-emergence spraying with glyphosate (selection for the co-transformed EPSPS gene).

[0110] T1 plants (cotyledon stage and 2-4 leaf stage, respectively) were sprayed with a 0.5% solution of Roundup herbicide (356 g ae / L of glyphosate) at 7 days after planting (DAP) and again at 11 DAP using a DeVilbiss compressed air nozzle at a spray volume of 10 mL / tray (703 L / ha) to provide an effective amount of glyphosate of 420 g ae / ha per application. Survivors (actively growing plants) were identified 4-7 days after the last spray and transplanted into 7 cm x 7 cm square pots prepared with horse manure soil and vermiculite (2-4 plants per tray). Transplanted plants were covered with a moisture-retaining dome for 3-4 days and placed in a culture room at 22°C as before or directly moved into a greenhouse. The covers were then removed and the plants were planted in a greenhouse (temperature 22±5°C, 50±30% RH, 14 h light: 10 h dark, minimum 500 μE / m2s-1 natural + supplemental light) at least 1 day before testing the effect of the promoter element driving the LUC reporter gene.

[0111] 3. Detection of the effect of the chimeric promoter of the present invention on driving the expression of LUC reporter gene in various tissues of Arabidopsis

[0112] T1 transformants were selected from the untransformed seed background using a glyphosate selection scheme. The Arabidopsis T1 plants introduced with the prDCP12 promoter sequence, the Arabidopsis T1 plants introduced with the prGm17gTsf1 control promoter sequence, the Arabidopsis T1 plants introduced with the pr35S control promoter sequence, and the Arabidopsis T1 plants introduced with the prAtH4A748:lTEV chimeric control promoter sequence in Part 2 of this Example were obtained, and samples were taken from different parts of the above Arabidopsis T1 plants at different stages as test samples:

[0113] During the rosette stage, samples were collected from three parts as test samples: roots, stems, and leaves;

[0114] During the bolting period, samples were collected from four parts as test samples: roots, stems, leaves, and flowers;

[0115] Samples were taken from four parts of the fruit at maturity as test samples: roots, stems, leaves, and pods.

[0116] Wild-type Arabidopsis thaliana (CK2) at the same location and at the same growth stage was sampled as a negative control sample.

[0117] Three test samples of the same mass from different parts of the different periods and transferred into the recombinant expression vectors DBN11-O to DBN14-O and a negative control sample from the same part of the wild-type Arabidopsis plant at the same period were taken as biological replicates, frozen and ground in liquid nitrogen, and then 1×PLB buffer was added respectively, centrifuged at 12000 rpm for 10 min at 4°C, and the supernatants were respectively aspirated for use.

[0118] According to the method of step 5 and step 6 in part 4 of the second embodiment, the test sample and the negative control sample were tested for dual fluorescein, and the REN gene was used as the internal reference. The ratio of LUC / REN reflects the relative activity intensity of the promoter (LUC / REN ratio = (LUC value of the test sample at different parts at different times after being transferred into different recombinant expression vectors - LUC value of the same part of the wild-type plant at the same time) / (REN value of the test sample at different parts at different times after being transferred into different recombinant expression vectors - REN value of the same part of the wild-type plant at the same time)). The ratio of LUC / REN at different parts of the stably transformed Arabidopsis at different times is shown in Table 2.

[0119] Table 2. Ratios of LUC / REN in different parts of stably transformed Arabidopsis at different stages

[0120]

[0121] The results in Table 2 show that: (1) the promoter prDCP12 of the present invention is active and is expressed in the roots, stems, leaves, flowers and fruit pods of Arabidopsis plants, indicating that the promoter prDCP12 can drive the expression of the target heterologous gene in the plant.

[0122] (2) In the stems of Arabidopsis plants at the bolting stage and in the pods at the mature stage, prDCP12 had a higher activity in driving LUC gene expression than the prGm17gTsf1, pr35S, and prAtH4A748:lTEV control promoters.

[0123] (3) In the roots of Arabidopsis plants at the rosette, bolting and mature stages, and in the leaves at the bolting stage, prDCP12 had higher activity in driving LUC gene expression than the pr35S and prAtH4A748:lTEV control promoters.

[0124] (4) In the flowers of Arabidopsis plants during the bolting stage, prDCP12 had a higher activity in driving LUC gene expression compared with the prAtH4A748:lTEV control promoter.

[0125] Fourth Example: Verification of the Effect of Promoter Elements Driving LUC Reporter Gene Expression in Transgenic Soybeans

[0126] 1. Transformation of Agrobacterium with recombinant expression vector

[0127] The correctly constructed recombinant expression vectors DBN11-O to DBN14-O were transformed into Agrobacterium EHA101 by liquid nitrogen method, and the transformation conditions were: 100 μL Agrobacterium EHA101, 3 μL plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 minutes, and bathed in 37°C warm water for 10 minutes; the transformed Agrobacterium EHA101 was inoculated in an LB test tube and cultured at 28°C and 200 rpm for 2 hours, and then spread on the LB solid plate containing 50 mg / L rifampicin and 50 mg / L spectinomycin until a positive single clone grew out, picked a single clone for culture and extracted its plasmid, and the extracted plasmid was sequenced and identified. The results showed that the structure of the recombinant expression vectors DBN11-O to DBN14-O was completely correct.

[0128] 2. Obtaining transgenic soybean plants

[0129] According to the conventional Agrobacterium infection method, the cotyledonary node tissue of the aseptically cultured soybean variety SY2043C was co-cultured with the Agrobacterium described in Part 1 of this Example to transform the T-DNA (including the prAtAct2 promoter sequence, the REN gene sequence, the t35s terminator sequence, the prDCP12 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence and the prAtH4A748:1TEV chimeric pair) in the above-mentioned recombinant expression vectors DBN11-0 to DBN14-0 into The prDCP12 promoter sequence, the LUC gene sequence, the tPsE9 terminator sequence, the prAtUbi10 promoter sequence, the spAtCTP2 nucleotide sequence, the cEPSPS gene sequence and the tNos terminator sequence were transferred into the soybean chromosome group, and soybean plants with the prDCP12 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence and the prAtH4A748:lTEV chimeric control promoter sequence were obtained.

[0130] For Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds were germinated in soybean germination medium (B5 salts 3.1 g / L, B5 vitamins, sucrose 20 g / L, agar 8 g / L, pH 5.6), the seeds were inoculated on the germination medium, and cultured under the following conditions: temperature 25 ± 1 ° C; photoperiod (light / dark) was 16 / 8 h. One day after germination, remove one cotyledon and the first true leaf and inoculate on a pretreated medium containing cytokinins (MS salt 4.3 g / L, B5 vitamins, sucrose 20 g / L, agar 8 g / L, 2-morpholineethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, 6-benzyladenine (6-BAP) 1 mg / L, acetosyringone (AS) 40 mg / L, pH = 5.3). Three days after inoculation on the pretreated medium, wound the cotyledon node with the back of a scalpel, and contact the wounded cotyledon node tissue with an Agrobacterium suspension, wherein the Agrobacterium is able to transfer the prDCP12 promoter sequence, prGm17gTsf1 control promoter sequence, pr35S control promoter sequence and prAtH4A748:lTEV chimeric control promoter sequence to the wounded cotyledon node tissue (step 1: infection step). In this step, the cotyledonary node tissue is preferably immersed in an Agrobacterium suspension (OD 660= 0.5-0.8, infection medium (MS salts 2.15 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 40 mg / L, 2-morpholineethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, pH 5.3) to start inoculation. Cotyledonary node tissue is co-cultivated with Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Preferably, the cotyledonary node tissue is cultured on solid medium (MS salts 4.3 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, MES 4 g / L, ZT 2 mg / L, agar 8 g / L, pH 5.6) after the infection step. After this co-cultivation stage, there can be an optional "recovery" step. In the "recovery" step, at least one antibiotic known to inhibit the growth of Agrobacterium (cephalosporin 150-250 mg / L) is present in the recovery medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, ZT 2 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, pH 5.6), and no selective agent for plant transformants is added (step 3: recovery step). Preferably, the tissue pieces regenerated from the cotyledonary nodes are cultured on a solid medium with antibiotics but no selective agent to eliminate Agrobacterium and provide a recovery period for infected cells. Subsequently, the tissue pieces regenerated from the cotyledonary nodes are cultured on a medium containing a selective agent (glyphosate) and growing transformed callus is selected (step 4: selection step). Preferably, the tissue pieces regenerated from the cotyledonary nodes are cultured on a screening solid medium with a selective agent (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, 6-benzyladenine (6-BAP) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, N-(phosphonomethyl)glycine 0.25 mol / L, pH 5.6), resulting in selective growth of the transformed cells. Then, the transformed cells are regenerated into plants (step 5: regeneration step), preferably, the tissue pieces regenerated from the cotyledonary nodes grown on a medium containing a selective agent are cultured on a solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0131] The resistant tissue blocks obtained by screening were transferred to the B5 differentiation medium (B5 salt 3.1g / L, B5 vitamins, MES1g / L, sucrose 30g / L, ZT 1mg / L, agar 8g / L, cephalosporin 150mg / L, glutamic acid 50mg / L, aspartic acid 50mg / L, gibberellin 1mg / L, auxin 1mg / L, N-(phosphonomethyl)glycine 0.25mol / L, pH5.6), and cultured for differentiation at 25°C. The differentiated seedlings were transferred to the B5 rooting medium (B5 salt 3.1g / L, B5 vitamins, MES1g / L, sucrose 30g / L, agar 8g / L, cephalosporin 150mg / L, indole-3-butyric acid (IBA) 1mg / L), cultured on the rooting medium at 25°C to a height of about 10cm, and moved to a greenhouse for culture until fruiting. In the greenhouse, the cultures were cultured at 26°C for 16 h and then at 20°C for 8 h each day.

[0132] 3. Verification of transgenic soybean plants using TaqMan

[0133] About 100 mg of leaves of soybean plants with prDCP12 promoter sequence, soybean plants with prGm17gTsf1 control promoter sequence, soybean plants with pr35S control promoter sequence, and soybean plants with prAtH4A748:lTEV chimeric control promoter sequence were taken as samples, and their genomic DNA was extracted using Qiagen's DNeasy Plant Maxi Kit. The copy number of EPSPS gene was detected by Taqman probe fluorescence quantitative PCR method to determine the copy number of prDCP12, prGm17gTsf1, pr35S and prAtH4A748:lTEV genes. At the same time, wild-type soybean plants were used as controls and detected and analyzed according to the following method. The experiment was repeated 3 times and the average value was taken.

[0134] The specific method for detecting the copy number of EPSPS gene is as follows:

[0135] Step 6, 100 mg of leaves of soybean plants transferred with prDCP12 promoter sequence, soybean plants transferred with prGm17gTsf1 control promoter sequence, soybean plants transferred with pr35S control promoter sequence, soybean plants transferred with prAtH4A748:lTEV chimeric control promoter sequence and wild-type soybean plants were taken respectively, and ground into homogenate with liquid nitrogen in a mortar, and 3 replicates were taken for each sample;

[0136] Step 7: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. For specific methods, refer to its product manual.

[0137] Step 8, using NanoDrop 2000 (Thermo Scientific) to measure the genomic DNA concentration of the above samples;

[0138] Step 9, adjusting the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μL;

[0139] Step 10: Use Taqman probe fluorescence quantitative PCR method to identify the copy number of the sample, use the sample with known copy number as the standard, use the sample of wild-type soybean plant as the control, and repeat 3 times for each sample to take the average value; the sequences of fluorescence quantitative PCR primers and probes are:

[0140] The following primers and probes were used to detect the EPSPS gene sequence:

[0141] Primer 1: ggtgtgcaggtgaagtctgaag as shown in SEQ ID NO: 21 in the sequence listing;

[0142] Primer 2: gtctttggtccacgcaaggt as shown in SEQ ID NO: 22 in the sequence listing;

[0143] Probe 1: cggtgatcgtcttccagt as shown in SEQ ID NO: 23 in the sequence listing;

[0144] The PCR reaction system is:

[0145]

[0146] The 50× primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration, and 860 μL of 1× TE buffer and was stored in an amber tube at 4°C.

[0147] The PCR reaction conditions were:

[0148]

[0149] Data were analyzed using SDS2.3 software (Applied Biosystems).

[0150] By analyzing the experimental results of the EPSPS gene copy number, it was confirmed that the prDCP12 promoter sequence, prGm17gTsf1 control promoter sequence, pr35S control promoter sequence, and prAtH4A748:lTEV chimeric control promoter sequence had all been integrated into the chromosome sets of the tested soybean plants, and that soybean plants introduced with the prDCP12 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:lTEV chimeric control promoter sequence all obtained single-copy transgenic soybean plants.

[0151] 4. Detection of the effect of the chimeric promoter of the present invention on driving the expression of LUC reporter gene in various soybean tissues

[0152] The soybean plants introduced with the prDCP12 promoter sequence, the soybean plants introduced with the prGm17gTsf1 control promoter sequence, the soybean plants introduced with the pr35S control promoter sequence, and the soybean plants introduced with the prAtH4A748:1TEV chimeric control promoter sequence in Part 3 of this example were obtained, and samples were taken from different parts of the above transgenic soybean plants at different stages as test samples:

[0153] During the vegetative growth period (V3 phase), samples were collected from three parts as test samples: roots, stems, and leaves;

[0154] During the reproductive growth period, samples were collected from six parts as test samples: roots, stems, leaves, flowers, pod skin, and fruits;

[0155] A wild-type soybean plant (CK3) at the same location at the same growth stage was sampled as a negative control sample.

[0156] The test samples from different parts at different periods and the negative control samples from the same part of the wild-type soybean plant (CK3) at the same period (three strains were sampled in each period, and three replicates of the same mass were sampled from each part of each strain) were frozen and ground in liquid nitrogen, and then 1×PLB buffer was added respectively, and the samples were centrifuged at 12000 rpm for 10 min at 4°C, and the supernatants were aspirated for use.

[0157] According to the method of step 5 and step 6 in part 4 of the second embodiment, the test sample and the negative control sample were tested for dual fluorescein, with the REN gene as the internal reference, and the ratio of LUC / REN reflects the relative activity intensity of the promoter (the definition of the LUC / REN ratio is the same as the definition of the LUC / REN ratio in Table 2 of the third embodiment above). The ratios of LUC / REN in different parts of the stably transformed soybean at different stages are shown in Table 3.

[0158] Table 3. Ratios of LUC / REN in different parts of soybean at different stages of stable transformation

[0159]

[0160] The results in Table 3 show that: (1) the promoter prDCP12 of the present invention is expressed in the roots, stems, leaves, flowers, pods and fruits of soybean plants, indicating that the promoter prDCP12 can drive the expression of the target heterologous gene in the plant; (2) during the vegetative growth period of soybean, compared with the pr35S and prAtH4A748:lTEV control promoters, prDCP12 has a higher activity in driving LUC gene expression; (3) in the leaves, stems, roots, pods and flowers of soybean during the reproductive growth period, compared with the pr35S and prAtH4A748:lTEV control promoters, prDCP12 has a higher activity in driving LUC gene expression.

[0161] Example 5: Detection of Herbicide Resistance Effect of Transgenic Arabidopsis Plants

[0162] 1. Construct a recombinant expression vector of prDCP12 driving the herbicide-tolerant gene HTG.

[0163] The 5' and 3' ends of the prDCP12 promoter sequence, prGm17gTsf1 control promoter sequence, pr35S control promoter sequence, and prAtH4A748:lTEV chimeric control promoter sequence were connected to universal adapter primer 2, respectively:

[0164] 5'-end universal linker primer 2: 5'-cacgtgaccctagtcacttaaagcttggcgcgcc-3', as shown in SEQ ID NO: 24 in the sequence listing;

[0165] 3' end universal linker primer 2: 5'-cagtagctggtgttggaggcat-3', as shown in SEQ ID NO: 25 in the sequence listing.

[0166] The construction of vectors using conventional enzyme digestion methods is well known to those skilled in the art. The schematic diagram of the structure of the vector DBNBC-HTG containing the herbicide-resistant gene HTG (vector backbone: pCAMBIA2301 (available from CAMBIA) with modified resistance tags) is shown in FIG. Figure 4As shown (Spec: spectinomycin gene; RB: right border; AscI: restriction endonuclease AscI recognition site; HTG: hydroxyphenylpyruvate dioxygenase gene (SEQ ID NO: 26); t35s: cauliflower virus 35s terminator (SEQ ID NO: 14); prAtUbi10: promoter of Arabidopsis thaliana ubiquitin 10 gene (SEQ ID NO: 17); spAtCTP2: Arabidopsis thaliana chloroplast transit peptide (SEQ ID NO: 18); cEPSPS: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 19); tNos: terminator of nopaline synthase gene (SEQ ID NO: 20); LB: left border).

[0167] The above-mentioned vector DBNBC-HTG was subjected to restriction endonuclease AscI for enzyme digestion reaction, thereby linearizing the vector DBNBC-HTG. The enzyme digestion product was purified to obtain a linearized DBNBC-HTG expression vector. The prDCP12 promoter sequence connected to the universal linker primer 2 was subjected to a recombination reaction with the linearized DBNBC-HTG expression vector. The operation steps were carried out according to the instructions of Takara's In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct a recombinant expression vector DBN15-O, whose structural schematic diagram is shown in FIG. Figure 5 shown.

[0168] The recombinant expression vector DBN15-O was transformed into Escherichia coli DH5α competent cells by heat shock method, and the heat shock conditions were as follows: 100 μL of Escherichia coli DH5α competent cells, 20 μL of recombinant plasmid DNA (recombinant expression vector DBN15-O), flicked to mix, heat-shocked in a 42°C water bath for 30 seconds, and immediately placed on ice for 2 minutes; 250 μL of antibiotic-free LB liquid medium (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH adjusted to 7.5 with NaOH), and cultured at 37°C with shaking (200 rpm / min) for 1 hour. Then, the cells were inverted and cultured at 37°C for 12 hours on the LB solid plate containing 50 mg / L spectinomycin, and the positive clone colonies were picked and cultured overnight in LB liquid medium containing 50 mg / L spectinomycin at 37°C with shaking (200 rpm / min). The plasmid was extracted by alkaline lysis: the bacterial solution was centrifuged at 12000 rpm for 1 min, the supernatant was removed, and the precipitated bacteria were suspended with 100 μL of ice-cold solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH = 8.0); 200 μL of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 minutes; add 150 μL of ice-cold solution III (3M potassium acetate, 5M acetic acid), mix thoroughly immediately, and place on ice for 5-10 minutes; centrifuge at 4°C and 12000rpm for 5 minutes, transfer the supernatant to a new 2mL centrifuge tube, add 2 times the volume of anhydrous ethanol, mix and place at room temperature for 5 minutes; centrifuge at 4°C and 12000rpm for 5 minutes, discard the supernatant, wash the precipitate with 70% ethanol (V / V) and dry it; add 30 μL TE (10mM Tris-HCl, 1mM EDTA, pH=8.0) containing RNase (20 μg / mL) to dissolve the precipitate; water bath at 37°C for 30 minutes to digest RNA; store at -20°C for use. The extracted plasmid was sequenced and identified, and the results showed that the recombinant expression vector DBN15-0 contained the nucleotide sequence shown in SEQ ID NO: 1 in the sequence table, namely the prDCP12 promoter sequence.

[0169] According to the above method for constructing a recombinant expression vector DBN15-O containing a prDCP12 promoter sequence, the prGm17gTsf1 control promoter sequence connected to the universal linker primer 2, the pr35S control promoter sequence connected to the universal linker primer 2, and the prAtH4A748:lTEV chimeric control promoter sequence connected to the universal linker primer 2 were respectively subjected to recombination reactions with the linearized DBNBC-HTG expression vector to obtain recombinant expression vectors DBN16-O to DBN18-O in turn, and sequencing verified that the above nucleotide sequences in the recombinant expression vectors DBN16-O to DBN18-O were correctly inserted.

[0170] 2. Transformation of Agrobacterium with recombinant expression vector

[0171] According to the method for transforming Agrobacterium with the recombinant expression vector in Part 1 of the third embodiment, the correctly constructed recombinant expression vectors DBN15-O to DBN18-O were transformed into Agrobacterium GV3101 respectively by liquid nitrogen method. The sequencing verification results showed that the structures of the recombinant expression vectors DBN15-O to DBN18-O were completely correct.

[0172] 3. Detection of the herbicide resistance effect of the promoter of the present invention driving the herbicide-resistant gene HTG in transgenic Arabidopsis plants

[0173] According to the method in part 2 of the third embodiment above, the Arabidopsis inflorescence is immersed in the Agrobacterium solution in part 2 of this embodiment to transfer the T-DNA in the recombinant expression vectors DBN15-O to DBN18-O constructed in part 2 of this embodiment into the Arabidopsis chromosome, and obtain the corresponding transgenic Arabidopsis plants, namely, Arabidopsis T1 plants with prDCP12 promoter sequence, Arabidopsis T1 plants with prGm17gTsf1 control promoter sequence, Arabidopsis T1 plants with pr35S control promoter sequence, and Arabidopsis T1 plants with prAtH4A748:lTEV chimeric control promoter sequence.

[0174] T1 transformants were selected from the untransformed seed background using a glyphosate selection scheme. Arabidopsis T1 plants transformed with the prDCP12 promoter sequence, Arabidopsis T1 plants transformed with the prGm17gTsf1 control promoter sequence, Arabidopsis T1 plants transformed with the pr35S control promoter sequence, Arabidopsis T1 plants transformed with the prAtH4A748:lTEV chimeric control promoter sequence, and wild-type Arabidopsis plants (CK4) (18 days after sowing) were sprayed with 4 times the field concentration (100 g ai / ha) of benzylpyrazone to test the herbicide tolerance of Arabidopsis. Seven days after spraying, the degree of damage to each plant caused by the herbicide was counted based on the proportion of leaf albinism area (leaf albinism area proportion = leaf albinism area / total leaf area × 100%): basically no albinism phenotype was set as level 0, leaf albinism area proportion less than 50% was set as level 1, leaf albinism area proportion greater than 50% was set as level 2, and leaf albinism area proportion 100% was set as level 3.

[0175] According to the formula X = [Σ(N × S) / (T × M)] × 100, the resistance performance of each transformation event of the recombinant expression vector was scored (X-drug damage score, N-number of plants damaged at the same level, S-number of pesticide damage levels, T-total number of plants, M-highest pesticide damage level), and resistance was evaluated according to the scores: high-resistant plants (0-15 points), medium-resistant plants (16-33 points), low-resistant plants (34-67 points), and non-resistant plants (68-100 points). The experimental results are shown in Table 4.

[0176] Table 4. Results of the tolerance test of transgenic Arabidopsis thaliana T1 plants to benzylpyraclostrobin

[0177]

[0178] For Arabidopsis, 4 times the field concentration of fenpyrazone is an effective dose for high pressure treatment. The results in Table 4 show that: (1) Compared with CK4, Arabidopsis plants transferred with the prDCP12 promoter sequence are tolerant to fenpyrazone at 4 times the field concentration. It can be seen that the chimeric promoter prDCP12 of the present invention can drive the expression of the target heterologous gene in plants. (2) Compared with the pr35S and prAtH4A748:lTEV control promoters, prDCP12 drives the herbicide resistance gene HTG in transgenic Arabidopsis plants. The herbicide resistance effect is better.

[0179] Although only specific implementation examples of the present invention are described above, those skilled in the art should understand that these are only examples, and the protection scope of the present invention is defined by the appended claims. Those skilled in the art may make various changes or modifications to these implementations without departing from the principles and essence of the present invention, but these changes or modifications all fall within the protection scope of the present invention.

Claims

1. A chimeric promoter, characterized in that It comprises a PP-prGm17gTsf1 element and a CP-prGmUbi3 element, wherein the PP-prGm17gTsf1 element is operably linked to the CP-prGmUbi3 element, and the PP-prGm17gTsf1 element is located upstream of the CP-prGmUbi3 element; The nucleotide sequences of the PP-prGm17gTsf1 element and the CP-prGmUbi3 element are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

2. The chimeric promoter according to claim 1, characterized in that The chimeric promoter further comprises an enhancer element, wherein the enhancer element is selected from at least one of an eCsVMV element, an L-prGmUbi3 element, and an I-prGm17gTsf1 element; The nucleotide sequences of the eCsVMV element, the L-prGmUbi3 element and the I-prGm17gTsf1 element are shown in SEQ ID NO: 2, SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

3. The chimeric promoter according to claim 1 or 2, characterized in that The enhancer element is selected from a combination of an eCsVMV element, an L-prGmUbi3 element and an I-prGm17gTsf1 element.

4. The chimeric promoter according to any one of claims 1 to 3, characterized in that The enhancer element is located at the 5' end or the 3' end of the chimeric promoter.

5. The chimeric promoter according to any one of claims 1 to 4, characterized in that The eCsVMV element, PP-prGm17gTsf1 element, CP-prGmUbi3 element, L-prGmUbi3 element and I-prGm17gTsf1 element are operably linked in sequence in the direction from 5' to 3'.

6. The chimeric promoter according to any one of claims 1 to 5, characterized in that The nucleotide sequence of the chimeric promoter is shown in SEQ ID NO:

1.

7. A recombinant DNA construct comprising the chimeric promoter of any one of claims 1 to 6 operably linked to a heterologous nucleotide sequence of interest.

8. The recombinant DNA construct according to claim 7, characterized in that The target heterologous nucleotide sequence encodes a target protein.

9. An expression cassette comprising the recombinant DNA construct of claim 7 or 8.

10. A recombinant vector comprising the expression cassette of claim 9.

11. A method for expressing a heterologous nucleotide sequence of interest in a plant, characterized in that: include: The heterologous nucleotide sequence of interest operably linked to the chimeric promoter of any one of claims 1 to 6 is stably integrated into plant cells.

12. The method for expressing a target heterologous nucleotide sequence in a plant according to claim 11, characterized in that: The plant is Arabidopsis, rapeseed, tobacco, soybean, cotton, pepper, beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato or peanut.

13. The method for expressing a target heterologous nucleotide sequence in a plant according to claim 11, characterized in that: The target heterologous nucleotide sequence is constitutively expressed in plant tissues.

14. The method for expressing a target heterologous nucleotide sequence in a plant according to claim 11, characterized in that: The target heterologous nucleotide sequence encodes a target protein.

15. The method for expressing a target heterologous nucleotide sequence in a plant according to claim 14, characterized in that: The target heterologous nucleotide sequence encodes a herbicide tolerance protein.

16. The method for expressing a target heterologous nucleotide sequence in a plant according to claim 14, characterized in that: The target heterologous nucleotide sequence encodes an insect resistance protein.

17. A plant or part thereof, characterized in that A chimeric promoter comprising any one of claims 1 to 6.

18. A method for obtaining processed agricultural products, characterized in that: The method comprises processing the harvested plant or part thereof according to claim 17 to obtain a processed agricultural product.

19. Use of the chimeric promoter according to any one of claims 1 to 6 for constitutively expressing a target heterologous nucleotide sequence in plant tissues.

20. Use of the chimeric promoter according to claim 19 for constitutively expressing a target heterologous nucleotide sequence in plant tissue, characterized in that: The plant is Arabidopsis, rapeseed, tobacco, soybean, cotton, pepper, beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato or peanut.

21. Use of the chimeric promoter according to claim 19 for constitutively expressing a target heterologous nucleotide sequence in plant tissue, characterized in that: The target heterologous nucleotide sequence encodes a target protein.

Images