Enhanced expression systems and methods of use thereof

Abstract

The present disclosure relates to enhanced expression systems and methods of using the same. The present disclosure relates to efficient protein expression systems that utilize piggyBac transposons and / or regulatory elements.

Description

[0001] This application is a divisional application of the patent application "Enhanced expression system and method of use thereof" with application date of February 18, 2021 and application number 202180015538.8 (international application number PCT / CN2021 / 076719). Technical Field

[0002] The present disclosure relates to efficient protein expression systems utilizing piggyBac transposons and / or regulatory elements. Background Art

[0003] There are many expression systems for recombinant proteins, for example, bacteria, yeast, fungi, insects, plants and mammalian cells. The significant differences in protein expression systems can affect the expression, isolation and purification of proteins. For example, low-level expression systems such as bacteria cannot be used to express specific types of proteins that require complex post-translational modifications such as glycosylation to achieve their biological activity. In addition, many therapeutic proteins require complex post-translational modifications such as glycosylation to achieve biological activity.

[0004] Mammalian expression systems for the production of therapeutic recombinant proteins are commonly used by pharmaceutical companies. Mammalian cells have the ability to carry out proper protein folding and complex post-translational modifications, which are essential for the therapeutic activity of many proteins. Many mammalian cell expression systems have been approved for the production of therapeutic proteins. However, establishing a stable mammalian cell expression system for therapeutic recombinant proteins is time-consuming, and expression levels are usually not optimized, and therefore are not ideal for large-scale production.

[0005] Therefore, there is a need for an improved expression system that can be used as a flexible platform to produce stable cell lines that can express various therapeutic recombinant proteins at elevated levels. The ability to produce stable cell lines that can be used to express recombinant proteins in the same host cell that can be used in a timely manner for manufacturing processes would be particularly useful during early drug development. There is also a need for an expression system with enhanced transcription and translation efficiency. Summary of the invention

[0006] The present disclosure relates to an efficient protein expression system utilizing piggyBac transposons and / or regulatory elements. The expression system provides a general tool that can effectively integrate a target nucleic acid into the genome of a cell and can significantly increase protein expression in a cell (e.g., Chinese hamster ovary cells). On the one hand, the expression system can effectively move a vector sequence (e.g., a sequence between two piggyBac ITRs) in a transposon vector into the target genome. The system can be used to establish a stable cell line for expressing various proteins (e.g., antibody heavy and light chains). On the one hand, the piggyBac expression system can be used with Chinese hamster ovary (CHO) cells to produce recombinant proteins for both research and biopharmaceutical manufacturing purposes.

[0007] In one aspect, provided herein is a nucleic acid comprising a 5'-ITR (inverted terminal repeat); a 3'-ITR sequence; and a regulatory element sequence that is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-30 and SEQ ID NOs: 35-58.

[0008] In some embodiments, the 5' ITR sequence comprises or consists of a sequence at least 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO:68, and the 3' ITR sequence comprises or consists of a sequence at least 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO:60.

[0009] In some embodiments, the 5' ITR sequence comprises SEQ ID NO:68 and the 3' ITR sequence comprises SEQ ID NO:60.

[0010] In some embodiments, the nucleic acid as described herein further comprises a 5'-interior domain and a 3'-interior domain. In some embodiments, the 5'-interior domain comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 66. In some embodiments, the 3'-interior domain comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 67. In some embodiments, the 5'-interior domain is adjacent to the 5'-ITR and the 3'-interior domain is adjacent to the 3'-ITR.

[0011] In some embodiments, the nucleic acid comprises one or more regulatory element sequences selected from the group consisting of SEQ ID NOs: 1-15 (eg, SEQ ID NO: 2).

[0012] In some embodiments, the nucleic acid comprises one or more regulatory element sequences selected from the group consisting of SEQ ID NOs: 35-46 (eg, SEQ ID NO: 36).

[0013] In some embodiments, nucleic acid as described herein also comprises a promoter and a sequence encoding a polypeptide. In some embodiments, the sequence encoding a polypeptide is operably connected to a promoter. In some embodiments, the sequence encoding a polypeptide is located between two regulatory element sequences.

[0014] In some embodiments, nucleic acid as described herein also comprises a promoter and a sequence encoding two or more polypeptides. In some embodiments, the polypeptide sequence encoding two or more is operably connected to the promoter. In some embodiments, the sequence encodes an antibody heavy chain and an antibody light chain.

[0015] In some embodiments, the nucleic acid further comprises a WXRE sequence that is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 35-46. In some embodiments, the nucleic acid comprises two or more expression cassettes. In some embodiments, the nucleic acid comprises a selection marker. In some embodiments, the selection marker is an antibiotic resistance gene, a sequence encoding a fluorescent protein, or lacZ.

[0016] In one aspect, provided herein is a vector comprising a nucleic acid as described herein.

[0017] In one aspect, provided herein is a transposon vector comprising, from 5′ to 3′: a 5′ ITR sequence consisting of a sequence at least 95% identical to SEQ ID NO: 68; a non-transposon heterologous DNA sequence; and a 3′ ITR sequence consisting of a sequence at least 95% identical to SEQ ID NO: 60.

[0018] In some embodiments, the 5' ITR sequence consists of SEQ ID NO:68 and the 3' ITR sequence consists of SEQ ID NO:60.

[0019] In some embodiments, the transposon vector as described herein further comprises a 5'-interior domain and a 3'-interior domain. In some embodiments, the 5'-interior domain comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 66. In some embodiments, the 3'-interior domain comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 67. In some embodiments, the 5'-interior domain is immediately adjacent to the 5'-ITR and the 3'-interior domain is immediately adjacent to the 3'-ITR.

[0020] In some embodiments, the non-transposon heterologous DNA sequence comprises a promoter and a sequence encoding more than one polypeptide. In some embodiments, the sequence encoding more than one polypeptide is operably linked to the promoter. In some embodiments, the promoter is a cytomegalovirus (CMV) promoter.

[0021] In some embodiments, the non-transposon heterologous DNA sequence further comprises a regulatory element sequence that is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-30 and 35-58.

[0022] In some embodiments, the non-transposon heterologous DNA sequence further comprises a WXRE sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 35-46.

[0023] In some embodiments, the non-transposon heterologous DNA sequence comprises a multiple cloning site.

[0024] In one aspect, provided herein is an expression system comprising: (a) a first nucleic acid comprising a 5'-ITR sequence; a non-transposon heterologous DNA sequence comprising a regulatory element sequence that is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-30 and 35-58; a 3'-ITR sequence; and (b) a second nucleic acid encoding a piggyBac transposase.

[0025] In some embodiments, the second nucleic acid encodes a piggyBac transposase having an amino acid sequence at least 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO:33.

[0026] In some embodiments, the non-transposon heterologous DNA sequence comprises a promoter and a sequence encoding more than one polypeptide. In some embodiments, the sequence encoding more than one polypeptide is operably linked to the promoter.

[0027] In some embodiments, the sequence encodes an antibody heavy chain and / or an antibody light chain. In some embodiments, the sequence encodes a monoclonal antibody, a bispecific antibody, a recombinant protein, or a fusion protein.

[0028] In some embodiments, the promoter is a CMV promoter.In some embodiments, the promoter is an inducible promoter (eg, a heat shock promoter, a metallothionein promoter, or a glucocorticoid response element).

[0029] In some embodiments, the non-transposon heterologous DNA sequence further comprises a regulatory element sequence that is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-30 and 35-58.

[0030] In some embodiments, the non-transposon heterologous DNA sequence further comprises a WXRE regulatory element sequence that is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 35-46.

[0031] In one aspect, provided herein is an isolated nucleic acid comprising a regulatory element sequence that is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-30 and 35-58.

[0032] In some embodiments, the nucleic acid further comprises a promoter and a protein coding sequence.

[0033] In some embodiments, the regulatory element sequence is located between the promoter and the protein coding sequence.

[0034] In some embodiments, the regulatory element sequence is located 3' to the protein coding sequence.

[0035] In some embodiments, the regulatory element sequence may be transcribed to the 5'-UTR or the 3'-UTR. In some embodiments, the isolated nucleic acid further comprises a 5'-ITR and a 3'-ITR, and the regulatory element sequence is located between the 5'-ITR and the 3'-ITR.

[0036] In one aspect, provided herein is a vector comprising a nucleic acid as described herein.

[0037] In one aspect, a vector is provided herein containing a piggyBac transposon, the piggyBac transposon comprising the following genetic elements in the 5' to 3' direction: a 5'-ITR comprising TR L , 5'-ITR spacer, IR L ; a promoter; a regulatory element sequence that is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-30 and 35-58; a protein coding sequence; and a 3'-ITR comprising an IR R , 3'-ITR spacer, TR R .

[0038] In one aspect, a vector containing a piggyBac transposon is provided herein, wherein the piggyBac transposon comprises the following genetic elements in the 5' to 3' direction: a 5'-ITR comprising TR L , 5'-ITR spacer, IR L ; a promoter; a protein coding sequence; a regulatory element sequence that is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-30 and 35-58; and a 3'-ITR that comprises an IR R , 3'-ITR spacer, TR R .

[0039] In one aspect, a vector is provided herein containing a piggyBac transposon, the piggyBac transposon comprising the following genetic elements in the 5' to 3' direction: a 3'-ITR comprising TR R , 3'-ITR spacer, IR R ; a promoter; a regulatory element sequence that is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-30 and 35-58; a protein coding sequence; and a 5'-ITR comprising an IR L , 5'-ITR spacer, TR L .

[0040] In one aspect, a vector is provided herein containing a piggyBac transposon, the piggyBac transposon comprising the following genetic elements in the 5' to 3' direction: a 3'-ITR comprising TR R , 3'-ITR spacer, IR R ; a promoter; a protein coding sequence; a regulatory element sequence that is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-30 and 35-58; and a 5'-ITR that comprises an IR L , 5'-ITR spacer, TR L .

[0041] In some embodiments, the 5'-ITR comprises or consists of a sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to the reverse sequence or the reverse complement of SEQ ID NO:68.

[0042] In some embodiments, the 3'-ITR comprises or consists of a sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to the reverse sequence or the reverse complement of SEQ ID NO:60.

[0043] In some embodiments, TR L Comprising or consisting of a sequence that is at least 80%, 85%, 90%, 95% or 100% identical to the reverse sequence or the reverse complement of SEQ ID NO:61.

[0044] In some embodiments, the 5'-ITR spacer comprises or consists of a sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to the reverse sequence or the reverse complement of SEQ ID NO:62.

[0045] In some embodiments, IR L Comprising or consisting of a sequence that is at least 80%, 85%, 90%, 95% or 100% identical to the reverse sequence or the reverse complement of SEQ ID NO:63.

[0046] In some embodiments, TR R Comprising or consisting of a sequence that is at least 80%, 85%, 90%, 95% or 100% identical to the reverse sequence or the reverse complement of SEQ ID NO:64.

[0047] In some embodiments, IR R Comprising or consisting of a sequence that is at least 80%, 85%, 90%, 95% or 100% identical to the reverse sequence or the reverse complement of SEQ ID NO:65.

[0048] In some embodiments, the vector comprises two or more regulatory element sequences, each of which is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-30 and 35-58.

[0049] In some embodiments, the vector further comprises a 5'-internal domain sequence and a 3'-internal domain sequence.

[0050] In some embodiments, the 5'-inner domain sequence comprises or consists of a sequence that is at least or about 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO:66, and the 3'-inner domain sequence comprises or consists of a sequence that is at least or about 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO:67.

[0051] In some embodiments, the regulatory element sequence may be transcribed to the 5'-UTR or the 3'-UTR.

[0052] In some embodiments, the vector further comprises a sequence encoding a piggyBac transposase. In some embodiments, the sequence encoding the piggyBac transposase is outside the region between the 5'-ITR and the 3'-ITR.

[0053] In one aspect, the present invention provides a method for producing a cell for expressing a polypeptide of interest, the method comprising: (a) introducing into the cell: a transposon vector comprising: a 5'-ITR (inverted terminal repeat) sequence; a 3'-ITR sequence; a regulatory element sequence at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-30 and 35-58; and a sequence encoding a polypeptide of interest; and (b) culturing the cell under suitable conditions. In some embodiments, the piggyBac transposon is integrated into the genome of the cell, thereby producing a cell for expressing a polypeptide of interest.

[0054] In some embodiments, the method further comprises introducing into the cell a vector containing a sequence encoding the piggyBac transposase.

[0055] In some embodiments, the transposon vector comprises a sequence encoding a piggyBac transposase.

[0056] In some embodiments, the transposon vector is introduced into the cell by microinjection, high velocity propulsion, permeabilization, fusion, or electroporation. In some embodiments, the cell is a Chinese hamster ovary (CHO) cell. In some embodiments, the cell is a mammalian cell or an insect cell.

[0057] In one aspect, provided herein is a cell comprising a nucleic acid as described herein, a vector as described herein, or an expression system as described herein.

[0058] In some embodiments, the cell is a Chinese Hamster Ovary (CHO) cell.

[0059] In one aspect, provided herein is a method of expressing a protein, the method comprising: culturing a cell as described herein under conditions that allow the cell to express the protein; and collecting and purifying the protein.

[0060] In one aspect, provided herein is a protein expressed by a cell as described herein, or produced by a method as described herein.

[0061] In one aspect, provided herein is a pharmaceutical composition comprising a protein as described herein and a pharmaceutically acceptable carrier.

[0062] In one aspect, provided herein is a nucleic acid comprising a 5'-ITR sequence; a 3'-ITR sequence; and one or more regulatory element sequences derived from CHO.

[0063] In one aspect, an expression system is provided herein, comprising: (a) a first nucleic acid comprising a piggyBac transposon, wherein the piggyBac transposon comprises the following genetic elements in the 5' to 3' direction: a first TTAA sequence; a 5'-ITR comprising a TR L , 5'-ITR spacer and IR L ; 5'-internal domain (ID); target sequence; 3'-ID; 3'-ITR, which contains IR R , 3'-ITR spacer and TR R ; and a second TTAA sequence; and (b) a second nucleic acid encoding a piggyBac transposase.

[0064] In one aspect, the present invention provides a method for producing a cell for expressing a target polypeptide, the method comprising: (a) introducing into the cell: a transposon vector comprising the following genetic elements in the 5' to 3' direction: a first TTAA sequence; a 5'-ITR comprising TR L , 5'-ITR spacer and IR L ; 5'-internal domain (ID); target sequence; 3'-ID; 3'-ITR, which contains IR R , 3'-ITR spacer and TR R ; and a second TTAA sequence; and (b) culturing the cells under suitable conditions.

[0065] In one aspect, provided herein is a cell line whose genome has stably integrated a piggyBac transposon comprising the following genetic elements: a 5'-ITR sequence; a regulatory element sequence that is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-15; and a 3'-ITR sequence.

[0066] In one aspect, provided herein is a cell line having a piggyBac transposon stably integrated into its genome comprising the following genetic elements: a 5'-ITR comprising TR L , 5'-ITR spacer and IR L ; 5'-internal domain (ID); target sequence; 3'-ID; 3'-ITR, which contains IR R , 3'-ITR spacer and TR.

[0067] In one aspect, the present disclosure provides a transposon vector comprising: a first PB transposase recognition site sequence comprising or consisting of a sequence at least 95% identical to SEQ ID NO:31; a non-transposon heterologous DNA sequence; and a second PB transposase recognition site sequence comprising or consisting of a sequence at least 95% identical to SEQ ID NO:32.

[0068] In one aspect, the present disclosure also relates to a vector comprising a polynucleotide molecule as described herein. In some embodiments, the vector is a recombinant expression vector.

[0069] In some embodiments, provided herein are vectors further comprising more than one gene encoding more than one protein.

[0070] In some embodiments, the protein is an antibody, a fusion protein, an enzyme, a soluble protein, a membrane protein, a structural protein, a ribosomal protein, a zymogen, a cell surface receptor protein, a transcriptional regulatory protein, a translational regulatory protein, a chromatin protein, a hormone, a cell cycle regulatory protein, a G protein, a neuroactive peptide, an immunomodulatory protein, a blood component protein, an ion gate protein, a heat shock protein, a dihydrofolate reductase, an antibiotic resistance protein, a functional fragment of any of the proteins, an epitope fragment of any of the proteins, and any combination thereof.

[0071] In one aspect, the disclosure relates to a recombinant host cell comprising a vector as described herein.

[0072] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Methods and materials for use in the present invention are described herein; other suitable methods and materials known in the art may also be used. The materials, methods, and examples are illustrative only and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and references mentioned herein are incorporated herein by reference in their entirety. In the event of a conflict, the present specification, including definitions, will prevail.

[0073] Other features and advantages of the invention will be apparent from the following detailed description and drawings, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1A is a schematic diagram showing the piggyBac transposon plasmid.

[0075] Figure 1B is a schematic diagram showing the piggyBac transposase plasmid.

[0076] Figure 2 is a bar graph showing the protein expression levels of three antibodies (A, B, and C) in transfected host cells.

[0077] Figure 3 is a bar graph showing protein expression levels in host cells with different regulatory elements.

[0078] Figure 4 is a bar graph showing the protein expression levels of three antibodies (D, E, and F) in host cells transfected with piggyBac transposon plasmids with or without regulatory elements.

[0079] Figure 5 Shown are the sequences of (1) piggyBac 5'-ITR; (2) piggyBac 3'-ITR; and (3) piggyBac transposase amino acids.

[0080] Figure 6 Displays the sequence of WXRE IDs:AL.

[0081] Figure 7 The reverse complement sequences of WXRE IDs: AL are shown.

[0082] Figure 8 The sequences of human CMW promoter and intron 1 of human EF-1α gene are shown.

[0083] Fig. 9 A schematic diagram showing a GFP expression vector in which WXRE is not inserted.

[0084] Fig.10 A schematic diagram showing a GFP expression vector into which WXRE is inserted.

[0085] Fig.11 The effect of adding transcription regulatory elements A to K on the expression level of the fusion protein is shown, wherein A1 and A2 respectively show the positive and negative directions of the transcription regulatory element A, and the others are similar.

[0086] Fig.12 The effect of adding transcription regulatory elements A to K on the specific productivity of the expression of the fusion protein is shown, wherein A1 and A2 respectively represent the positive and negative directions of the transcription regulatory element A, and the others are similar.

[0087] Fig.13 A schematic diagram of a vector expressing the heavy chain of adalimumab with WXRE inserted is shown. HC means heavy chain.

[0088] Fig.14A schematic diagram showing a vector expressing the light chain of adalimumab with WXRE inserted, wherein LC means light chain.

[0089] Fig.15 Table 8 shows a comparison of the 14-day expression level of adalimumab under different transcription regulatory element combination conditions, wherein the components of the transcription regulatory element upstream of the heavy chain and the transcription regulatory element upstream of the light chain in Samples 1 to 12 are shown in Table 8.

[0090] Fig.16 The amino acid sequences of the A chain of PD-L1, the heavy chain (HC), and the light chain (LC) of adalimumab are shown. DETAILED DESCRIPTION

[0091] DNA transposon is a repetitive sequence naturally present in animal genomes. The piggyBac transposon was first discovered in insect genomes and contains key elements including transposase and inverted terminal repeats. The piggyBac transposon system can "cut and paste" between genomes and plasmids to replace DNA sequences. Compared with other transposon systems, the piggyBac transposase can accurately replace the terminal inverted repeats and the sequences between the repeats into genomic DNA containing the "TTAA" nucleotide sequence without any other modification or loss of the genomic DNA. The transposon system has been used in stem cell research, gene modification and many cell engineering fields.

[0092] Faster and more efficient protein expression technology is one of the main concerns of academia and industry. Transient expression technology can deliver gram-scale recombinant proteins in about 2 weeks, but compared with the classic stable cell pool, the protein expression level is relatively limited. On the other hand, the genome of the stable cell pool has a low probability of being inserted by exogenous DNA, largely due to the traditional stable transfection method that randomly integrates exogenous DNA into the genome. The inefficient DNA integration problem will lead to a relatively slow recovery during antibiotic screening. Although the recombinant protein expression level is relatively high, the time-consuming production of proteins with stable pools limits the widespread use of this classical technology and cannot meet the needs of industry.

[0093] Some existing transposon systems can be used to construct stable cell lines that produce recombinant proteins. However, these systems (e.g., Tol2 transposon) usually take more than a month to produce stable cell lines with application value, which makes them lack time advantages relative to the classical stable cell pool method. Compared with other transposon systems (e.g., Sleeping Beauty and Mos1), the efficiency of the piggyBac system for CHO cell lines described in the present disclosure has significant efficiency advantages.

[0094] In addition, exogenous protein expression can be regulated by regulatory elements (REs). Many factors with regulatory transcription and translation functions can affect protein expression levels. The present disclosure also provides many DNA regulatory elements that have been identified by RNA abundance analysis. Further experiments were performed to demonstrate that they can improve exogenous protein expression.

[0095] The present disclosure provides a highly efficient expression system utilizing piggyBac transposons and / or regulatory elements. The expression system can establish a stable cell line that can express recombinant proteins at elevated levels in a relatively short period of time.

[0096] PiggyBac transposons and transposases

[0097] After the resurrection of the Sleeping Beauty transposon system from the genome of the medaka fish, DNA-based transposon systems first emerged as an effective tool for genome engineering in mammalian cells. Transposon DNA vectors can be engineered for many purposes, including transgenesis, gene therapy, gene trapping, or inserting other DNA elements into the genome of a cell. The piggyBac (PB) transposon system is naturally active and was originally discovered in insect cells while propagating a baculovirus in the TN-386 cell line from the cabbage looper moth Trichoplusia ni.

[0098] Gene transfer (mobilization) based on PiggyBac is carried out by a 'cut and paste' mechanism. When the piggyBac transposase protein is expressed in mammalian cells, it binds to the inverted repeat sequence position of the transposon, causing the DNA to be cut and releasing the 3' hydroxyl groups at both ends of the transposon. This leads to hydrophilic attack (hydrophilic attack) and hairpin formation of the flanking TTAA sequence, releasing the transposon from its plasmid backbone. The plasmid backbone is then repaired by host cell factors through the connection of complementary TTAA overhangs. The PiggyBac transposase places the TTAA sequence in the genomic DNA of mammalian cells. Through the hairpin resolution of the transposon and the hydrophilic attack of the 30 hydroxyls on the transposon on the genomic DNA, a staggered 4 base pair (bp) cut is generated in the genomic DNA, forming a transient double-strand (ds) break with TTAA overhangs on both sides of the break. Then, the transposon is inserted into the genomic DNA at the TTAA site, resulting in the replication of the TTAA, so that TTAA is found at both ends of the transposon. The sequence will be inserted into the genome, and the sequence will be passed on to all offspring cells. In the case of excision of the transposon by the piggyBac transposase, cells that have been transgenic can be induced and selected to remove the transgene, reconnecting the single-stranded TTAA to form a single TTAA. Therefore, the unique mechanism of piggyBac transposition leads to unique advantages: seamless excision of the transposon sequence. After piggyBac excises the transposon from DNA, it seamlessly produces the original piggyBac target site. A detailed description of piggyBac can be found in, for example, Woodard, et al., "piggyBac-ing models and new therapeutic strategies." Trends in biotechnology 33.9 (2015): 525-533; Cary et al. "Transposon mutagenesis of baculoviruses: analysis of Trichoplusia ni transposon IFP2 insertions within the FP-locus of nuclear polyhedrosisviruses." Virology 172.1 (1989): 156-169; Both are incorporated herein by reference in their entirety.

[0099] The wild-type piggyBac is a 2472 bp transposon with inverted terminal repeats (ITRs) and a 594 amino acid transposase within the ITRs. The PB transposase recognizes the PB 5'-ITR and the PB 3'-ITR. The wild-type 5'-ITR includes the left terminal repeat (TRL ), 31 bp spacer (5'-ITR spacer), and left internal repeat (IR L The sequence of the wild-type 5'-ITR is CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATCATGCGTA AAATTGACGCATG (SEQ ID NO: 68). L The sequence of the 31 bp spacer region is CCCTAGAAAGATA (SEQ ID NO: 61); the sequence of the 31 bp spacer region is ATCATATTGTGACGTACGTTAAAGATAATCA (SEQ ID NO: 62); and IR L The sequence is TGCGTAAAATTGACGCATG (SEQ ID NO: 63).

[0100] Similarly, the wild-type 3'-ITR includes the right terminal repeat (TR R ), short spacer (GAC; 3'-ITR spacer), and right internal repeat (IR R The sequence of the wild-type 3'-ITR is CATGCGTCAATTTTACGCAGACTATCTTTCTAGGG (SEQ ID NO: 60). R The sequence is TATCTTTCTAGGG (SEQ ID NO: 64); IR R The sequence is CATGCGTCAATTTTACGCA (SEQ ID NO: 65). Figure 5 As shown in , terminal repeats are indicated by single underscores and internal repeats are indicated by double underscores.

[0101] As used herein, the term "5'-ITR" refers to the sequence recognized by the piggyBac transposase for transposon activity, including TR L IR L , and optionally, a spacer region (eg, a 31 bp spacer region) therebetween. As used herein, the term "3'-ITR" refers to a sequence recognized by piggyBac transposase for transposon activity, including TR R IR R , optionally and a spacer therebetween.

[0102] The present disclosure provides a piggyBac expression system. In some embodiments, the piggyBac transposase and the piggyBac transposon are carried on two separate plasmids (e.g., a transposon vector and a transposase vector). Figure 1A-1B). The transposase and transposon can also be delivered on the same plasmid (cis), with the transposase gene outside the transposon inverted terminal repeat elements (ITRs).

[0103] In some embodiments, the transposon vector has piggyBac (PB) 5'- and 3'-inverted terminal repeats (ITRs). The 5'-ITR may include, for example, TR L , and IR L , and optionally a spacer (eg, a 31 bp spacer), or consisting thereof. The 3'-ITR may comprise, for example, TR R , and IR R , and optionally a spacer (e.g., GAC), or consisting thereof. The target sequence (e.g., target gene or GOI) can be inserted into the vector between 5'-ITR and 3'-ITR or between the PB transposase recognition site sequences. In some embodiments, GOI is operably connected to a promoter. In some embodiments, GOI is operably connected to one, two, three, four, five, or more regulatory elements. The regulatory element can be located at the 5' end of GOI or the 3' end of GOI. In some embodiments, the regulatory element is between the promoter and GOI or between GOI and the polyA signal sequence. The polyA signal sequence provides a signal for polyadenylation of transcribed mRNA. In some embodiments, the transposon vector can further include a selection marker. The selection marker can be operably connected to the same promoter or different promoters. In some embodiments, the selection marker and GOI can be under the control of the same promoter. In some embodiments, the selection marker can have its own promoter. Usually, the genome of the host cell itself does not provide a selection marker function. Thus, cells with the correct modification can be screened for the selectable marker.

[0104] In some embodiments, the target sequence comprises various genetic elements, for example, restriction sites, loxP sites, regulatory elements, promoters, enhancers, expression cassettes, gene operons, etc. In some embodiments, the target sequence does not have any protein coding sequence.

[0105] In some embodiments, a PB transposase vector is provided. The PB transposase vector is designed to express the PB transposase. During the experiment, two vectors are used to transfect host cells (e.g., CHO-K1 cells). The PB transposase expressed from the PB transposase vector recognizes the PB 5'-ITR and PB3'-ITR on the transposon vector, and the nucleic acid sequence between PB 5'-ITR and 3'-ITR (including both PB 5'-ITR and 3'-ITR) is effectively moved and integrated into the chromosome TTAA site in the cell. In some embodiments, cells are then selected by selecting markers (e.g., antibiotic resistance genes) and protein expression activity.

[0106] In some embodiments, the 5'-interior domain and the 3'-interior domain can be used in conjunction with the 5'-ITR and the 3'-ITR to increase the integration efficiency of the PB transposon (e.g., by at least 10%, 20%, 30%, 40%, 50% compared to a PB transposon without the 5'-interior domain sequence or the 3'-interior domain sequence). In some embodiments, the PB transposon recognition site comprises a 5'-ITR and a 3'-ITR. Figure 5 '-inner domain sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 5'-inner domain sequence shown in . Figure 5 The 5'-internal domain sequence in

[0107] TGTTTTATCGGTCTGTATATCGAGGTTTATTTATTAATTTGAATAGATATTA

[0108] AGTTTTATTATATTTACACTTACATACTAATAATAAATTCAACAAACAATT

[0109] TATTTATGTTTTATTTATTTATTAAAAAAAAACAAAAACTCAAAATTTCTTCTATAAAGTAACAAAACT (SEQ ID NO: 66).

[0110] In some embodiments, the PB transposon recognition site comprises a 3'-internal domain sequence. The 3'-internal domain sequence may be Figure 5 The 3'-interior domain sequences shown in are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical. Figure 5 The 3'-internal domain sequence in is:

[0111] TATCTATAACAAGAAAATATATATATAATAAGTTATCACGTAAGTAGAAC

[0112] ATGAAATAACAATATAATTATCGTATGAGTTAAATCTTAAAAGTCACGTA

[0113] AAAGATAATCATGCGTCATTTTGACTCACGCGGTCGTTATAGTTCAAAA

[0114] TCAGTGACACTTACCGCATTGACAAGCACGCCTCACGGGAGCTCCAAG

[0115] CGGCGACTGAGATGTCCTAAATGCACAGCGACGGATTCGCGCTATTTAGAAAGAGAGAGCAATATTTCAAGAATG (SEQ ID NO: 67).

[0116] In some embodiments, the PB transposon comprises a 5'-interior domain sequence of at least or about 50, 100, 110, 120, 130, 140, 150, 160, 170, or 172 consecutive nucleotides of SEQ ID NO: 66. In some embodiments, the PB transposon comprises a 3'-interior domain sequence of at least or about 50, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, or 272 consecutive nucleotides of SEQ ID NO: 67.

[0117] In some embodiments, the PB transposon does not have a 5'-internal domain sequence. In some embodiments, the PB transposon does not have a 3'-internal domain sequence.

[0118] As used herein, the term "PB transposase 5'-recognition site" refers to one of the two site pairs that the PB transposase recognizes and interacts with, which are located in the 5' direction of the nucleic acid (e.g., 5' to 3' direction on the sense strand based on the coding sequence or reference sequence). The term "PB transposase 3'-recognition site" refers to one of the two site pairs that the PB transposase recognizes and interacts with, which are located in the 3' direction of the nucleic acid (e.g., 5' to 3' direction on the sense strand based on the coding sequence or reference sequence). In some embodiments, the PB transposase 5'-recognition site sequence comprises a TR L In some embodiments, the PB transposase 3'-recognition site sequence comprises TR R In some embodiments, the PB transposase 5'-recognition site comprises TR L and IR L , optionally with a spacer and / or an internal domain sequence, or consisting thereof. In some embodiments, the PB transposase 3'-recognition site comprises TR R and IR R , optionally with spacer and / or internal domain sequences, or consisting thereof.

[0119] The positions of the 5'-ITR and 3'-ITR can be interchanged on the transposon vector. Thus, in some embodiments, the PB transposase 3'-recognition site sequence comprises TR L In some embodiments, the PB transposase 5'-recognition site sequence comprises TR R In some embodiments, the PB transposase 3'-recognition site comprises TR L and IR L , optionally with a spacer and / or an internal domain sequence, or consisting thereof. In some embodiments, the PB transposase 5'-recognition site comprises TR R and IR R , optionally with spacer and / or internal domain sequences, or consisting thereof.

[0120] In some embodiments, the PB transposase 5'-recognition site comprises, or consists of, a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 31. In some embodiments, the PB transposase 3'-recognition site comprises, or consists of, a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 32. In some embodiments, the PB transposase 5'-recognition site comprises or consists of a sequence having at least or about 50, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, or 230 consecutive nucleotides, or the entire sequence of SEQ ID NO: 31. In some embodiments, the PB transposase 3'-recognition site comprises or consists of a sequence having at least or about 50, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, or 310 consecutive nucleotides, or the entire sequence of SEQ ID NO: 32.

[0121] In some embodiments, the length of the sequence between the ITR or PB transposase recognition site is at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 kb. In some embodiments, the transposon comprises an insert ranging from 1.5-3 kb, 1.5-5 kb, 1.5-10 kb, 1.5-20 kb, 1.5-30 kb, 1.5-50 kb, 1.5-75 kb, 2-5 kb, 2-10 kb, 2-20 kb, 2-30 kb, 2-50 kb, 2-75 kb, 3-5 kb, 3-10 kb, 3-20 kb, 3-30 kb, 3-50 kb, 3-75 kb, 5-10 kb, 5-20 kb, 5-30 kb, 5-50 kb, 5-75 kb, 10-20 kb, 10-30 kb, 10-50 kb, or 10-75 kb.

[0122] The disclosure also provides a vector for preparing a transposon vector containing a target gene or a target sequence. In some embodiments, the vector comprises a 5'-ITR and a 3'-ITR as described herein, and a linker sequence between the 5'-ITR and the 3'-ITR. In some embodiments, the vector comprises a PB transposase 5'-recognition site and a PB transposase 3'-recognition site as described herein, and a linker sequence between the two recognition sites. In some embodiments, the linker sequence is a short-length DNA (e.g., less than 20, 30, 40, 50, 60, 70, 80, 90, 100 or 200 nucleotides), which comprises many different endonuclease restriction sites close to the position. The presence of the linker sequence is advantageous because it allows easy insertion and removal of various exogenous sequences such as expression cassettes, thereby simplifying the process of preparing a vector containing a specific targeted DNA fragment. As used herein, an expression cassette is a vector or sequence of a gene to be expressed by a transfected cell and a regulatory sequence of the gene. In some embodiments, a transposon vector can have various regulatory elements or genetic elements, such as a promoter (eg, an inducible promoter), an enhancer, or an insulator, among others.

[0123] When the transposon vector is introduced into a host cell, in the presence of a transposase activity that is specific for the flanking reverse sequence, the targeted DNA sequence will be excised from the introduced vector and will be inserted into the position in the genome. In the presence of a transposase activity, the transposition of the targeted DNA is promoted. The gene encoding the transposase can be physically connected to a transposon vector already present in the genome of the host cell, or introduced into the cell as a part of a separate vector. In some embodiments, an inducible promoter can be used as a means of initiating production or transposase activity.

[0124] Adjustment element

[0125] The present disclosure also provides various regulatory elements. As used herein, the term "regulatory element" in the present disclosure refers to a sequence that participates in gene transcription and / or translation regulation. In some embodiments, the regulatory element is a transcriptional regulatory element or a translational regulatory element. In some embodiments, the regulatory element can stabilize mRNA. In some embodiments, these regulatory elements are derived from CHO-K1 cells. In some embodiments, these regulatory elements can increase the expression level of the target gene.

[0126] The present disclosure shows that the regulatory elements listed in Table 1 can increase the expression level of the target gene. Without wishing to be bound by theory, it has been hypothesized that these regulatory elements can increase transcription efficiency and stabilize transcribed mRNA. In some embodiments, these regulatory elements can make mRNA resistant to degradation.

[0127] SEQ ID NOs: 1-15 are sequences of regulatory elements. Reverse complementary sequences are provided in SEQ ID NOs: 16-30. In one aspect, the present disclosure provides isolated polynucleotide molecules comprising: (i) a sequence of any one of SEQ ID NOs: 1-15; (ii) a reverse complementary sequence of a sequence of any one of SEQ ID NOs: 1-15; (iii) a reverse complementary sequence of a sequence that can hybridize with a sequence of (i) or (ii) under high stringency hybridization conditions or very high stringency hybridization conditions; and (iv) a sequence that is at least or about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NOs: 1-30. As used herein, the term "reverse complementary sequence" in the present disclosure is a sequence that is in the opposite direction to the sequence of the original polynucleotide and is also complementary to the sequence of the original polynucleotide. For example, if the original polynucleotide sequence is ACTGAAC, its reverse complement sequence is GTTCAGT.

[0128] In one aspect, the disclosure also provides a sequence comprising a promoter and a target gene. The regulatory element sequence may be located at the 5' end of the target gene (eg, between the promoter and the target gene) or at the 3' end of the target gene (eg, between the target gene and the polyA signal sequence).

[0129] In some embodiments, the regulatory element has a sequence with at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% (including all ranges and percentages between these values) sequence identity with any one of SEQ ID NOs: 1-30. In some embodiments, the sequence differs from a sequence selected from SEQ ID NOs: 1-30 by at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In some embodiments, the sequence differs from a sequence selected from SEQ ID NOs: 1-30 by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.

[0130] The sequence can have a forward or reverse orientation. In some embodiments, the regulatory element sequence can increase the expression of the foreign protein by about or at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% (e.g., compared to a control sequence without the regulatory element sequence).

[0131] The regulatory element sequence can be located after the promoter (e.g., from 5' to 3' on the sense strand of the coding sequence) or after the polynucleotide encoding the polypeptide (e.g., from 5' to 3' on the sense strand of the coding sequence). In some embodiments, the regulatory element is located before the polynucleotide encoding the polypeptide (e.g., transcribed to the 5'-untranslated region (5'-UTR)). In some embodiments, there are at least or about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides between the regulatory element sequence and the promoter, or between the regulatory element sequence and the polynucleotide encoding the polypeptide. In some embodiments, there are no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides between the regulatory element sequence and the promoter, or between the regulatory element sequence and the polynucleotide encoding the polypeptide.

[0132] In some embodiments, the regulatory element sequence can be located after (e.g., immediately after) the polynucleotide encoding the polypeptide (e.g., transcribed to the 3'-UTR). In some embodiments, there are at least or about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides between the regulatory element sequence and the end of the sequence encoding the polypeptide, or between the regulatory element sequence and the polyA signal sequence. In some embodiments, there are no more than 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides between the regulatory element sequence and the end of the sequence encoding the polypeptide, or between the regulatory element sequence and the polyA signal sequence.

[0133] The present disclosure also provides a method for screening regulatory element sequences. In some embodiments, RNA sequencing (RNA-seq) can be used for sequencing and quantifying mRNA in cells (e.g., CHO cells). Total RNA is extracted. In some embodiments, cDNA is produced from the extracted RNA. The amount of RNA is ranked by abundance. And the sequence of the non-translated region of the RNA ranked in the front is selected. In some embodiments, experiments as described herein are performed to verify the effect of regulatory elements on protein expression. On the one hand, the mRNA of the desired host cell (e.g., CHO-K1 cell) at different stages is sequenced and quantified by high-throughput sequencing methods (e.g., RNA-seq). In some embodiments, transient transfection and stable transfection can be performed. Total RNA can be extracted from an appropriate number (e.g., at least or about 10, 20, or 30) of samples after an appropriate time (e.g., day 6, day 8, day 10, day 12, or day 14) by transient transfection, or from an appropriate number (e.g., at least or about 10, 20, or 30) of stably transfected samples (e.g., stable protein expressing cell lines) after an appropriate time (e.g., day 6, day 8, day 10, day 12, or day 14) of a traditional fed-batch process (e.g., a 14-day fed-batch process).

[0134] In some embodiments, cDNA can be generated accordingly (e.g., by reverse transcription) and used for sequencing (e.g., high-throughput sequencing). With the aid of sequencing data and relative read lengths (reads), mRNAs can be extracted and ranked by average abundance in all samples. In some embodiments, regulatory element (RE) sequences can be extracted from the untranslated regions of the top ranked mRNAs (e.g., at least or about the top 5, top 10, top 15, top 20, top 25, top 30, top 35, top 40, or more).

[0135] In some embodiments, the regulatory element sequences described herein can be incorporated into a fusion protein expression plasmid (e.g., immediately before or immediately after a recombinant protein expression gene). In some embodiments, a control sample that does not contain any regulatory element sequence can be used to determine the effect of the regulatory element.

[0136] WXRE regulating element

[0137] Regulatory elements can regulate gene transcription and / or translation. In some embodiments, the regulatory element is a transcriptional regulatory element, such as a WXRE regulatory element. Figure 6 As shown in , the WXRE in the present disclosure includes transcription regulatory element A (SEQ ID NO: 35), transcription regulatory element B (SEQ ID NO: 36), transcription regulatory element C (SEQ ID NO: 37), transcription regulatory element D (SEQ ID NO: 38), transcription regulatory element E (SEQ ID NO: 39), transcription regulatory element F (SEQ ID NO: 40), transcription regulatory element G (SEQ ID NO: 41), transcription regulatory element H (SEQ ID NO: 42), transcription regulatory element I (SEQ ID NO: 43), transcription regulatory element J (SEQ ID NO: 44), transcription regulatory element K (SEQ ID NO: 45), and transcription regulatory element L (SEQ ID NO: 46). Accordingly, as Figure 7 As shown in, the reverse complementary sequence of WXRE in the present disclosure includes the reverse complementary sequence of transcription regulatory element A (SEQ ID NO:47), the reverse complementary sequence of transcription regulatory element B (SEQ ID NO:48), the reverse complementary sequence of transcription regulatory element C (SEQ ID NO:49), the reverse complementary sequence of transcription regulatory element D (SEQ ID NO:50), the reverse complementary sequence of transcription regulatory element E (SEQ ID NO:51), the reverse complementary sequence of transcription regulatory element F (SEQ ID NO:52), the reverse complementary sequence of transcription regulatory element G (SEQ ID NO:53), the reverse complementary sequence of transcription regulatory element H (SEQ ID NO:54), the reverse complementary sequence of transcription regulatory element I (SEQ ID NO:55), the reverse complementary sequence of transcription regulatory element J (SEQ ID NO:56), the reverse complementary sequence of transcription regulatory element K (SEQ ID NO:57), and the reverse complementary sequence of transcription regulatory element L (SEQ ID NO:58).

[0138] In some embodiments, the WXRE sequence has at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity (including all ranges and percentages between these values) to the sequence of any one of SEQ ID NOs: 35-58. In some embodiments, the WXRE sequence differs from a sequence selected from SEQ ID NOs: 35-58 by at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In some embodiments, the WXRE sequence differs from a sequence selected from SEQ ID NOs: 35-58 by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.

[0139] The WXRE sequence can have a forward or reverse orientation. As used herein, when the sense strand (from 5' to 3') has the same sequence as the target sequence, the target sequence has a forward orientation. When the sense strand has a sequence that is reverse complementary to the target sequence, the target sequence has a reverse orientation. Sequences that are reverse complementary to SEQ ID NOs: 35-46 are recorded in SEQ ID NOs: 47-58, respectively.

[0140] In some embodiments, the WXRE sequence can increase the expression of the exogenous protein by about or at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% (e.g., compared to a control sequence without the WXRE sequence).

[0141] In some embodiments, the WXRE sequence, the promoter, and the polynucleotide encoding the polypeptide are operably linked together. In some embodiments, the WXRE sequence, the promoter, the polynucleotide encoding the polypeptide, and more than one other regulatory element are operably linked together. In some embodiments, the other regulatory element is a regulatory element as described herein (e.g., SEQ ID NOs: 1-30). In some embodiments, an intron of EF-1α (e.g., the first intron of human EF-1α) can be used to increase expression. The WXRE sequence, the promoter, and the polynucleotide encoding the polypeptide that are operably linked together can have a variety of orders. For example, the WXRE sequence can be located before the promoter (e.g., from 5' to 3' on the sense strand of the coding sequence) or after the polynucleotide encoding the polypeptide (e.g., from 5' to 3' on the sense strand of the coding sequence). In some embodiments, there are at least or about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, or 5000 nucleotides between the WXRE sequence and the promoter, or between the WXRE sequence and the polynucleotide encoding the polypeptide. In some embodiments, there are no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, or 5000 nucleotides between the WXRE sequence and the promoter, or between the WXRE sequence and the polynucleotide encoding the polypeptide. In some embodiments, one or more additional regulatory elements are located between the promoter and the sequence encoding the polypeptide.

[0142] In some embodiments, the use of the transcriptional regulatory elements (WXRE) listed in the present disclosure can greatly increase the expression level of the exogenous protein while still maintaining its biological activity (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 times).

[0143] In some embodiments, the transcriptional regulatory elements (WXREs) listed in the present disclosure can be used together with other regulatory elements as a whole to enable the expression level of foreign proteins to be greatly increased while still maintaining their biological activity.

[0144] Thus, in one aspect, the present disclosure relates to an isolated polynucleotide molecule comprising a nucleotide sequence selected from the group consisting of (i) to (iv): (i) a sequence of any one of SEQ ID NOs:35-46; (ii) a reverse complementary sequence of a sequence of any one of SEQ ID NOs:35-46; (iii) a reverse complementary sequence of a sequence that is capable of hybridizing to the sequence of (i) or (ii) under high stringency hybridization conditions or very high stringency hybridization conditions; and (iv) a sequence that has at least 80% sequence identity, or at least 90% sequence identity, alternatively at least 95% sequence identity, preferably at least 97% sequence identity, more preferably at least 98% sequence identity, and most preferably at least 99% sequence identity with the sequence of (i) or (ii).

[0145] Various WXRE sequences and methods of using them are described, for example, in WO2020 / 034097A1 and WO2020 / 034986A1, which are incorporated herein by reference in their entireties.

[0146] In some embodiments of the present disclosure, the WXRE sequence can be inserted into two vectors. They can be the same or different and can have a forward or reverse orientation. Exemplary combinations of WXREs in two vectors are listed in Table 2.

[0147] Table 2 Exemplary combinations of WXREs in two vectors

[0148]

[0149]

[0150]

[0151]

[0152]

[0153] Expression system

[0154] The present disclosure provides an effective protein expression system using the piggyBac transposon and / or one or more regulatory elements as described herein. As used herein, the term "protein expression system" or "expression system" refers to a system comprising a host and a vector containing a heterologous sequence (e.g., an exogenous gene), and the expression of the heterologous sequence in the host can be achieved by the system. The protein expression system generally comprises the following parts: (1) a host, i.e., an organism expressing a protein, which can be selected from bacteria, yeast, plant cells, animal cells, etc.; (2) one or more vectors. The type of vector matches the host. Depending on the host, the vector can be a prokaryotic (bacterial) expression vector, a yeast expression vector, a plant expression vector, a mammalian expression vector, an insect expression vector, etc. The vector comprises a fragment of a heterologous gene. The heterologous gene can be expressed in the host by the mediation of the vector. In some embodiments, the expressed protein product is secreted. In some embodiments, the vector is integrated into the host cell DNA.

[0155] The vector can be a delivery vehicle for polynucleotides. In some embodiments, the vector includes a polynucleotide sequence encoding a specific protein operably inserted therein, and allows the protein to be expressed in genetic engineering recombinant technology. The vector can be used for transformation, transduction or transfection of host cells. The vector in the present disclosure can be any suitable vector, including chromosomes, non-chromosomes, and synthetic nucleic acid vectors (including a group of suitable nucleic acid sequences expressing various elements). For example, the vector can be a recombinant plasmid vector, a recombinant eukaryotic virus vector, a recombinant bacteriophage vector, a recombinant yeast minichromosome vector, a recombinant bacterial artificial chromosome vector, or a recombinant yeast plasmid vector.

[0156] In some embodiments, the vectors in the present disclosure may include derivatives of SV40, bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from a combination of plasmids and phage DNA, and vectors such as viral nucleic acids (RNA or DNA). In some embodiments, the vector is an adeno-associated virus (AAV) vector.

[0157] As used herein, the term "host cell" in the present disclosure refers to a cell that receives heterologous polynucleotides and / or vectors introduced therein. The host cell can be a eukaryotic host cell or a prokaryotic host cell, wherein the eukaryotic host cell can be a mammalian host cell, an insect host cell, a plant host cell, a fungal host cell, a eukaryotic algae (algae) host cell, a nematode (nematode) host cell, a protozoan host cell, and a fish host cell. Exemplarily, the host cell in the present disclosure is a eukaryotic host cell, such as a mammalian host cell. In some embodiments, the mammalian host cell is a Chinese hamster ovary (CHO) cell, a COS cell, a Vero cell, a SP2 / 0 cell, a NS / O myeloma cell, an immature hamster kidney cell, a HeLa cell, a human B cell, a cv-1 / EBNA cell, a L cell, a 3T3 cell, a HEPG2 cell, a PerC6 cell, a human embryonic kidney 293 (HEK 293) cell, or a MDCK cell. In some embodiments, the cell is a human embryonic retinal cell (PER.C6) with a transformation early region (E1) of adenovirus type 5 (ad5). CHO cells are routinely used for the production of biopharmaceutical proteins. In some embodiments, the CHO cell is a CHO-K1 cell, a CHO-DG44 cell, or a CHO-S cell. In a preferred embodiment, the CHO cell is a CHO-K1 cell.

[0158] The key step in protein expression is to screen the recombinant host cells that have been successfully transfected with the vector containing the heterologous gene encoding the target protein. Most of the commonly used selection markers are contained in the vector. The selection marker can be a gene or DNA sequence that allows the separation of the recombinant host cells containing the marker and the recombinant host cells that do not contain the marker. The combination of the selection marker and the selection medium allows the growth of the recombinant host cells that have been transfected with the vector, and in some embodiments, suppresses the growth of the host cells that have not been successfully transfected.

[0159] Antibiotic resistance genes are the most commonly used markers for recombinant host cell selection. The combination of antibiotic resistance genes as selection markers and selection medium containing antibiotics can be used to achieve selection. Exemplary antibiotic selection markers include but are not limited to ampicillin resistance gene, chloramphenicol resistance gene, kanamycin resistance gene, tetracycline resistance gene, polymyxin B resistance gene, erythromycin resistance gene, carbenicillin resistance gene, streptomycin resistance gene, spectinomycin resistance gene, blasticidin resistance gene, neomycin resistance gene, puromycin resistance gene, bleomycin resistance gene and hygromycin B resistance gene. Therefore, antibiotics are selected to include but are not limited to ampicillin, chloramphenicol, kanamycin, tetracycline, polymyxin B, erythromycin, carbenicillin, streptomycin, spectinomycin, blasticidin, neomycin, puromycin, bleomycin and hygromycin B. In some embodiments, the selection marker is the blasticidin resistance gene. In some embodiments, the selection marker is the bleomycin resistance gene.

[0160] In some embodiments, the selection medium may include one or more of the following components: serum, polysaccharides (e.g., glucose and / or dextrose), sodium pyruvate, glutathione, ethanolamine, amino acids (e.g., glycine, alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, histidine, isoleucine, leucine, lysine, glutamine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and / or valine). amino acid) or its salt, vitamin (for example, ascorbyl phosphate, choline chloride, D-calcium pantothenate, folic acid, nicotinamide, pyridoxine hydrochloride, riboflavin, thiamine hydrochloride, and / or inositol (i-inositol)), inorganic salt (for example, calcium chloride, ferric nitrate, magnesium sulfate, potassium chloride, sodium bicarbonate, sodium chloride, and / or disodium hydrogen phosphate), protein (for example, human transferrin and / or recombinant insulin), and / or trace element (for example, ammonium metavanadate, copper sulfate, manganous chloride, and / or sodium selenite).

[0161] The expression system can be used to express various proteins or polypeptides, such as antibodies, fusion proteins, enzymes, soluble proteins, membrane proteins, structural proteins, ribosomal proteins, zymogens, cell surface receptor proteins, transcriptional regulatory proteins, translational regulatory proteins, chromatin proteins, hormones, cell cycle regulatory proteins, G proteins, neuroactive peptides, immunomodulatory proteins, blood component proteins, ion gate proteins, heat shock proteins, dihydrofolate reductase, antibiotic resistance proteins, functional fragments of any of the proteins, epitope fragments of any of the proteins, and any combination thereof.

[0162] As used herein, the term "antibody" in the present disclosure refers to immunoglobulins, fragments thereof, or derivatives thereof, and includes any polypeptide containing an antigen binding site, whether produced in vitro or in vivo. The term includes, but is not limited to, polyclonal antibodies, monoclonal antibodies, monospecific antibodies, bispecific antibodies, trispecific antibodies, multispecific antibodies, non-specific antibodies, humanized antibodies, fully human antibodies, chimeric antibodies, single domain antibodies, single chain antibodies, synthetic antibodies, recombinant antibodies, heterozygous antibodies, mutated antibodies, and grafted antibodies. The term "antibody" also includes antibody fragments such as Fab, Fab', F(ab'), 2 , Fv, scFv, Fd, dAb, and other antibody fragments that retain antigen binding function. Typically, such fragments will include antigen binding fragments.

[0163] As used herein, the term "fusion protein" in the present disclosure refers to a molecule comprising two or more proteins or fragments thereof, wherein the two or more proteins or fragments thereof are connected via their respective peptide backbones by covalent bonds, and more preferably, the fusion protein is produced by gene expression of polynucleotide molecules encoding these proteins. In some embodiments, the fusion protein includes an immunoglobulin domain. In some embodiments, the fusion protein is an Fc fusion protein.

[0164] In some embodiments, antibodies that can be used in conjunction with the expression system include, for example, Adalimumab, Bezlotoxumab, Avelumab, Dupilumab, Durvalumab, Ocrelizumab, Brodalumab, Reslizumab, Olaratumumab, Daratumumab, Elotuzumab, Necitumumab , Infliximab, Obiltoxaximab, Atezolizumab, Secukinumab, Mepolizumab, Nivolumab, Alirocumab, Evolocumab, Dinutuximab, Bevacizumab, Pembrolizumab, Ramucirumab, Vedolizumab, Siltuximab, Alemtuzumab, Trastuzumab, Pertuzumab, Obinutuzumab, Brentuximab, Raxibacumab, Belimumab, Ipilimumab, Denosumab, Ofatumumab, Besilesomab, Tocilizumab, Canakinumab akinumab), Golimumab, Ustekinumab, Certolizumab, Catumaxomab, Eculizumab, Ranibizumab, Panitumumab, Natalizumab, Omalizumab, Cetuximab, Efalizumab, Ibritumomab, Fanolesomab,Tositumomab, Gemtuzumab, Palivizumab, Necitumumab, Basiliximab, Rituximab, Capromab, Satumomab, and Muromonab.

[0165] In some embodiments, fusion proteins useful in the present disclosure include, for example, Etanercept, Alefacept, Abatacept, Rilonacept, Romiplostim, Belatacept, and Aflibercept.

[0166] In some embodiments, the expression system provides at least two transposon vectors. One transposon vector is designed to carry a sequence encoding a first polypeptide (e.g., an antibody heavy chain). The second transposon vector is designed to carry a sequence encoding a second polypeptide (e.g., an antibody light chain). In some embodiments, a single transposon vector provides a sequence encoding more than two polypeptides. For example, the sequence encoding the antibody heavy chain and the sequence encoding the antibody light chain can be on the same transposon vector. They can be located in the same expression cassette in the transposon vector or in different expression cassettes.

[0167] In some embodiments, the transposon vector may include a sequence comprising one or more of the following elements from 5' to 3' or consisting of: TTAA, 5'-ITR, optionally 5'-internal domain, promoter, target gene, selection marker, optionally 3'-internal domain, 3'-ITR, and TTAA. In some embodiments, the transposon vector may include a sequence comprising one or more of the following elements from 5' to 3' or consisting of: PB transposase 5'-recognition site, promoter, target gene, selection marker, and PB transposase 3'-recognition site. In some embodiments, the sequence may further include more than two regulatory elements. One or two regulatory elements may be located between the promoter and the target gene and / or between the target gene and the polyA signal sequence. Thus, in some embodiments, the transposon vector may include a sequence comprising or consisting of one or more of the following elements from 5' to 3': TTAA, 5'-ITR, optionally 5'-internal domain, promoter, regulatory element, target gene, regulatory element, polyA signal sequence, promoter for selection marker, selection marker, polyA signal sequence for selection marker, optionally 3'-internal domain, 3'-ITR, and TTAA. In some embodiments, the transposon vector may include a sequence comprising or consisting of one or more of the following elements from 5' to 3': PB transposase 5'-recognition site, promoter, regulatory element, target gene, regulatory element, polyA signal sequence, promoter for selection marker, selection marker, polyA signal sequence for selection marker, and PB transposase 3'-recognition site.

[0168] The target gene may actually comprise sequences encoding more than two polypeptides (e.g., antibody heavy chains and antibody light chains). These sequences may be separated from each other by sequences encoding self-cleaving peptides (e.g., P2A or T2A) or protease recognition sites (e.g., furin). Thus, an open reading frame (ORF) encodes a single polyprotein that can be cut into individual proteins during or after translation. Similarly, the transposase vector may have a sequence comprising a promoter, a piggyBac transposase coding sequence, a polyA signal sequence, or a sequence consisting thereof. In some embodiments, the transposase vector further comprises a selection marker.

[0169] The expression of the target gene can be further enhanced by the WXRE transcriptional regulatory element. In some embodiments, the transposon vector may include a sequence comprising or consisting of one or more of the following elements from 5' to 3': TTAA, 5'-ITR, optionally 5'-internal domain, WXRE transcriptional regulatory element, promoter, optionally the first intron of human EF-1α, regulatory element, target gene, regulatory element, polyA signal sequence, promoter for selection marker, selection marker, polyA signal sequence for selection marker, optionally 3'-internal domain, 3'-ITR, and TTAA. In some embodiments, the transposon vector may include a sequence comprising or consisting of one or more of the following elements from 5' to 3': PB transposase 5'-recognition site, WXRE transcriptional regulatory element, promoter, optionally the first intron of human EF-1α, regulatory element, target gene, regulatory element, polyA signal sequence, promoter for selection marker, selection marker, polyA signal sequence for selection marker, and PB transposase 5'-recognition site.

[0170] In some embodiments, the promoter is a CMV promoter. In some embodiments, the CMV promoter has sequence identity to the sequence shown in SEQ ID:59. In some embodiments, the sequence having sequence identity to the sequence shown in SEQ ID:59 has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% (including all ranges and percentages between these values) sequence identity to the sequence shown in SEQ ID:59.

[0171] In some embodiments, the promoter is an inducible promoter. Inducible promoters include any promoters that can increase the production of gene products by a given gene response to exposure to an inducer. Therefore, the use of this construct allows the control of the expression of a target functional gene or transposase introduced into a host cell. Those skilled in the art are aware of inducible promoters, and there are a variety of inducible promoters that can be used to drive expression. Inducible systems include, for example, heat shock promoter systems, metallothionein systems, glucocorticoid systems, tissue-specific promoters, etc. Promoters regulated by heat shock, such as promoters generally associated with genes encoding 70kDa heat shock proteins, can increase expression by several times after being exposed to elevated temperatures. The glucocorticoid system also works well in terms of triggering gene expression. The system is composed of genes encoding glucocorticoid receptor proteins (GR), which form complexes with hormones in the presence of steroid hormones (i.e., glucocorticoids or one of their synthetic equivalents such as dexamethasone). The complex then binds to a short nucleotide sequence (26 bp) called a glucocorticoid response element (GRE), and the binding activates the expression of the linked gene. Thus, the inducible promoter can be used as an environmentally inducible promoter for controlling the expression of an introduced gene.

[0172] In some embodiments, the inducible promoter is a T7 promoter. In some embodiments, the inducible promoter is a PAllacO1 promoter. In some embodiments, the inducible promoter is activated by an agent selected from the group comprising: IPTG, sodium salicylate, octapine, nopaline, quorum signal 3OC6HSL, aTc, cuminic acid, DAPG, and salicylic acid. In some embodiments, the inducible promoter has a terminator and the terminator is downstream of the inducible promoter. Examples of inducible promoters regulated by exogenously provided promoters include zinc-inducible sheep metallothionein (MT) promoters, dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoters, T7 polymerase promoter systems, ecdysone insect promoters, tetracycline-repressible systems, tetracycline-inducible systems, and rapamycin-inducible systems.

[0173] The promoter can also be polycistronic (bicistronic or tricistronic). For example, in some embodiments, the transcription unit can be engineered into a bicistronic unit containing an IRES (internal ribosome entry site), which allows co-expression of gene products (e.g., encoding antibody heavy chains and antibody light chains) by information from a single promoter. Alternatively, in some cases, a single promoter can direct the expression of RNA, which contains two or three genes (e.g., encoding the α chain and / or β chain of TCR) separated from each other by a sequence encoding a self-cleaving peptide (e.g., P2A or T2A) or a protease recognition site (e.g., Flynn) in a single open reading frame (ORF). Therefore, ORF encodes a single polyprotein, which is cut into a single protein during translation (in the case of 2A such as T2A) or after translation. In some cases, peptides such as T2A can cause the ribosome to skip synthesis of the peptide bond at the C-terminus of the 2A element (ribosome skipping), resulting in a separation between the end of the 2A sequence and the next peptide downstream.

[0174] The first intron of human EF-1α can be used to increase expression levels. The first intron of human EF-1α can have a sequence with a sequence having sequence identity with the sequence shown in SEQ ID:34. In some embodiments, the sequence with sequence identity with the sequence shown in SEQ ID:34 has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% (including all ranges and percentages between these values) sequence identity with the sequence shown in SEQ ID:34 (the first intron of human EF-1α).

[0175] In some embodiments, an expression system as described herein can increase the expression of an exogenous protein by about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, or 50 fold (e.g., compared to a control expression system without a regulatory element sequence or a piggyBac transposon).

[0176] The present disclosure also provides nucleic acids that are at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to any of the nucleotide sequences described herein. Sequences, and amino acid sequences that are at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to any amino acid sequence described herein. In some embodiments, the disclosure relates to nucleotide sequences encoding any peptide as described herein, or any amino acid sequence encoded by any nucleotide sequence as described herein. In some embodiments, the nucleic acid sequence is less than 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 150, 200, 250, 300, 350, 400, 500, 600, 700, 800, 900, 1000, or 5000 nucleotides. In some embodiments, the amino acid sequence is less than 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 500, or 1000 amino acid residues.

[0177] As used herein, the terms "sequence identity" and "percent identity" in the present disclosure refer to the percentage of identical (i.e., identical) nucleotides or amino acids between two or more polynucleotides or polypeptides. The sequence identity between two or more polynucleotides or polypeptides can be determined by the following method. Align the nucleotide sequences or amino acid sequences of the polynucleotides or polypeptides, score the number of positions containing the same nucleotides or amino acid residues in the aligned polynucleotides or polypeptides, and compare them with the number of positions containing different nucleotides or amino acid residues in the aligned polynucleotides or polypeptides. The polynucleotides may differ at one position, for example, by containing different nucleotides (i.e., substitutions or mutations) or by deleting nucleotides (one or more) (i.e., inserting nucleotides (one or more) or deleting nucleotides (one or more) in one or two polynucleotides). The polypeptides may differ at one position, for example, by containing different amino acids (i.e., substitutions or mutations) or by deleting amino acids (one or more) (i.e., inserting amino acids (one or more) or deleting amino acids (one or more) in one or two polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotides or amino acid residues by the total number of amino acid residues in the polynucleotides or polypeptides. For example, the percent identity can be calculated by the number of positions containing the same nucleotide or amino acid residue divided by the sum of nucleotide or amino acid residue in the polynucleotide or polypeptide.Therefore, the percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of rooms and the length of each room, it is necessary to introduce it for the best alignment of two sequences.For purposes of the present disclosure, the determination of the percent identity between the comparison of the sequence and the two sequences can for example be completed using the Blossum 62 scoring matrix and a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5.

[0178] The present disclosure also provides a kit comprising a recombinant host cell as described herein, and / or a kit comprising a vector or expression system as described herein.

[0179] Methods of using expression systems, transposon vectors, and transposase vectors

[0180] The present disclosure provides methods of using expression systems, transposon vectors, and transposase vectors.

[0181] In one aspect, provided herein are methods of using expression systems to produce recombinant proteins in host cells (eg, Chinese hamster ovary (CHO) cells, CHO-K1 cells, or any cells commonly used for protein expression known in the art).

[0182] In some embodiments, an appropriate number of host cells (e.g., at least or about 1 million, 2 million, 3 million, 5 million, 6 million, 8 million, 9 million, 10 million, 20 million, 30 million, 40 million, 50 million, or 100 million) are transfected with an appropriate amount of a transposon vector (e.g., a recombinant protein expression plasmid) and a transposase vector (e.g., a transposase expression plasmid). In some embodiments, the cell density is between 3.5 million and 4.5 million cells / mL. In some embodiments, host cells are transfected with a total of at least or about 1 μg of a transposon vector (e.g., at least or about 1 μg, 2 μg, 3 μg, 4 μg, 5 μg, 6 μg, 7 μg, 8 μg, 9 μg, 10 μg, 20 μg, 30 μg, 40 μg, 50 μg, or 100 μg).

[0183] In some embodiments, the transposon vector (e.g., a recombinant protein expression plasmid) and the transposase vector (e.g., a transposase expression plasmid) used for transfection have a mass ratio of about 1:1, about 2:1, about 3:1, about 4:1, about 5:1, about 6:1, about 7:1, about 8:1, about 9:1, about 10:1, about 11:1, about 12:1, about 13:1, about 14:1, about 15:1, about 16:1, about 17:1, about 18:1, about 19:1, or about 20:1. Then, the transfected cells are resuspended in an appropriate volume (e.g., at least or about 1 mL, 2 mL, 3 mL, 4 mL, 5 mL, 6 mL, 7 mL, 8 mL, 9 mL, 10 mL, 15 mL, 20 mL, 30 mL, 40 mL, or 50 mL) of host cell culture. The resulting solution can be mixed and cultured in a shaking incubator (e.g., shaking incubator).

[0184] Many transformation or transfection techniques can be used to introduce vectors into cells. Electroporation is also a common method for introducing DNA into cells. In this technique, cells are subjected to an electric pulse of high field strength, which reversibly permeabilizes the biomembrane, allowing the entry of exogenous DNA sequences. In some embodiments, fertilized eggs are microinjected with vectors. In some embodiments, PEI (polyetherimide) can be added to transduce plasmids as described herein into host cells (e.g., CHO-K1 cells). In some embodiments, vectors can be directly microinjected into cells using a micropipette. Alternatively, high velocity ballistics can be used to push small DNA-associated particles into cells. In some embodiments, cells are permeabilized by the presence of polyethylene glycol, thereby allowing DNA to enter cells by diffusion. DNA can also be introduced into cells by fusing protoplasts with other vectors containing DNA. These vectors include minicells, cells, lysosomes, or other soluble lipid-surfaced bodies. The resulting cell culture can be cultured in a suitable container (eg, spin tube) in an incubator (eg, a shaking incubator).

[0185] After an appropriate time (e.g., at least or about 2 hours, 4 hours, 6 hours, 12 hours, 18 hours, 24 hours, 30 hours, 36 hours or more) of transfection, an appropriate volume (e.g., at least or about 1 mL, 2 mL, 5 mL, 10 mL, 15 mL, or 20 mL) of fresh culture medium containing a selection antibiotic (e.g., blasticidin, geneticin (G-418), hygromycin B, mycophenolic acid, puromycin, bleomycin) can be added to the transfected cell culture. The antibiotic agent corresponds to an antibiotic resistance gene as described herein. The concentration of the antibiotic can be determined (e.g., by a kill curve experiment) for natural host cells (e.g., unmodified cells). In addition, the concentration of the supplemented culture medium can be the same or higher (e.g., at least or about 2-fold, 3-fold, 4-fold, 5-fold or higher) than the level of the normal antibiotic concentration used for selection.

[0186] In some embodiments, cells are passaged (e.g., every day, every 2 days, every 3 days, every 4 days, every 5 days, or every 6 days) with fresh culture medium containing the selected antibiotic agent. The seeding density can be adjusted based on cell growth conditions (e.g., cell viability, growth rate, and doubling time).

[0187] In some embodiments, after an appropriate period of antibiotic selection (about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks or longer), the cell culture can be used to inoculate the production basal medium at about the same inoculation density as determined for each transfected cell culture. The production cell culture can be cultured in a shaking incubator.

[0188] In some embodiments, the production process can be carried out by batch feeding culture. A suitable type and amount of feeding medium can be supplemented to the culture accordingly.

[0189] In some aspects, the disclosure provides methods designed to rapidly increase heteromultimer (e.g., antibody) expression. For example, for effective expression of antibodies, antibody heavy chains and antibody light chains need to be expressed in a ratio of approximately 1:1. If the concentration of the selected antibiotic is too low, the amount of the functional vector in the cell may be too small. If the concentration of the selected antibiotic is too high, this may produce conditions that are unfavorable for culturing cells. In some embodiments, the expression system in the present method relates to a pair of two vectors, one carrying a heterologous gene encoding an antibody heavy chain, and the other carrying a heterologous gene encoding an antibody light chain. The selection markers in the two vectors may be different. In one embodiment, the selection marker in the first vector is blasticidin, and in the second vector is bleomycin. The concentration of blasticidin and bleomycin may be any concentration as described herein. In some embodiments, the method may also relate to a vector comprising a heterologous gene encoding an antibody heavy chain and a heterologous gene encoding an antibody light chain. The ratio of the two vectors needs to be appropriately adjusted. Based on experiments under many different conditions, it has been determined that the methods provided herein can express antibodies with high efficiency and can be used to reliably increase heteromultimer expression in a relatively short period of time. In addition, the methods provided herein can express antibodies at high expression levels. Therefore, in some embodiments, the method involves transfecting a cell with a pair of two transposon vectors, one carrying a heterologous gene encoding a first polypeptide and the other carrying a heterologous gene encoding a second polypeptide. Two selection markers are used. One selection marker is a blasticidin resistance gene and the other selection marker is a bleomycin resistance gene. In some embodiments, blasticidin is present in the selection medium in an amount of 1-15 μg / mL, and bleomycin is present in an amount of 50-1500 μg / mL. In some embodiments, after about 18 to 30 hours (e.g., about 24 hours) of transfection, cells are cultured in an appropriate cell culture medium containing blasticidin (e.g., 9 μg / mL) and bleomycin (e.g., 400 μg / mL). Then, every 2 to 4 days, the cells are passaged to a new medium containing blasticidin and bleomycin. When the cell viability is restored to more than 90%, the expression level of the heteromultimer can be evaluated by batch feeding. In some embodiments, the batch feeding culture can be any medium as described herein. In some embodiments, the batch feeding culture comprises blasticidin and bleomycin.

[0190] The present disclosure also provides a method for preparing a transgenic animal. On the one hand, the method involves the following in vitro introduction into a non-human vertebrate embryo or a fertilized oocyte: a nucleic acid comprising a transposon vector as described herein, and a nucleotide sequence encoding a transposase as described herein in the same vector or on a separate vector. The resulting non-human vertebrate embryo or fertilized oocyte can be selected and then implanted into a foster mother of the same species under conditions that are conducive to the embryo developing into a transgenic non-human vertebrate. Then, the embryo can develop into a transgenic non-human vertebrate, thereby producing a transgenic non-human vertebrate containing an exogenous nucleotide sequence.

[0191] Many selection markers can be used, including, for example, genes that provide resistance to antibiotics, pesticides, insecticides, herbicides; genes that modify the host's physiology, such as, for example, eye color or green fluorescent protein, to produce an altered visible phenotype; etc. The inserted DNA is integrated into the genome and can be stably transmitted to subsequent offspring. In some embodiments, cross-breeding is performed to produce heterozygous or homozygous transgenic animals with the inserted sequence.

[0192] In some embodiments, the animal is a cow, cat, dog, horse, sheep, mouse, rat, guinea pig, hamster, mink, panda, or pig. In some embodiments, the cell is of mammalian origin and can be obtained from various animals described herein.

[0193] On the one hand, the present disclosure relates to a method for preparing a recombinant host cell stably expressing a protein, the method comprising inserting a vector as described herein into a host cell. In some embodiments, the host cell is a Chinese hamster ovary (CHO) cell. In some embodiments, provided herein is a method comprising culturing a recombinant host cell as described herein under conditions that allow protein production.

[0194] On the one hand, the disclosure also provides a method for identifying a polypeptide with a desired property (e.g., binding specificity or functionality). The method involves generating different sets of polynucleotides, preferably plasmid vectors or double-stranded DNA PCR amplicons encoding polypeptides with different properties, wherein the polynucleotides comprise sequences encoding polypeptides between ITR sequences, and the ITR sequences are recognized by at least one transposase and work with at least one transposase. The different sets of polynucleotides are then introduced into a host cell. At least one transposase working with the reverse terminal repeats is expressed in a host cell so that the different sets of polynucleotides are integrated into the host cell genome to provide a host cell population expressing different sets of the polynucleotides, and the polynucleotides encode polypeptides with different properties. The host cells are then screened to identify host cells expressing polypeptides with a desired property (e.g., binding specificity or functionality). The inserted sequence is then determined from the host cell.

[0195] In one aspect, the present disclosure relates to a kit comprising a recombinant host cell as described herein, a method of using a recombinant host cell as described herein in the preparation of a reagent or kit for detecting a disease caused by abnormal protein expression. In one aspect, the present disclosure also provides a method of using a recombinant host cell as described herein in the preparation of a pharmaceutical composition for treating or preventing a disease. Also provided herein is a pharmaceutical composition containing at least one (e.g., one, two, three, or four) protein (e.g., antibody or antigen binding fragment) as described herein. The pharmaceutical composition can be formulated in any manner known in the art.

[0196] Example

[0197] The present invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

[0198] Example 1: Construction of a vector library and a stable pool expressing green fluorescent protein

[0199] 1.1 Preparation of vector library containing genomic fragments of Chinese hamster ovary cells

[0200] 1.1.1 1 μg of GFP expression vector (i.e., Fig. 9 The vector shown in FIG. 3 was digested with BamHI to linearize the vector and incubated at 37° C. overnight (the composition and content of the reagents in the digestion reaction are shown in Table 3), wherein BamHI can be replaced by any other endonuclease corresponding to the specific digestion site that exists upstream of the promoter corresponding to GFP.

[0201] The schematic diagram of GFP expression vector is as follows Fig. 9 shown.

[0202] Table 3 Composition and content of reagents in enzyme digestion reaction

[0203] Reaction components volume NEB CutSmart Buffer (Cat#B7204S) 5μL B H 5μL GFP expression vector 1 μg Ultrapure water Make up the total volume to 50 μL

[0204] 1.1.2 Approximately five million CHO host cells were harvested, and genomic DNA of the CHO host cells was extracted using the DNeasy Blood & Tissue Kit (QIAGEN), and the genomic DNA was dissolved in 100 μL of the elution buffer of the aforementioned kit.

[0205] 1.1.3 5 μg of genomic DNA was digested with 100 units of restriction endonuclease BglII (NEB) or DpnII (NEB) (the composition and content of the reagents in the digestion reaction are shown in Table 4). Other restriction endonucleases can also be used as long as they match the sticky ends of the endonuclease of the linearized vector in step 1.1.1.

[0206] Table 4 Composition and content of reagents in enzyme digestion reaction

[0207] Reaction components volume NEB CutSmart Buffer (Cat#B7204S) 5μL B H 5μL CHO genomic DNA 1 μg Ultrapure water Make up the total volume to 50 μL

[0208] 1.1.4 Treat the linearized vector in 1.1.1 with 2 units of calf intestinal alkaline phosphatase (NEB) at 37°C for about 30 minutes. Other types of alkaline phosphatases can also be used.

[0209] 1.1.5 Separate the linearized GFP expression vector in 1.1.4 and the CHO genomic DNA digested in 1.1.3 by agarose gel electrophoresis. Recover the GFP expression vector fragment and the 1-4 kb fragment of the genome digested by gel excision, and extract DNA from the agarose gel after electrophoresis using QIAquick Gel Extraction Kit (QIAGEN).

[0210] 1.1.6 The GFP expression vector fragment and the genomic fragment recovered in 1.1.5 were connected using a DNA ligation kit (Ligation Kit) (Takara, Cat#6022), and the ligation reaction was carried out at 16°C for 45 minutes (the composition and content of the reagents in the ligation reaction are shown in Table 5).

[0211] Table 5 Composition and content of reagents in the ligation reaction

[0212] Reaction components volume Recovered CHO genomic DNA 4μL Recycled carrier 6μL Solution I 20 μg Ultrapure water 10μL

[0213] 1.1.7 Take 10 μL of the ligation product obtained by 1.1.6, add 100 μL of competent cells, ice bath for 30 minutes, heat shock at 42°C for 1 minute, and then place on ice for 1 minute. Add 500 μL of fresh LB medium without antibiotics to each tube of cells, and resuscitate the cells at 37°C for 45 minutes. Skip the plating step and directly add 500mL of medium containing 100 mg / L of ampicillin. Use Plasmid Maxi Kit (QIAGEN) for vector extraction. The extracted DNA is used as a vector library.

[0214] 1.1.8 Linearize the vector library obtained in 1.1.7 using a restriction endonuclease (e.g., PvuI (NEB)) whose restriction site is located only in the prokaryotic region of the vector backbone, and incubate overnight at 37° C. under the same reaction conditions as in 1.1.1. The next day, recover the DNA by the phenol-chloroform method and use it for transfection.

[0215] 1.2 Construction of a stable pool expressing green fluorescent protein

[0216] 1.2.1 Centrifuge about five million CHO host cells and discard the supernatant. At the same time, evenly mix 90 μL of SF cell line solution (Cell Line Solution), 20 μL of Supplement I (Supplement I) and 0.3 μg to 0.6 μg of the linearized vector library obtained by step 1.1.8 in the Amaxa SF Cell Line 4D-Nucleofector Kit L (Lonza, Cat# VCA-1005), resuspend the cells with the mixed solution and transfer them into the electroporation cuvette. Use 4D-Nucleofector TM The cells were transfected using the program corresponding to each host cell in the System electroporator. The electroporated cells were resuspended in 5 mL of culture medium without antibiotics and cultured in a shaking incubator at 37°C.

[0217] 1.2.2 24 hours after transfection, add an equal volume of selection medium containing an antibiotic corresponding to the resistance gene in the vector to the cell culture medium for screening (in this experiment, the antibiotic is bleomycin (800 μg / mL)).

[0218] 1.2.3 Count the cells every 2 to 4 days, perform cell subculture according to the cell growth, and screen by using a selection medium with an antibiotic corresponding to the resistance gene in the vector (in this experiment, the antibiotic is bleomycin (400 μg / mL)). When the cell survival rate recovers to more than 90%, prepare for monoclonal screening.

[0219] Example 2: Screening of clones that highly express green fluorescent protein

[0220] 2.1 Single cell sorting and expansion

[0221] 2.1.1 The cells with higher GFP expression levels (eg, the top 0.5% of the expression levels) in the recovered pool in step 1.2.3 of Example 1 were sorted by FACS AriaII flow cytometer and cultured in 96-well plates.

[0222] 2.1.2 Replace 75% of the medium in the plate every 2 to 4 days until recovered cells are visible to the naked eye.

[0223] 2.2 Screening of clones with high GFP expression

[0224] The cells recovered in 2.1.2 were transferred to new 96-well plates in sequence, for a total of about 300 clones (all cells in each well were derived from one cell, referred to as one clone). The expression level of GFP was detected by FACS AriaII flow cytometer, and the clones with the top 10% of the detection intensity were transferred to 24-well plates for amplification.

[0225] Example 3: Screening, identification and validation of transcriptional regulatory elements

[0226] 3.1 Identification of candidate sequences of transcriptional regulatory elements

[0227] 3.1.1 When the cells amplified in the 24-well plate in 2.2 substantially fill the bottom of the plate, the genome of each clone is extracted using the DNeasy Blood & Tissue Kit (QIAGEN).

[0228] 3.1.2 Design forward primers and reverse primers in the vector (about 200 bp upstream and downstream of the restriction site of BamHI, respectively), and perform PCR amplification on the genome extracted in 3.1.1 in sequence, wherein the sequence of the forward primer of the PCR reaction is: GCAAAAAAGGGAATAAGGGCGACACGG (SEQ ID NO: 69), and the sequence of the reverse primer of the PCR reaction is: CATAGCCCATATATGGAGTTCCGCGTTA (SEQ ID NO: 70).

[0229] The reaction system of the above PCR reaction is shown in Table 6.

[0230] Table 6 Reaction system of PCR reaction

[0231] Reaction components volume 5X Q5 Reaction Buffer 5μL 10mM dNTPs 0.5μL 10 μM forward primer 1.25μL 10 μM reverse primer 1.25μL Genome 1μL Q5 DNA Polymerase (Cat#M0491S) 0.25μl Ultrapure water 15.75μL

[0232] The reaction steps of the above PCR reaction are shown in Table 7.

[0233] Table 7 PCR reaction steps

[0234]

[0235] 3.1.3 The PCR products were separated by agarose gel electrophoresis, the gel was cut to recover specific bands (more than one) larger than 1 kb, and DNA was extracted using QIAquick Gel Extraction Kit (QIAGEN).

[0236] 3.1.4 Send the recovered bands (one or more) for sequencing to identify the sequences A to G of the candidate transcriptional regulatory elements.

[0237] 3.1.5 The sequences A to G of the transcriptional regulatory elements identified by sequencing are as follows, wherein:

[0238] The sequence of the transcriptional regulatory element A is the sequence shown in SEQ ID NO: 35 (the reverse sequence of the transcriptional regulatory element A is the sequence shown in SEQ ID NO: 47);

[0239] The sequence of transcriptional regulatory element B is the sequence shown in SEQ ID NO:36 (the reverse sequence of transcriptional regulatory element B is the sequence shown in SEQ ID NO:48);

[0240] The sequence of the transcriptional regulatory element C is the sequence shown in SEQ ID NO: 37 (the reverse sequence of the transcriptional regulatory element C is the sequence shown in SEQ ID NO: 49);

[0241] The sequence of the transcriptional regulatory element D is the sequence shown in SEQ ID NO: 38 (the reverse sequence of the transcriptional regulatory element D is the sequence shown in SEQ ID NO: 50);

[0242] The sequence of the transcriptional regulatory element E is the sequence shown in SEQ ID NO: 39 (the reverse sequence of the transcriptional regulatory element E is the sequence shown in SEQ ID NO: 51);

[0243] The sequence of the transcriptional regulatory element F is the sequence shown in SEQ ID NO: 40 (the reverse sequence of the transcriptional regulatory element F is the sequence shown in SEQ ID NO: 52);

[0244] The sequence of the transcriptional regulatory element G is the sequence shown in SEQ ID NO:41 (the reverse sequence of the transcriptional regulatory element G is the sequence shown in SEQ ID NO:53);

[0245] The sequence of the transcriptional regulatory element H is the sequence shown in SEQ ID NO:42 (the reverse sequence of the transcriptional regulatory element H is the sequence shown in SEQ ID NO:54);

[0246] The sequence of transcriptional regulatory element 1 is the sequence shown in SEQ ID NO: 43 (the reverse sequence of transcriptional regulatory element 1 is the sequence shown in SEQ ID NO: 55);

[0247] The sequence of the transcriptional regulatory element J is the sequence shown in SEQ ID NO: 44 (the reverse sequence of the transcriptional regulatory element J is the sequence shown in SEQ ID NO: 56); and

[0248] The sequence of the transcription regulatory element K is the sequence shown in SEQ ID NO: 45 (the reverse sequence of the transcription regulatory element K is the sequence shown in SEQ ID NO: 57).

[0249] 3.2 Verification of transcriptional regulatory elements

[0250] 3.2.1 Use the In-Fusion Cloning Kit (Takara) to insert the transcriptional regulatory elements A to K identified by sequencing in 3.1.5 into the BamHI restriction site upstream of the corresponding promoter in the vector containing the GFP gene. Fig.10 The vector in which the transcriptional regulatory element is inserted is shown (wherein WXRE indicates one of the transcriptional regulatory elements A to K). The aforementioned vector is linearized using a restriction endonuclease (e.g., PvuI (NEB)) whose restriction site is located only in the prokaryotic region of the vector backbone, and incubated overnight at 37° C. The next day, DNA is recovered by phenol-chloroform and used for transfection.

[0251] 3.2.2 Centrifuge about five million CHO host cells and discard the supernatant. Meanwhile, evenly mix 90 μL of SF cell line solution, 20 μL of supplement I and 30 μg of linearized vector containing the gene of the protein to be expressed (obtained by 3.2.1) in Amaxa SF cell line 4D-Nucleofector Kit L (Lonza, Cat# VCA-1005), resuspend the cells with the mixed solution and transfer them into the electroporation tube. TM The cells were transfected using the program corresponding to each host cell in the System electroporator. The electroporated cells were resuspended in 5 mL of medium without antibiotics and cultured in a shaker at 37°C. Each sample contained a transcriptional regulatory element or was a control without any transcriptional regulatory element.

[0252] 3.2.3 24 hours after transfection, add an equal volume of selection medium containing antibiotics corresponding to the resistance gene in the vector to the cell culture medium for screening. Use a medium containing antibiotics (one or more) to passage the cells every 2 to 4 days.

[0253] 3.2.4 After the cell viability recovered to above 90%, batch fed-batch culture was used to evaluate the effect of transcription regulatory elements A to K on protein expression levels.

[0254] Example 4: Effect of transcriptional regulatory elements on expression levels of protein expression systems for expressing heterologous proteins

[0255] 4.1.1 The transcriptional regulatory elements A to K were constructed in both the forward and reverse directions into the upstream BamHI position of the promoter of the fusion protein (the aforementioned fusion protein is the A chain of PD-L1, and its sequence is the sequence shown in SEQ ID NO: 71). Fig.10 The vector shown has a transcriptional regulatory element inserted therein (wherein WXRE is one of the transcriptional regulatory elements A to K), wherein the tail number 1 of the transcriptional regulatory element indicates the forward direction, and the tail number 2 of the transcriptional regulatory element indicates the reverse direction. For example, the transcriptional regulatory element A1 (as shown in SEQ ID NO: 35) shows the forward direction (i.e., 5' to 3') of the sequence, which is transcribed in the sense strand of the coding sequence. The transcriptional regulatory element A2 shows the reverse complementary sequence of the sequence and is shown in SEQ ID NO: 47. That is, the transcriptional regulatory element A1 in the sense strand of the protein coding sequence in Example 4 is equivalent to the transcriptional regulatory element A in Example 3 of the present disclosure.

[0256] The vector was linearized using a restriction endonuclease (eg, PvuI (NEB)) whose restriction sites were located only in the prokaryotic region of the vector backbone, and incubated overnight at 37° C. The next day, the DNA was recovered by phenol-chloroform and used for transfection.

[0257] 4.1.2 Centrifuge about 5 million CHO host cells and discard the supernatant. Meanwhile, evenly mix 90 μL of SF cell line solution, 20 μL of supplement I and 30 μg of linearized vector containing the gene of fusion protein (obtained by 4.1.1) in Amaxa SF cell line 4D-Nucleofector. Resuspend the cells with the mixed solution and transfer them into the electroporation tube. TM The cells were transfected using the program corresponding to each host cell in the System electroporator. The electroporated cells were resuspended with 5 mL of antibiotic-free culture medium and cultured in a shaker at 37°C. The samples in one group contained only one transcriptional regulatory element in a certain direction (i.e., forward or reverse), and the samples that did not contain any transcriptional regulatory elements were used as controls.

[0258] 4.1.3 24 hours after transfection, add an equal volume of culture medium containing 800 μg / mL bleomycin to the transfected cells.

[0259] 4.1.4 The cells were passaged every 2 to 4 days using medium containing 400 μg / mL bleomycin.

[0260] 4.1.5 When the cell survival rate recovered to above 90%, the expression level of the fusion protein PD-L1 was evaluated by batch feeding culture.

[0261] 4.1.6 Verify whether the sequence of PD-L1 obtained by expression is identical to the sequence shown in SEQ ID NO:71.

[0262] 4.2 Experimental Results

[0263] like Fig.11 As shown, compared with the control group without the transcriptional regulatory element, inserting the transcriptional regulatory element upstream of the promoter of the fusion protein can increase the expression level of the target protein by about 10% to 25% (see Fig.11 The aforementioned sequences promote protein expression in one direction more than in another direction, which may be related to the directionality of the promoter.

[0264] like Fig.12As shown, corresponding to the expression level, the positive or negative transcription regulatory element can increase the specific productivity by about 10% (see Fig.12 A2, B1, B2, D2, E2, F2, G1, H1, I2, J1, and K2).

[0265] At the same time, it was confirmed by verification that the sequence of PD-L1 obtained by expression was identical to the sequence shown in SEQ ID NO:71.

[0266] Example 5: Effect of transcriptional regulatory elements on the expression level of adalimumab expressed in a protein expression system

[0267] 5.1.1 The reverse sequence (A2) of transcriptional regulatory element A, the forward sequence (B1) of transcriptional regulatory element B, and the forward sequence (G1) of transcriptional regulatory element G were constructed upstream of the promoter of the gene expressing adalimumab by using Takara's In-Fusion cloning kit (specific conditions are shown in Table 7). Fig.13 and Fig.14 The vector in which the transcriptional regulatory element is inserted is shown in FIG. 1 (where WXRE is one of the transcriptional regulatory elements A to G), wherein the "heavy chain upstream transcriptional regulatory element" is cloned into Fig.13 The vector shown in FIG. 1 is used to clone the "light chain upstream transcriptional regulatory element" into the vector shown in FIG. Fig.14 In the vector shown. Fig.13 The amino acid sequence of the heavy chain (HC) of adalimumab in is shown in SEQ ID NO: 72; Fig.14 The amino acid sequence of the light chain (LC) of adalimumab in is shown in SEQ ID NO:73.

[0268] The aforementioned vector was linearized using a restriction endonuclease (eg, PvuI (NEB)) whose restriction site was located only in the prokaryotic region of the vector backbone, and incubated overnight at 37° C. The next day, DNA was recovered by phenol-chloroform and used for transfection.

[0269] Table 8 Corresponding transcriptional regulatory elements under different conditions

[0270] Sample ID Transcriptional regulatory element upstream of the heavy chain Transcriptional regulatory element upstream of the light chain 1 B1 B1 2 B1 G1 3 G1 G1 4 B1 A2 5 G1 A2 6 (for comparison of 1-5) N / A N / A 7 H1 H1 8 I2 I2 9 J1 J1 10 K1 K1 11 K2 K2 12 (for 7-11 comparison) N / A N / A

[0271] 5.1.2 Centrifuge about five million CHO host cells and discard the supernatant. Meanwhile, evenly mix 90 μL of SF cell line solution, 20 μL of supplement I and 30 μg of linearized vector containing the sequence of adalimumab (obtained by 5.1.1) in Amaxa SF cell line 4D-nucleofectomy kit L (Lonza, Cat# VCA-1005), resuspend the cells with the mixed solution and transfer them into the electroporation tube. Use 4D-Nucleofector TM The cells were transfected using the program corresponding to each host cell in the System electroporator. The electroporated cells were resuspended with 5 mL of antibiotic-free culture medium and cultured in a shaker at 37°C. The samples in one group contained only one transcriptional regulatory element in a certain direction (i.e., forward or reverse), and the samples that did not contain any transcriptional regulatory elements were used as controls.

[0272] 5.1.3 Use a method designed for rapid evaluation of antibody expression. This method ensures that the antibody heavy and light chains are roughly expressed in a 1:1 ratio and can reliably evaluate antibody expression in a relatively short period of time. 24 hours after transfection, add an equal volume of culture medium containing 18 μg / mL blasticidin and 800 μg / mL bleomycin to the transfected cells.

[0273] 5.1.4 The cells were passaged every 2 to 4 days using medium containing 9 μg / mL blasticidin and 400 μg / mL bleomycin.

[0274] 5.1.5 When the cell survival rate recovers to more than 90%, the expression level of adalimumab is evaluated by batch feeding culture. Since both the heavy chain expression vector and the light chain expression vector of adalimumab can be transfected into the same host cell, the heavy chain and light chain of adalimumab can be expressed simultaneously. Since the aforementioned heavy chain and light chain can self-assemble in the host cell, a complete adalimumab is obtained.

[0275] 5.1.6 Determine the biological activity of the obtained adalimumab.

[0276] 5.2 Experimental Results

[0277] Compared with the control group, in some forward sequences containing transcriptional regulatory element B (see samples 1, 2, and 4), the expression level of adalimumab increased by 10% to 20% (e.g. Fig.15 shown).

[0278] By determining the biological activity of adalimumab expressed by the heterologous protein expression vector, it was found that its biological activity was the same as that of the known commercially available adalimumab.

[0279] Example 6: Transposon-based stable pool development

[0280] The recombinant protein expression gene and the antibiotic resistance gene are inserted between a pair of terminal repeat sequences that can be recognized by the piggyBac transposase. For example, if the recombinant protein (eg, antibody or Fc fusion protein) comprises multiple expression units, these different expression units can be cloned into vectors containing different antibiotic resistance genes.

[0281] The plasmid containing the piggyBac transposase expression gene and the plasmid containing the recombinant protein expression gene were prepared by the endotoxin-free plasmid kit, respectively. These plasmids do not need to be linearized by digestion.

[0282] The host cells used for transfection are suspension-adapted CHO-K1 cells. The desired viable cell density of the host cells is between 1 million and 3 million cells / mL.

[0283] To generate cell pools expressing different human IgG1 antibodies (A, B, and C), 10 million host cells were transfected with a total of 20 μg of a 10:1 mass ratio of a transposon vector and a transposase vector for expressing antibodies. The transposon vector included a transposon vector for antibody heavy chain and a transposon vector for antibody light chain at a ratio of about 1:1.

[0284] Then, the transfected cells were resuspended in 10 mL of cell culture. For the control, the same amount of host cells were transfected with the same amount of linearized antibody expression plasmid. These linearized antibody expression nucleic acids were not inserted into the transposase expression plasmid. The cells were mixed with the plasmid and Culture in a shaking incubator.

[0285] After transfection for 24 hours, 10 mL of fresh culture medium containing selected antibiotics was added to the cell culture. The antibiotic reagent corresponds to the antibiotic resistance gene. The concentration of the antibiotic is determined by a killing curve experiment on the host cells. In addition, the concentration of the supplementary culture medium is twice the level of the selected antibiotic concentration. This will allow the actual antibiotic concentration of the resulting cell culture to be at the selected antibiotic concentration level.

[0286] Cells were passaged every 2 to 4 days with fresh medium containing the selected antibiotic agent. The seeding density was adjusted based on the viability, growth rate, and doubling time of the cells.

[0287] After approximately 2 weeks of cultivation, the cell cultures were used to inoculate production basal medium at the same inoculation density determined for each transfected cell culture.The production cell cultures were grown in a shaking incubator.

[0288] The production process is carried out by fed-batch culture. The culture is supplemented with a suitable type and amount of feed medium accordingly.

[0289] The results are shown in Figure 2 After 14 days of culture, the fed-batch culture of host cells using the piggyBac transposon system produced 2.4 g / L Antibody A, 4.1 g / L Antibody B, and 4.6 g / L Antibody C (PB D14 titer). As shown in the figure, different sequences of the variable regions can lead to different expression levels. But for each antibody, the piggyBac transposon expression system significantly increased the expression level.

[0290] In contrast, the conventional stable pool control produced less than 0.2 g / L of antibody (conventional pool D14 titer). Thus, under the same conditions, the piggyBac transposon system increased protein expression more than 10-fold.

[0291] Example 7: Regulatory element screening

[0292] As described below, RNA sequencing was performed on the mRNA of CHO-K1 cells at different stages. Transient and stable transfections were performed and total RNA was extracted from: 1) 10 samples on day 6 after transient transfection; 2) 10 samples on day 8 after transient transfection; and 3) 10 stable transfection samples on day 10 of a traditional 14-day batch feeding process.

[0293] cDNA was generated and sequenced. Based on the relative number of reads, mRNAs were extracted and ranked by the average abundance of all 30 samples. Regulatory element (RE) sequences were extracted from the top ranked mRNAs and listed in the table below.

[0294] Table 1.

[0295]

[0296] Experiments were performed to evaluate the effects of these RE sequences on protein expression. These RE sequences were incorporated into fusion protein expression plasmids, immediately following the recombinant protein expression gene. The control sample did not contain any regulatory element sequence.

[0297] A total of 10 million host cells were transfected with 20 μg of fusion protein expression plasmids with different RE sequences. The transfected cells were resuspended in 10 mL of host cell culture. The resulting solution was mixed and Culture in a shaking incubator.

[0298] 24 hours after transfection, 10 mL of fresh medium containing selected antibiotics was added to the transfected cell culture. Cells were passaged every 2 to 4 days with fresh medium containing the selected antibiotic reagent. The inoculation density was adjusted based on the cell survival rate, growth rate, and doubling time.

[0299] After approximately 2 weeks of antibiotic selection, the cell cultures were each used to inoculate production basal medium at the same inoculation density as determined for each transfected cell culture. The production cell cultures were grown in a shaking incubator.

[0300] The production process is carried out by fed-batch culture. The culture is supplemented with a suitable type and amount of feed medium accordingly.

[0301] like Figure 3 As shown in , most of the regulatory elements increased protein expression by at least 10% productivity compared to the control.

[0302] Example 8: Combination of piggyBac and regulatory elements

[0303] The recombinant protein expression gene, a typical regulatory element sequence and an antibiotic resistance gene are cloned between a pair of terminal repeat sequences that can be recognized by the piggyBac recombinase. For example, if the recombinant protein (e.g., antibody or Fc fusion protein) contains multiple expression units, these different expression units can be cloned into vectors containing different antibiotic resistance genes.

[0304] The plasmid containing the piggyBac transposase expression gene and the plasmid containing the recombinant protein expression gene were prepared by an endotoxin-free plasmid kit, respectively. These plasmids were not linearized by digestion.

[0305] The host cells used for transfection are suspension-adapted CHO-K1 cells. The desired viable cell density of the host cells is between 1 million and 3 million cells / mL.

[0306] To generate cell pools expressing different human IgG1 antibodies (D, E, and F), 10 million host cells were transfected with 20 μg of a 10:1 mass ratio of piggyBac transposon vector (with or without WXRE ID: B (SEQ ID NO: 36)) and transposase vector. The transfected cells were then resuspended in 10 mL of host cell culture. As a traditional stable pool control, the same number of host cells were transfected with the same amount of linearized antibody expression plasmid. The resulting solutions were mixed and plated in Culture in a shaking incubator.

[0307] After 24 hours of transfection, 10 mL of fresh culture medium containing selected antibiotics was added to the transfected cell culture. The antibiotic reagent corresponds to the antibiotic resistance gene as determined herein. The concentration of the antibiotic is determined by a kill curve experiment on the host cells. In addition, the concentration of the supplementary culture medium is twice the level of the selected antibiotic concentration for selection, so that the actual antibiotic concentration of the resulting cell culture is the same as the selected antibiotic concentration.

[0308] Cells were passaged every 2 to 4 days with fresh medium containing the selected antibiotic agent. The seeding density was adjusted based on the viability and doubling time of the cells.

[0309] After 2 weeks of antibiotic selection, the cell cultures were each used to inoculate production basal medium at the same inoculation density determined for each transfected cell culture.The production cell cultures were grown in a shaking incubator.

[0310] The production process is carried out by fed-batch culture. The culture is supplemented with a suitable type and amount of feed medium accordingly.

[0311] like Figure 4 As shown in , after 14 days, the protein expression (titer) of the three groups of production cell cultures using only the piggyBac transposon system (without RE sequence) was 2.1 g / L, 3.9 g / L, and 5.5 g / L, respectively. However, when the RE sequence was present in the antibody expression plasmid, the expression increased to 2.8 g / L, 5.2 g / L, and 6.5 g / L, respectively. The results show that the combination of the piggyBac transposon system and the regulatory element sequence (e.g., WXRE) can further increase protein production.

[0312] Other Implementations

[0313] It should be understood that although the invention has been described in conjunction with the detailed description of the invention, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the appended claims.

Claims

1. A nucleic acid comprising: 5'-ITR (inverted terminal repeat) sequence; 3'-ITR sequence; and A regulatory element sequence that is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-15 and SEQ ID NOs: 35, 37-47, 49-58.

2. The nucleic acid of claim 1, wherein the 5'-ITR sequence comprises or consists of a sequence that is at least 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO:68, and the 3'-ITR sequence comprises or consists of a sequence that is at least 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO:

60.

3. The nucleic acid of claim 1, wherein the 5'-ITR sequence comprises SEQ ID NO: 68 and the 3'-ITR sequence comprises SEQ ID NO:

60.

4. The nucleic acid of claim 1, further comprising a 5'-inner domain and a 3'-inner domain, wherein the 5'-inner domain comprises a sequence that is at least 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO:66, wherein the 3'-inner domain comprises a sequence that is at least 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO:67, wherein the 5'-inner domain is adjacent to the 5'-ITR and the 3'-inner domain is adjacent to the 3'-ITR.

5. The nucleic acid of claim 1, wherein the nucleic acid comprises one or more regulatory element sequences selected from the group consisting of SEQ ID NOs: 1-15 (eg, SEQ ID NO: 2).

6. The nucleic acid of claim 1, wherein the nucleic acid comprises one or more regulatory element sequences selected from the group consisting of SEQ ID NOs: 35, 37-47, 49-58.

7. The nucleic acid according to any one of claims 1 to 6, further comprising a promoter and a sequence encoding a polypeptide, wherein the sequence encoding a polypeptide is operably linked to the promoter.

8. The nucleic acid according to claim 7, wherein the sequence encoding the polypeptide is located between two regulatory element sequences.

9. The nucleic acid according to any one of claims 1 to 6, further comprising a promoter and a sequence encoding two or more polypeptides, wherein the sequence encoding two or more polypeptides is operably linked to the promoter.

10. The nucleic acid of claim 9, wherein the sequence encodes an antibody heavy chain and an antibody light chain.

11. The nucleic acid of any one of claims 1 to 10, wherein the nucleic acid further comprises a WXRE sequence that is at least 80%, 85%, 90%, 95% or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 35, 37-47, 49-58.

12. The nucleic acid according to any one of claims 1 to 10, wherein the nucleic acid comprises two or more expression cassettes.

13. The nucleic acid according to any one of claims 1 to 12, wherein the nucleic acid comprises a selection marker.

14. The nucleic acid of claim 13, wherein the selection marker is an antibiotic resistance gene, a sequence encoding a fluorescent protein, or lacZ.

15. A vector comprising the nucleic acid according to any one of claims 1 to 14.

Images