An early flowering molecular marker of rapeseed BnaC3.LEAFY and its application in breeding

Abstract

The present invention provides a BnaC3.LEAFY early flowering molecular marker of Brassica napus and its application in breeding, belonging to the field of plant molecular breeding and gene editing technology, and analyzes the gene structure variation of large fragments on the genome of the core germplasm resources of Brassica napus, excavates the genetic loci that affect the early and late formation of inflorescence, and obtains the corresponding gene structure variation sequence DEL00110133; molecular markers are developed based on the structure variation sequence, and the obtained molecular markers can be used to screen the germplasm with early inflorescence establishment and early flowering time traits in different germplasm resources of Brassica napus, which is beneficial to the subsequent rapid breeding of rapeseed. The present invention also performs genetic sequence editing based on CRISPR / Cas9 on the gene structure variation sequence to obtain a new late flowering genetic sequence, and provides a new method and new gene sequence resources for the breeding of Brassica napus with late inflorescence establishment and late flowering time.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant molecular breeding and gene editing, and in particular relates to a rapeseed BnaC3.LEAFY early flowering molecular marker and application thereof in breeding. Background Art

[0002] Brassica napus (AACC, 2n=38) is an important oil crop cultivated in China and around the world. It is formed by natural hybridization of Brassica rapa and Brassica oleracea and genome doubling to form allotetraploids. Therefore, Brassica napus (hereinafter referred to as rapeseed) has a very rich genetic variation basis. The overwintering Brassica napus production areas mainly adopt the "oil-rice" or "oil-rice-rice" rotation system for multi-cropping production in one year to ensure the security of grain and oil supply. In recent years, with the continuous extension of the rice growing period and the promotion of the "oil-rice-rice" three-cropping system, the demand for early-flowering and early-maturing rapeseed germplasm that adapts to the crop rotation has continued to increase. At present, most of the rapeseeds planted have a long growing period, and there is a crop rotation contradiction between rapeseed and rice, which affects the planting of rice; at the same time, the excessively long growing period makes it easy for rapeseed to encounter extremely unfavorable weather in the later stage, such as high temperature forced maturity, which ultimately affects the yield. Understanding the impact of changing environmental conditions on reproductive transition and the initiation of inflorescence development is crucial for rapeseed reproductive adaptation. For most plants, such as annual Arabidopsis, early reproductive transition and inflorescence establishment can shorten the life cycle and reduce the likelihood of being affected by extreme weather. For crops, the length of the life cycle is a more complex agronomic trait. Crops sense environmental conditions, regulate vegetative growth and reproductive growth, enter reproductive growth at the right time, initiate inflorescence establishment and flowering, reflecting the adaptability of rapeseed to the environment. Therefore, in production practice, early-flowering and early-maturing rapeseed germplasm needs to have characteristics such as early inflorescence establishment and early flowering.

[0003] In the genome, single nucleotide polymorphisms (SNPs) and small insertions or deletions (INDELs) are widely present types of genomic structural variation, which promote the differentiation of many important agronomic traits in natural populations. With the development of second-generation genome sequencing and assembly technology, SNP-based genome-wide association study (GWAS) has been used in various studies to detect many genomic loci associated with phenotypes. Taking flowering time as an example, many studies have reported that the homologous genes of Arabidopsis FLOWERINGLOCUS T (FT) and FLOWERINGLOCUS C (FLC) have multiple SNPs in Brassica napus, and these SNPs are closely related to the differentiation of its ecotype and the regulation of flowering time. Compared with SNPs and INDELs, structural variations (SVs) have a larger variation range, often greater than 50 to 100 base pairs (bp), and even up to tens of thousands of bp, which have greater interference with the coding region and cis-regulatory region on the chromosome. Gene structural variations include presence and absence variations (PAVs), duplications (DUPs) and inversions (INVs) of large fragment sequences. These gene structural variations have a more profound impact on plant evolution and the genetic determination of agronomic traits; however, due to the limitations of sequencing technology, the detection of gene structural variations must rely on long-chain sequencing, so researchers' understanding of gene structural variations and genotypes and phenotypes also begins here. In the whole genome, most gene structural variations related to genes are located in cis-regulatory regions, and only a small number exist in coding sequence regions (CDS). Gene structural variation in exons usually leads to gene expression inhibition, while SVs in promoter and intron regions have more diverse effects on gene expression, which can promote or inhibit gene expression. In Brassica napus, BnaA10.FLC showed different structural variations in spring and winter ecotypes. In the spring material Westar, a 5,625-base LINE-type reverse transposon (TE) was inserted into the coding region of BnaA10.FLC, resulting in almost undetectable expression.In winter materials Darmor and Tapidor, a 621-base MITE transposon was inserted into the promoter region, which enhanced the expression of BnaA10.FLC and delayed the flowering time (Yin, S., Wan, M., Guo, C., Wang, B., Li, H., Li, G., Tian, ​​Y., Ge, X., King, GJ, Liu, K., et al. (2020). Transposon insertions within alleles of BnaFLC.A10 and BnaFLC.A2 are associated with seasonal crop type in rapeseed. J Exp Bot 71: 4729-4741.). In the allotetraploid Brassica napus with a more complex genome, there are relatively few studies on the association between gene structural variation and phenotype. How it affects the time of inflorescence establishment and flowering time of rapeseed needs further exploration.

[0004] In Arabidopsis, key regulators of reproductive development initiation such as phosphatidylethanolamine-binding protein (PEBP) family proteins have been extensively studied. FT promotes reproductive processes, while TERMINALFLOWER 1 (TFL1) promotes vegetative growth. Variations in the form of SNPs, INDELs, and SVs of FT and TFL1 have been widely present in a variety of crops, determining their flowering time. In the reproductive process of Arabidopsis thaliana (At), AtLEAFY (AtLFY) acts as a pioneer transcription factor to determine floral meristems by upregulating APETALA1 (AtAP1), which in turn positively regulates AtLFY expression through a positive feedback mechanism. Recent studies have found that AtLFY plays different regulatory roles on AtFT and AtTFL1, achieving precise regulation of plant architecture and flowering. Recent studies have found that AtLFY is under opposite regulation of AtFT and AtTFL1 (Zhu, Y., Klasfeld, S., Jeong, CW, Jin, R., Goto, K., Yamaguchi, N., and Wagner, D. (2020). TERMINAL FLOWER 1-FD complex target genes and competition with FLOWERING LOCUS T. Nat Commun 11: 5118.).

[0005] With the development of CRISPR / Cas9 technology, knocking out a gene by gene editing candidate gene sites can verify whether the gene really controls certain traits. The CRISPR / Cas9 currently used basically targets the sgRNA target at the gene coding region in order to change the amino acid sequence of the encoded protein to achieve the purpose of confirming the gene function. On the genome-wide scale, the distribution of gene structural variation is mostly located in non-coding regions, such as intron regions within genes, or regions between genes. By changing the gene sequence of the non-coding region, the expression of the target gene can be upregulated or downregulated without changing the protein sequence it encodes. In the study of Brassica napus, how to use non-coding regions to regulate the expression of target genes and then change plant traits needs further study. Summary of the invention

[0006] In view of this, the purpose of the present invention is to analyze the gene structure variation of large fragments on the genome of cabbage-type core germplasm resources, to explore the genetic loci that affect the early and late inflorescence formation, to develop molecular markers, and to verify the genetic and molecular functions of the fragments through gene editing technology, to create new genetic sequences, to directionally change the agronomic traits of the early and late inflorescence formation, and to provide a good strategy for the improvement of rapeseed germplasm traits.

[0007] The present invention provides a gene structure variation sequence DEL00110133 as a Brassica napus BnaC3.LEAFY early flowering molecular marker, and the BnaC3.LEAFY early flowering molecular marker is shown as SEQ ID NO.1.

[0008] The present invention provides an application of the BnaC3.LEAFY early flowering molecular marker in promoting the expression of the BnaC3.LEAFY gene of rapeseed, promoting early flowering of rapeseed or shortening the growth period of rapeseed. The BnaC3.LEAFY early flowering molecular marker is introduced into the second intron region of the BnaC3.LEAFY gene of rapeseed, the expression level of the BnaC3.LEAFY gene of rapeseed is increased, the rapeseed exhibits an early flowering phenotype, and the growth period of rapeseed is shortened.

[0009] The invention provides a primer set for amplifying a BnaC3.LEAFY early flowering molecular marker of Brassica napus, comprising BnaC3.LEAFY_DEL00110133_F and BnaC3.LEAFY_DEL00110133_R; the sequence of BnaC3.LEAFY_DEL00110133_F is shown in SEQ ID NO.2, and the sequence of BnaC3.LEAFY_DEL00110133_R is shown in SEQ ID NO.3.

[0010] The present invention provides a method for screening rapeseed germplasm with an early flowering phenotype, comprising the following steps:

[0011] 1) Extracting genomic DNA from samples to be screened;

[0012] 2) using the primer set to amplify the genomic DNA obtained in step 1) to obtain an amplified product; if the amplified product includes the BnaC3.LEAFY early flowering molecular marker, it is determined to be a rapeseed germplasm with an early flowering phenotype; otherwise, it is determined to be a rapeseed germplasm without an early flowering phenotype.

[0013] The present invention provides an sgRNA for preparing a rapeseed late flowering genetic sequence, including sgRNA-2, sgRNA-26 or sgRNA-31; the sequence of the sgRNA-2 is shown in SEQ ID NO.4, the sequence of the sgRNA-26 is shown in SEQ ID NO.5, and the sequence of the sgRNA-31 is shown in SEQ ID NO.6.

[0014] The present invention provides an application of the sgRNA in reducing the expression level of the BnaC3.LEAFY gene, preparing a rapeseed late-flowering genetic sequence or extending the growth period of rapeseed, and utilizing CRISPR / CAS9 gene editing technology to delete the second intron sequence of the BnaC3.LEAFY gene, obtain a rapeseed late-flowering genetic sequence, reduce the expression level of the BnaC3.LEAFY gene, and extend the growth period of rapeseed.

[0015] The present invention provides a rapeseed late-flowering genetic sequence, and the sequence is shown as SEQ ID NO.7 or SEQ ID NO.8.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention uses the core germplasm resources of Brassica napus planted in the field to study the correspondence between early flowering traits and gene structure variation. The natural population used in the present invention has good genetic diversity and can represent various agronomic traits of rapeseed of different ecotypes. The present invention obtains genetic loci that affect the early flowering of inflorescences through whole genome analysis based on genome structure variation, and obtains corresponding gene structure variation. For one of the BnaC3.LEAFY genes on chromosome C3, there is a gene structure variation sequence DEL00110133 in the second intron non-coding region of the gene. The presence of this gene structure variation sequence is conducive to high expression of the gene and is consistent with the early flowering phenotype of field planting materials.

[0018] The present invention develops a molecular marker primer set for the above-mentioned gene structure variation sequence DEL00110133. The obtained primer set can be used to screen germplasms or plants with early inflorescence establishment and early flowering time traits in different germplasm resources of Brassica napus, and can be applied to subsequent rapeseed rapid breeding.

[0019] The present invention also performs CRISPR / Cas9-based genetic sequence editing on the gene structure variation sequence DEL00110133. This method can prepare a new late-flowering genetic sequence, providing a new method and new gene sequence resources for breeding Brassica napus with late inflorescence establishment and late flowering time. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Inflorescence formation of 279 varieties was observed in the field after overwintering and scored by "1" and "0". Schematic diagram of the scoring criteria;

[0021] Figure 2 Seven significant qVIF genetic loci were obtained based on whole genome analysis of gene structural variation, among which qVIF-5 and qVIF-6 were located in high linkage disequilibrium regions;

[0022] Figure 3 The gene structure variations in the seven qVIF genetic loci are shown in Figure 2. Except for the gene structure of qVIF-3, which is located in the gene coding region, the other gene structure variations are located in the gene non-coding region. The green area represents exons, the broken line area represents introns, and the other blank areas represent non-coding regions.

[0023] Figure 4 The PCR experiment was performed using a molecular marker primer set to distinguish haplotype 1 and haplotype 2 of BnaC3.LFY, where (a) is the haplotype gene structure of BnaC3.LFY; (b) PCR was performed using the primers in (a) to determine the haplotype distribution of field materials.

[0024] Figure 5 To align gBnaC3.LFY with gAtLFY by mVISTA, we found that DEL00110136 was beyond the regulatory range of the distal regulatory region of LFY;

[0025] Figure 6 The distribution of different haplotypes of BnaC3.LFY and the early and late establishment of inflorescences. The yellow marks are germplasms that have established inflorescences in the field, and the green marks are germplasms that have not yet established inflorescences in the field;

[0026] Figure 7The expression level and flowering time of BnaC3.LFY of different haplotypes in Hangzhou and Changxing in January 2024 are statistically analyzed. (b) The data are statistical data from a previously published paper (Wu, D., Liang, Z., Yan, T., Xu, Y., Xuan, L., Tang, J., Zhou, G., Lohwasser, U., Hua, S., Wang, H., et al. (2019). Whole-Genome Resequencing of a Worldwide Collection of Rapeseed Accessions Reveals the Genetic Basis of Ecotype Divergence. Mol Plant 12: 30-43.) and re-analyzed.

[0027] Figure 8 To edit the second intron of BnaC3.LFY in Brassica napus Westar, where (a) shows two homozygous mutants BnaC3.lfy △i2 The editing method, represented by the deleted part, is marked in the figure; (b) is the length comparison of intron 2 after editing by CRISPR / Cas9;

[0028] Fig. 9 Figure 3. The delayed inflorescence establishment and flowering delay phenotypes caused by editing the second intron of BnaC3.LFY in Brassica napus Westar, where (a) BnaC3.lfy I2 The shoot apex phenotype of the homozygous mutant at the critical inflorescence establishment period, "1" is the anatomical structure diagram of the inflorescence establishment, and "0" is the deconstructive structure diagram of the inflorescence not established; (b) is two independent BnaC3.lfy I2 The whole plant phenotype (top) and inflorescence phenotype (bottom) of the homozygous mutant; (c) shows the late flowering phenotype of the mutant compared with the wild-type Westar; (d) shows the expression level of BnaC3.LFY measured at the period of Figure (b). The knockout of intron 2 caused a decrease in the expression level of BnaC3.LFY. DETAILED DESCRIPTION

[0029] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0030] Example 1

[0031] (1) Brassica napus seeds were sown directly in the field. The same rapeseed germplasm material was planted in a small experimental plot with a length of 1.5 meters and a width of 1.5 meters. The seedlings were thinned out before wintering. The final planting density was 16 rapeseed plants per plot.

[0032] (2) After overwintering, rapeseed gradually enters reproductive growth and produces inflorescences. In order to identify SV loci related to inflorescence establishment and flowering in the field, the time point of rapeseed inflorescence establishment was carefully observed in the fields of Changxing. In the field, the rapeseed leaves were pried open to observe whether the apical growth point hidden at the base of the petiole formed an inflorescence structure with a flower structure, thereby determining the early or late establishment of the rapeseed germplasm inflorescence.

[0033] (3) Using the survey method in (2), record whether different rapeseed germplasms in the experimental field have formed an inflorescence structure visible to the naked eye on January 12, 2024. Using the scoring method, the germplasm materials that have established an inflorescence structure that is obvious to the naked eye will be marked with "1"; the germplasm materials that have not yet established an inflorescence structure that is obvious to the naked eye will be marked with "0" (e.g. Figure 1 shown).

[0034] (4) The statistical data of whether different germplasm materials have established inflorescence structure were used as input for structural variation-based genome-wide association analysis (SV-GWAS) using the score values ​​obtained in step (2). The GEMMAv0.98.1 software package was used with the v0 version of the Zhongshuang 11 (abbreviated as ZS11 or ZS) reference genome. The threshold was set to 6.62. Based on the mixed linear model, the genetic loci that affect the early and late establishment of inflorescence were screened out and named as quantitative visible inflorescence formation loci, abbreviated as qVIF. There are 7 loci in total, named qVIF-1 to qVIF-7 ( Figure 2 ), including 6 large fragment deletion mutations and 1 large fragment insertion mutation ( Figure 3 ).

[0035] (5) Through the analysis of (4), a total of 7 different qVIF sites of genomic structural variations were discovered, as shown in Table 1. Two of them, DEL00110133 and DEL00110136, belong to the qVIF-5 and qVIF-6 sites, respectively, and are located in the intron and upstream regions of the BnaC03G0561300ZS gene, respectively. Both are genomic structural variations in non-coding regions and are in high linkage disequilibrium ( Figure 3 ); BnaC03G0561300ZS encodes the BnaC3.LEAFY gene, abbreviated as BnaC3.LFY gene, or BnLFY for short.

[0036] Table 1 Gene structure sequences in the qVIF genetic locus

[0037]

[0038]

[0039]

[0040]

[0041] (6) Gene structure variation DEL00015475 is located at the qVIF-1 locus, in the intergenic region between the two genes BnaA03G0410700ZS and BnaA03G0410800ZS; gene structure variation DEL00049841 is located at the qVIF-2 locus, in the intergenic region between the two genes BnaA080158200ZS and BnaA080158400ZS; The structural variation DEL00098805 is located at the qVIF-4 genetic locus, in the intergenic region between the two genes BnaC03G0067900ZS and BnaC03G0068000ZS; the gene structural variation INS00146028 is located at the qVIF-7 genetic locus, in the intergenic region between the two genes BnaC06013800ZS and BnaC06013900ZS, which are also non-coding regions ( Figure 3 ).

[0042] (7) Gene structure variation DEL00049784 is located at the qVIF-3 locus, in the 3' untranslated region of the BnaA080156000ZS gene ( Figure 3 ).

[0043] (8) The haplotype of the BnaC03G0561300ZS / BnaC3.LEAFY gene with two structural variations, DEL00110133 and DEL00110136, is haplotype 1, and the haplotype of the gene without these two structures is haplotype 2, which are named BnaC3.LEAFY and BnaC3.LEAFY. 单倍型1 、BnaC3.LEAFY 单倍型2 ( Figure 4 ). With BnaC3.LEAFY 单倍型1 There are 20 accessions of Brassica napus germplasms with agronomic phenotypes of early inflorescence establishment and early flowering, and the expression level of BnaC3.LEAFY during the inflorescence development period is higher than that of BnaC3.LEAFY 单倍型2 .

[0044] Based on the fact that both SV sites are located near the BnaC3.LFY gene, the conservation of the non-regulatory regions of Arabidopsis gAtLFY and rapeseed gBnaC3.LFY was analyzed. It was found that the two key regions of the Arabidopsis gAtLFY promoter region, the distal regulatory region and the proximal regulatory region, were highly conserved in rapeseed gBnaC3.LFY. DEL00110136 was beyond the regulatory range of the distal region ( Figure 5), so we mainly focus on the structural variation in this region of DEL00110133.

[0045] (9) Aiming at the structural variation of DEL00110133 in the second intron of BnaC03G0561300ZS / BnaC3.LEAFY, a pair of universal primers were designed, ATAGGTTCTGATTTTATGTCTTCACTCG (SEQ ID NO.2) as the forward primer and CATGAGGACATCGTATCTTACTATCTCG (SEQ ID NO.3) as the reverse primer (sequence from 5' to 3', as shown in Table 1), and used as a primer set for molecular marker screening. 5 μl of KOD enzyme (KOD OneMasterMix), 0.3 μl of 10 μM forward primer, 0.3 μl of 10 μM reverse primer, 0.5 μl of extracted DNA template, 3.9 μl of water, a total of 10 μl system. A commonly used PCR instrument on the market was used, and pre-denaturation was performed at 94 degrees Celsius for 2 minutes. Then, five cycles were performed, from 10 seconds of denaturation at 98 degrees Celsius, to 5 seconds of annealing at 52 to 56 degrees Celsius (1 degree Celsius increase for each cycle), and then to 15 seconds of extension at 68 degrees Celsius. Another 30 cycles were performed, from 10 seconds of denaturation at 98 degrees Celsius, to 5 seconds of annealing at 54 degrees Celsius, and then to 15 seconds of extension at 68 degrees Celsius. After the experiment was completed, 5 μl of the sample was run on gel electrophoresis to detect the band size.

[0046] Among 287 accessions of Brassica napus with different ecotypes (PCR numbers and germplasm names are shown in Table 2), 21 accessions with BnaC3.LEAFY 单倍型1 The material has an early flowering field phenotype, and its amplified length is 2508bp ( Figure 4 ).

[0047] Table 2 PCR numbers and germplasm names of Brassica napus materials

[0048]

[0049]

[0050]

[0051]

[0052] (10) In BnaC3.LEAFY without DEL00110133 and DEL00110136 单倍型2 In rapeseed germplasm, such as Westar, the primer set of molecular markers in (9) was used to amplify a length of 206 bp, and its DNA sequence has a certain degree of conservation.

[0053] Further analysis revealed that the rapeseed varieties with haplotype 1 had a higher expression level of BnaC3.LFY than the rapeseed varieties with haplotype 2 ( Figure 7 ), inflorescence is established earlier ( Figure 6 ), and it is known from the public database that the flowering days are also earlier. This locus significantly affects the early and late formation of inflorescence and flowering, and this genetic locus provides an important genetic material basis for breeding early-flowering rapeseed.

[0054] (11) Targeting BnaC3.LEAFY in Westar 单倍型2 A total of 38 sgRNA sequences were designed using the CRISPR / Cas9 gene editing system (Table 3). Through analysis and experiments, sgRNA-2, sgRNA-26, and sgRNA-31 were able to produce large fragment deletions between the target sgRNA sequences.

[0055] Table 3 Brassica napus WestarBnaC3.LEAFY 单倍型2 sgRNA sequence design targeting the second intron

[0056]

[0057]

[0058] (12) Using the technique of (11), a new homozygous Brassica napus material was created in Westar, which contained a fragment deletion in the non-coding region of the second intron (intron 2 or i2) and had no changes in the coding region. The material was named BnaC3.lfy △i2 , in T 2 In the #26-11 plant of the generation, 519 bases were deleted in the second intron (Table 4). 2 The #40-3 plant of the next generation had a 530-base deletion in the second intron (Table 4); in the net house pot experiment, both plants showed a late flowering phenotype compared with the wild type Westar ( Figure 8 ), which proved the positive effect of the second intron of BnaC3.LFY on inflorescence establishment and flowering time, providing important genetic resources for molecular breeding of Brassica napus.

[0059] Table 4. In Brassica napus WestarBnaC3.LEAFY 单倍型2 Sequences created for the second intron

[0060]

[0061]

[0062] Note: Bases deleted by CRISPR / Cas9 are marked with strikethroughs.

[0063] As can be seen from the above embodiments, the present invention mainly analyzes the gene structural variation of large fragments on the genome of the core germplasm resources of cabbage type, and excavates the structural variation sequence DEL00110133 that affects the early and late formation of inflorescences. Based on the structural variation sequence DEL00110133, a molecular marker primer set is developed to screen for germplasms or plants with early inflorescence establishment and early flowering time traits in different germplasm resources of cabbage type rapeseed, which is beneficial to the subsequent rapid breeding of rapeseed. The present invention also verifies the genetic and molecular functions of the structural variation sequence through gene editing technology, creates a new genetic sequence, and directionally changes the agronomic traits of early and late inflorescence formation.

[0064] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A Brassica napus BnaC3.LEAFY Early flowering molecular marker, characterized in that Said BnaC3.LEAFY The early flowering molecular marker is shown in SEQ ID NO.

1.

2. The method according to claim 1 BnaC3.LEAFY Early flowering molecular markers in promoting rapeseed BnaC3.LEAFY The application of gene expression, promoting early flowering of rapeseed or shortening the growth period of rapeseed is characterized in that: In rapeseed BnaC3.LEAFY The second intron region of the gene is introduced into the BnaC3.LEAFY Early flowering molecular markers, rapeseed BnaC3.LEAFY The gene expression level increases, and the rapeseed exhibits an early flowering phenotype, shortening the growth period of the rapeseed.

3. A method for expanding Brassica napus BnaC3.LEAFY The primer set for early flowering molecular markers is characterized by: It includes BnaC3.LEAFY_DEL00110133_F and BnaC3.LEAFY_DEL00110133_R; the sequence of BnaC3.LEAFY_DEL00110133_F is shown in SEQ ID NO.2, and the sequence of BnaC3.LEAFY_DEL00110133_R is shown in SEQ ID NO.

3.

4. A method for screening rapeseed germplasm with early flowering phenotype, characterized in that: The following steps are involved: 1) Extract genomic DNA from samples to be screened; 2) using the primer set described in claim 3 to amplify the genomic DNA obtained in step 1) to obtain an amplified product; if the amplified product includes the BnaC3.LEAFY Early flowering molecular markers are used to identify rapeseed germplasm with early flowering phenotype; Otherwise, it is determined as rapeseed germplasm without early flowering phenotype.

5. A sgRNA for preparing a late-flowering genetic sequence of rapeseed, characterized in that: Including sgRNA-2, sgRNA-26 or sgRNA-31; the sequence of the sgRNA-2 is shown as SEQ ID NO.4, the sequence of the sgRNA-26 is shown as SEQ ID NO.5, and the sequence of the sgRNA-31 is shown as SEQ ID NO.

6.

6. The sgRNA according to claim 5 reduces BnaC3.LEAFY The expression amount of a gene, the use in preparing a late-flowering genetic sequence of rapeseed or extending the growth period of rapeseed, is characterized in that: Using CRISPR / CAS9 gene editing technology BnaC3.LEAFY The second intron sequence of the gene was deleted, and the late flowering genetic sequence of rapeseed was obtained, which reduced BnaC3.LEAFY The expression level of the gene prolongs the growing period of rapeseed.

7. A gene for regulating late flowering of rapeseed, characterized in that: The sequence of the gene regulating the late flowering of rapeseed is shown in SEQ ID NO.7 or SEQ ID NO.8.

Images