DsRNA nano nucleic acid insecticide for preventing and treating piercing-sucking pests as well as preparation method and application of dsRNA nano nucleic acid insecticide

Abstract

The invention discloses a dsRNA nano nucleic acid insecticide for preventing and treating piercing-sucking pests, the dsRNA nano nucleic acid insecticide is composed of dsRNA of a specific targeting piercing-sucking pest Chs gene and a carrier, the piercing-sucking pests are Panonychus citri, Diaphorina citri or Aphis gossypii, the nucleotide sequences of the Chs gene are respectively shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, and the carrier is MgAl or MgFe layered double-metal hydroxide nanoparticles. The dsRNA nano nucleic acid insecticide is applied to host plants of the piercing-sucking pests, after the plants induce the piercing-sucking pests to eat the dsRNA nano nucleic acid insecticide, RNA synthesis and silent Chs genes are interfered in vivo, death is promoted, and the dsRNA nano nucleic acid insecticide has good application prospects in treatment of the piercing-sucking pests.

Description

Technical Field

[0001] The present invention belongs to the field of pest control and relates to nucleic acid insecticides, in particular to a double-stranded RNA (dsRNA) nano nucleic acid insecticide. Background Art

[0002] So far, chemical pesticides are still the main means of controlling agricultural pests. However, chemical pesticides lack selectivity and may accidentally harm natural enemies, bees or other organisms while killing pests. In addition, with the frequent use of chemical pesticides, pest resistance problems frequently occur, and the control effect continues to decline. In order to effectively deal with the selectivity and resistance problems caused by chemical pesticides, new nucleic acid insecticides have been continuously developed and marketed in recent years. Unlike chemical pesticides, nucleic acid insecticides induce "RNA interference" in pests, leading to gene silencing and pest death. It is a safe, green and efficient new pesticide.

[0003] "RNA interference" is one of the most important biological discoveries of this century. It was originally developed by genetically modifying crops to produce double-stranded RNA targeting pests. After inducing them to eat, the RNA interference program is activated to kill the pests or inhibit their growth and reproduction. It was later discovered that double-stranded RNA can also be absorbed and spread by crops and enter the bodies of pests to exert their effects by spraying on the surface of crops, or by injection, seed treatment, soil irrigation, etc. At present, this non-genetically modified nucleic acid insecticide has made positive progress in the prevention and control of pests such as diamondback moth, fruit fly, and whitefly.

[0004] Piercing-sucking pests are considered to be one of the most important pest groups in global agriculture. They are characterized by a wide variety of species, wide distribution, miscellaneous diet, strong reproductive capacity, and severe damage. Their feeding can cause branches, leaves, and flowers to curl, become deformed, and wilt. In severe cases, the entire plant may wither or die. They can also spread viruses while feeding. Unlike chewing pests, piercing-sucking pests suck by pricking, so double-stranded RNA is required in plant sap. The wax layer, cuticle, cell wall, and cell membrane of the plant epidermis all constitute a barrier to the absorption and diffusion of double-stranded RNA. In addition, RNA molecules have poor stability and are easily degraded by nucleases. They can also be destroyed by ultraviolet light, high temperature, and acidic and alkaline environments. In addition, different crops have different ways of transmitting double-stranded RNA, and different pests have different absorption efficiencies for double-stranded RNA, resulting in great differences in the RNA interference effects of different pests. All of the above are key factors that determine the success or failure of nucleic acid insecticides in the control of piercing-sucking pests.

[0005] Nanoparticles are particles with a diameter ranging from 1 to 100 nm. They have high biocompatibility and degradability, and low toxicity and cost. Currently, nanomaterials have been widely used in various fields. In the agricultural field, nanoparticles can improve the delivery efficiency and stability of dsRNA, thereby promoting the development of dsRNA biopesticides. Based on this, this study screened target genes for piercing-sucking pests, synthesized dsRNA based on the screened target genes, and studied the synergistic effect of nanoparticles on dsRNA, and finally developed an efficient and green piercing-sucking pest control strategy. Summary of the invention

[0006] RNA interference (RNAi) has been proven to be a powerful insecticide technology. In piercing-sucking pests, double-stranded RNA (dsRNA) can be absorbed through the plant wall and then transported into the pest body through the feeding pathway. However, the use of dsRNA as a nucleic acid insecticide in piercing-sucking pests is hindered by the unique barrier imposed by the plant surface and cell wall, which hinders the effective delivery of dsRNA into the plant body. To this end, the present invention overcomes the shortcomings of the prior art and proposes a dsRNA nano nucleic acid insecticide for piercing-sucking pests. It uses nanomaterials MgAl-LDH and MgFe-LDH as carriers, loads dsRNA, and efficiently delivers dsRNA to interfere with target gene expression and promote the death of piercing-sucking pests, thereby achieving the purpose of green and efficient control of piercing-sucking pests.

[0007] To achieve the above object, the present invention uses the following technical solutions: dsRNA nanoparticles for the control of piercing-sucking pests, which specifically target piercing-sucking pests Chs The dsRNA of the gene and a vector are composed, and the piercing-sucking pest is Panonychus citri Panonychus citri , citrus psyllid Diaphorina citri Aphis gossypii Aphis gossypii , the citrus mites Chs Gene (abbreviated as PcChs The nucleotide sequence of the gene is shown in SEQ ID NO.1, the citrus psyllid Chs Gene (abbreviated as DcChs The nucleotide sequence of the gene is shown in SEQ ID NO.2, and the cotton aphid Chs Gene (abbreviated as AgChs The nucleotide sequence of the gene is shown in SEQ ID NO.3, and the carrier is MgAl or MgFe layered double metal hydroxide nanoparticles.

[0008] The preparation method of the dsRNA nano nucleic acid insecticide comprises the following steps: 1) Extract total RNA from piercing-sucking pests, reverse transcribe it into cDNA, use cDNA as template, design primers to amplify theChs Gene, the amplified product was connected with the vector plasmid to obtain Chs Gene expression plasmid; 2) Connect the T7 promoter sequence to the 5′ end of the designed primer, use the constructed expression plasmid as a template for PCR amplification, and transcribe the amplified product in vitro to synthesize a specific target for piercing-sucking pests. Chs dsRNA of a gene; 3) reacting Mg(NO3)2 with Al(NO3)3 or Fe(NO3)3 in a NaOH solution, collecting the precipitate by centrifugation, and heating the precipitate in a reactor to obtain MgAl or MgFe layered double hydroxide nanoparticles; 4) The synthesized dsRNA is co-incubated with layered double metal hydroxide nanoparticles, and the precipitate is collected by centrifugation to obtain a dsRNA nano nucleic acid insecticide for controlling piercing-sucking pests.

[0009] The sequences of the amplified products of the primers are shown in SEQ ID NOs. 1, 2, and 3, respectively. PcChs, DcChs, AgChs Gene.

[0010] Wherein, the sequence of the T7 promoter is shown as SEQ ID NO.4.

[0011] Wherein, the mass ratio of the dsRNA to the layered double hydroxide nanoparticles is 1:1-11.

[0012] Preferably, the target citrus mites, citrus psyllids, cotton aphids Chs The mass ratios of the dsRNA of the genes (respectively referred to as dsPcChs, dsDcChs, and dsAgChs) to MgAl layered double hydroxide nanoparticles were 1:5, 1:7, and 1:9, respectively; and the mass ratios to MgFe layered double hydroxide nanoparticles were 1:7, 1:7, and 1:9, respectively.

[0013] Apply the dsRNA nano nucleic acid insecticide to the host plant of the piercing-sucking pest, and the piercing-sucking pest will feed on the host plant and interfere with the Chs The dsRNA nanoparticle nucleic acid insecticide prepared by the invention has a good application prospect in the control of piercing-sucking pests.

[0014] The beneficial effects of the present invention are: The nucleic acid insecticide prepared by the present invention overcomes the barrier obstacles imposed by the plant surface and cell wall, and can penetrate the plant epidermis and enter the body fluid circulation, thereby being eaten by piercing-sucking pests and interfering with Chs Gene expression, on this basis, the present invention confirms PcChs , DcChs andAgChs The silencing of the gene promoted the death of Panonychus citri, Psyllid citri and Aphid gossypii. The dsRNA delivery system constructed by the present invention significantly improved the interference efficiency of dsRNA on the target gene of piercing-sucking pests, increased the mortality rate of piercing-sucking pests, and achieved efficient and green prevention and control of piercing-sucking pests. The present invention also has the advantages of good biocompatibility and high stability of dsRNA, and can be widely used in the prevention and control of other piercing-sucking pests. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 : Particle size, monodispersity and Zeta potential test results of MgAl-LDH and MgFe-LDH.

[0016] Figure 2 : Electrophoresis detection of dsRNA with dsGFP as control.

[0017] Figure 3 : Electrophoresis detection diagram of MgAl-LDH-dsRNA and MgFe-LDH-dsRNA prepared in different proportions. DETAILED DESCRIPTION

[0018] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0019] Key Materials: pTOPO-T Simple plasmid: used as PcChs , DcChs and AgChs The gene expression vector was purchased from Beijing Aidlab Biological Co., Ltd.

[0020] Total Gold Trans 5α Chemically Competent Cells (CD201-02): for PcChs , DcChs and AgChs The gene expression was purchased from Beijing Bio-Innovation Technology Co., Ltd.

[0021] Other materials not described herein are conventional materials in the art.

[0022] Example 1 Preparation of Layered Double Hydroxide (LDHs) Nanoparticles Using the co-precipitation method, weigh 6 mmol Mg(NO3)2·6H2O and 2 mmol Al(NO3)3·9H2O or 2 mmolFe(NO3)3·9H2O, add them to 10 ml methanol, and after fully dissolving, add 40 ml NaOH (16 mmol) methanol solution. Stir the mixed solution under N2 protection for 30 minutes, and then collect the precipitate by centrifugation.

[0023] The collected precipitate was then washed three times with 40 ml of methanol, dispersed in 40 ml of methanol and transferred to a high-pressure reactor and heated to 80°C for reaction. The reaction time for MgAl-LDH was 6 hours, and the reaction time for MgFe-LDH was 24 hours. After the reaction, the precipitate was collected by centrifugation and washed three times with deionized water to obtain MgAl-LDH and MgFe-LDH nanoparticles.

[0024] The precipitate was resuspended in 40 ml of deionized water, 50 ul was taken from each of the 40 ml MgAl-LDH or MgFe-LDH suspensions, and diluted 500 times with deionized water. The dilutions were then ultrasonicated for 30 min, and 1 ml of the dilutions were placed in a glass cuvette. The particle size, monodispersity and Zeta potential of the MgAl-LDH or MgFe-LDH nanosheets were measured by a nanoparticle size analyzer (Malvern Instruments Ltd., UK). In addition, 1 ml was taken from the 40 ml MgAl-LDH or MgFe-LDH suspensions, and its morphology was photographed by a transmission electron microscope (JEOL, Japan Electronics Co., Ltd.).

[0025] The results are as follows Figure 1 As shown in Figure 2, transmission electron microscopy results show that both MgAl-LDH and MgFe-LDH nanosheets are hexagonal ( Figure 1 AB), with particle sizes of 49.76±0.18 nm and 64.91±1.79 nm ( Figure 1 C); monodispersity indices were 0.13±0.02 and 0.15±0.01 ( Figure 1 C); Zeta potentials were 47.32±0.46 mV and 66.34±0.79 mV ( Figure 1 D).

[0026] Example 2 Chs Gene cloning and dsRNA synthesis 1. Gene cloning Takara's Trizol was used to extract total RNA from Panonychus citri, Psyllid citri and Aphis gossypii, and then cDNA was synthesized using the total RNA as a template according to the reverse transcription kit steps. PcChs (SEQ IDNO.1), citrus psyllid DcChs (SEQ ID NO.2) and cotton aphid AgChsA primer was designed on the coding region of the (SEQ ID NO.3) gene. The primer sequence is shown in Table 1. Using cDNA as a template, specific primers were used to PCR amplify the target gene fragment. The PCR reaction conditions were: 94℃ pre-denaturation for 3min; 94℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 60s, 35 cycles; 72℃ extension for 10min; 4℃ storage. After the PCR product was detected by agarose gel electrophoresis, it was excised and recovered according to the steps of the gel recovery kit. The PCR product was then connected to the pTOPO-T Simple vector and transformed into the competent cell Trans 5α. After the expression plasmid was sequenced and verified, the successfully cloned target fragment plasmid was extracted using a plasmid miniprep kit (OMEGA, USA) as a template for synthesizing dsRNA.

[0027] Table 1 Piercing-sucking pests Chs PCR primers for gene amplification

[0028] Table 2 Connection system

[0029] The method for extracting plasmids is as follows: the accurate clones obtained by sequencing are expanded in LB bacterial solution containing ampicillin resistance, and then the target fragment plasmid is extracted according to the following operation: (1) Take 1.5-5 ml of bacterial culture and centrifuge at 10,000 g for 1 min at room temperature and discard the supernatant; (2) Add 250 µl of Solution I (containing RNase A) and vortex until the bacteria are completely suspended. (3) Add 250 µl of Solution II and gently invert the tube 4 to 6 times to obtain a clear lysate. (4) Add 350 µl of Solution III, gently invert several times to mix (a white flocculent precipitate will appear), and centrifuge at 10,000 g for 10 min at room temperature; (5) Aspirate the supernatant and transfer it to a clean absorption column equipped with a 2 ml centrifuge tube. Centrifuge at 10,000 g for 1 min at room temperature and discard the filtrate. (6) Add 500 µl Buffer HB, centrifuge at 10,000 g for 1 min, and discard the filtrate; (7) Add 750 µl Wash Buffer to wash the absorption column, centrifuge at 10,000 g for 1 min, and discard the filtrate; wash again in the same way and centrifuge at 13,000 g for 1 min; (8) Centrifuge the absorption column at 10,000 g for 2 min (to ensure that ethanol is removed); (9) Place the absorption column in a clean 1.5 ml centrifuge tube, add 50–100 µl of sterile water or TE buffer to the center of the absorption column filter membrane, and centrifuge at 10,000 g for 1 min. Store at –20°C.

[0030] 2. Preparation of DsRNA (1) PCR amplification of target fragment In Table 1 PcChs -F. PcChs -R, DcChs -F. DcChs -R, AgChs -F and AgChs The T7 promoter sequence GGATCCTAATACGACTCACTATAGG was added to the 5′ end of the -R primer, and the primer was synthesized by Nanjing GenScript Biotechnology Co., Ltd. Then, PCR amplification was performed using the expression plasmid constructed in step 1 as a template, and the reaction system and reaction conditions were the same as above. The integrity of the PCR product was tested by 1.2% agarose gel electrophoresis, and then the gel was excised and recovered according to the gel recovery kit steps after agarose gel electrophoresis.

[0031] (2) T7 in vitro transcription synthesis of dsRNA In vitro dsRNA synthesis was performed using the Promega T7 Ribomax Express RNAi System kit, and the reaction system was as follows: Table 3 dsRNA transcription system

[0032] (1) Place the prepared mixture in a PCR reaction at 37°C for 4 h. (2) Place the reaction solution in a 70°C water bath for 10 min, close the water bath, and allow it to slowly cool to room temperature. (3) Add 1 μl of RQ1 RNase-free DNase and 1 μl of 200-fold diluted RNase A solution to the reaction solution, flick to mix, and incubate at 37°C for 30 min to remove single-stranded RNA and double-stranded DNA. (4) Add 0.1 volume of 3 M ammonium acetate (pH = 5.2) and 1 volume of isopropanol to the reaction solution after incubation, flick to mix, and place on ice for 10 min; centrifuge at 4 °C, 1200 rpm for 10 min, and remove the supernatant; (5) Add 0.5 ml of 75% pre-cooled DEPC-treated enzyme-free ethanol to wash the precipitate, centrifuge at 4°C, 1200 rpm for 5 min, and remove the supernatant; (6) Dry at room temperature for 15 min, add 30-50 μl of enzyme-free water to dissolve the precipitate. Detect the correctness of the target dsRNA band by agarose gel electrophoresis ( Figure 2 ). Store at -20℃ or -80℃ until use.

[0033] Example 3 Preparation of MgAl-LDH-dsRNA and MgFe-LDH-dsRNA The synthesized MgAl-LDH and MgFe-LDH were mixed with dsRNA in different mass ratios (1:1, 3:1, 5:1, 7:1, 9:1, 11:1), respectively, and then incubated in a shaker at 37°C and 220 rpm for 30 min. After the incubation, the precipitate was collected by centrifugation and dissolved in enzyme-free water to obtain the nano-delivery systems MgAl-LDH-dsRNA and MgFe-LDH-dsRNA.

[0034] Figure 3 The electrophoresis detection diagram of MgAl-LDH-dsRNA and MgFe-LDH-dsRNA prepared in different ratios. In gel electrophoresis, 2 kb + The marker is used as an indicator band to show the location of the dsRNA fragment size, and the location shown by the dsRNA band is used as a reference. When LDH cannot completely load dsRNA, there will be a band that is the same as the reference; when LDH is completely loaded with dsRNA, the formed complex (showing milky white) stays in the upper spot hole, in this case, it indicates the optimal ratio of LDH loading dsRNA. As can be seen from the figure, the optimal ratios of MgAl-LDH to dsPcChs, dsDcChs and dsAgChs are 5.0:1, 7.0:1 and 9.0:1 respectively; the optimal ratios of MgFe-LDH to dsPcChs are 7.0:1, 7.0:1 and 9.0:1 respectively.

[0035] Table 4 shows the particle size, potential and loading efficiency test results of MgAl-LDH-dsRNA and MgFe-LDH-dsRNA, wherein the loading efficiency test and calculation method is: using an ultra-micro spectrophotometer (Thermo Fisher, USA) to test the OD value of MgAl-LDH-dsRNA or MgFe-LDH-dsRNA under the optimal mass ratio condition. 260 The absorbance value at 100 nm was the total dsRNA. Then, MgAl-LDH-dsRNA or MgFe-LDH-dsRNA was centrifuged at 4°C, 15,000 rpm, for 30 min, and the OD in the supernatant was measured. 260The absorbance value at is the supernatant dsRNA. MgAl-LDH and MgFe-LDH without dsRNA were used as blank controls. The loading efficiency (%) was calculated using the following formula: Loading efficiency (%) = (total dsRNA - supernatant dsRNA) / total dsRNA × 100 It can be seen from Table 4 that the loading efficiencies of MgAl-LDH-dsPcChs, MgAl-LDH-dsDcChs and MgAl-LDH-dsAgChs are 91.38%, 92.44% and 95.41%, respectively, and the loading efficiencies of MgFe-LDH-dsPcChs, MgFe-LDH-dsDcChs and MgFe-LDH-dsAgChs are 92.60%, 91.21% and 94.99%, respectively.

[0036] Table 4 Detection results of MgAl-LDH-dsRNA and MgFe-LDH-dsRNA

[0037] Example 4 Indoor biological activity determination of nucleic acid insecticides In order to determine the effects of nanonucleic acid insecticides on PcChs , DcChs and AgChs To investigate the effect of the PCR on gene expression, shoots about 6-8 cm long with 3 leaves were collected from HB grapefruit trees (host of Panonychus citri), Murraya paniculata plants (host of Psyllid citri), and cotton plants (Aphis gossypii). The shoots were washed with enzyme-free water to reduce bacterial contamination on the shoots. The stem base of the shoots was cut at a 45° angle and dried at room temperature for 2 h. The shoots were inserted into enzyme-free EP tubes containing the test solution and placed at room temperature for 12 h to stimulate the absorption of the test solution. The treated shoots were then transferred to a box (6.5 cm in diameter and 10 cm in height) containing sterile agar medium, and the test tubes containing the shoots were fixed. Panonychus citri, Psyllid citri, and Aphis gossypii fed on the shoots treated with the test solution for 48 h, and then the mortality of Panonychus citri nymphs, Psyllid citri nymphs, and Aphis gossypii larvae were counted. The surviving individuals were used for qPCR experiments to detect the interference efficiency of the target gene.

[0038] In the bioassay of Panonychus citri nymphs, tender shoots were inserted into enzyme-free EP tubes containing 300 μl (640 ng / μl) of MgAl-LDH-dsPcChs or MgFe-LDH-dsPcChs as the treatment group, naked dsPcChs as the control group, and tender shoots treated with only 300ul enzyme-free water as the blank control group (only used to count the mortality rate and for the calculation of the corrected mortality rate, the formula is: Corrected mortality rate (%) = (MgAl-LDH-dsRNA or naked dsRNA treatment group mortality rate - blank control group mortality rate) / (100 - blank control group mortality rate) × 100. About 200 citrus Panonychus nymphs that were starved for 24 hours were released on each tender shoot.

[0039] In the citrus psyllid nymph survival test, the tender shoots were inserted into 200 μl (160 ng / μl) of MgAl-LDH-dsDcChs or MgFe-LDH-dsDcChs enzyme-free EP tubes as the treatment group, naked dsDcChs as the control group, and tender shoots treated with only 200 ul enzyme-free water as the blank control group (only used to count the mortality rate). About 25 5th instar citrus psyllid nymphs that had been starved for 8 hours were released on each tender shoot.

[0040] In the cotton aphid larvae survival test, the tender shoots were inserted into 300 μl (160 ng / μl) of MgAl-LDH-dsAgChs or MgFe-LDH-dsAgChs enzyme-free EP tubes as the treatment group, naked dsAgChs as the control group, and tender shoots treated with only 300 ul enzyme-free water as the blank control group (only used to count the mortality rate). About 80 3rd instar cotton aphid larvae that had been starved for 8 hours were released on each tender shoot.

[0041] Table 5 Gene silencing efficiency determination results

[0042] The results show that compared with dsRNA without LDH nanoparticles, the gene silencing efficiency of MgAl-LDH-dsRNA or MgFe-LDH-dsRNA prepared by the present invention is greatly improved, and the gene silencing efficiency of MgFe-LDH-dsRNA is generally higher than that of MgAl-LDH-dsRNA.

[0043] Table 6 Mortality determination results

[0044] The results show that compared with dsRNA without LDH nanoparticles, the corrected mortality rate of MgAl-LDH-dsRNA or MgFe-LDH-dsRNA prepared by the present invention is greatly improved.

[0045] In summary, the present invention successfully constructed a nucleic acid insecticide composed of nanomaterials carrying dsRNA, which significantly improved the interference efficiency of dsRNA on the target genes of piercing-sucking pests, increased the mortality rate of piercing-sucking pests, and achieved efficient and green prevention and control of piercing-sucking pests. The invention has the advantages of simple synthesis method, low cost, good biocompatibility, etc.

Claims

1. dsRNA nanoparticles for the control of piercing-sucking pests, which specifically target piercing-sucking pests Chs The dsRNA of the gene and a vector are composed of the piercing-sucking pests are citrus mites Panonychus citri , citrus psyllid Diaphorina citri Aphis gossypii Aphis gossypii , the citrus mites PcChs The nucleotide sequence of the gene is shown in SEQ ID NO.

1. DcChs The nucleotide sequence of the gene is shown in SEQ ID NO.2, and the cotton aphid AG The nucleotide sequence of the gene is shown in SEQ ID NO.3, and the carrier is MgAl or MgFe layered double metal hydroxide nanoparticles.

2. A method for preparing the dsRNA nanoparticle insecticide according to claim 1, characterized in that The following steps are involved: 1) Extract total RNA from piercing-sucking pests, reverse transcribe it into cDNA, use cDNA as template, design primers to amplify the Chs Gene, the amplified product was connected with the vector plasmid to obtain Chs Gene expression plasmid; 2) Connect the T7 promoter sequence to the 5′ end of the designed primer, use the constructed expression plasmid as a template for PCR amplification, and transcribe the amplified product in vitro to synthesize a specific target for piercing-sucking pests. Chs dsRNA of a gene; 3) reacting Mg(NO3)2 with Al(NO3)3 or Fe(NO3)3 in a NaOH solution, collecting the precipitate by centrifugation, and heating the precipitate in a reactor to obtain MgAl or MgFe layered double hydroxide nanoparticles; 4) The synthesized dsRNA is co-incubated with layered double metal hydroxide nanoparticles, and the precipitate is collected by centrifugation to obtain a dsRNA nano nucleic acid insecticide for controlling piercing-sucking pests.

3. The method for preparing the dsRNA nanoparticle insecticide according to claim 2, characterized in that: The sequence of the T7 promoter is shown in SEQ ID NO.

4.

4. The method for preparing the dsRNA nanoparticle insecticide according to claim 2, characterized in that: The mass ratio of the dsRNA to the layered double hydroxide nanoparticles is 1: 1-11.

5. The method for preparing the dsRNA nanoparticle insecticide according to claim 4, characterized in that: The target citrus mites, citrus psyllids, cotton aphids Chs The mass ratios of the gene's dsRNA to MgAl layered double hydroxide nanoparticles were 1: 5, 1: 7 and 1: 9, respectively; and the mass ratios to MgFe layered double hydroxide nanoparticles were 1: 7, 1: 7 and 1: 9, respectively.

6. Use of the dsRNA nano nucleic acid insecticide according to claim 1 in controlling piercing-sucking pests.

7. A method for controlling piercing-sucking pests, characterized in that: Apply the dsRNA nano nucleic acid insecticide according to claim 1 to the host plant of the piercing-sucking pest, and the piercing-sucking pest will be fed by the insect and interfere with the Chs Normal expression of genes promotes death.

Images