A plasmid vector for seamless editing of Drosophila genome, its construction method and application
By designing the plasmid vector pGX-DsRed-ITRs-TTAA, the seamless editing problem in Drosophila genome editing is solved, the accuracy and reliability of genome editing is achieved, and the difficulty of homologous recombination ligation is reduced.
Patent Information
- Application Number
- CN202211608126.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-14
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2042-12-14
AI Technical Summary
The prior art is difficult to achieve seamless editing during the process of Drosophila genome editing, especially the introduction of exogenous sequences at both ends of knocked-in genes, affecting the experimental results.
A plasmid vector pGX-DsRed-ITRs-TTAA was designed, which contained 3’ITRS-DsRed-5’ITRS elements. The upstream and downstream of the DsRed gene were piggyBac transposons 3’ and 5’ITRS, respectively, and BbsI and BsaI endonuclease sites were introduced, immediately adjacent to the TTAA sequence, so as to facilitate the recognition and accurate removal of piggyBac transposonase.
Through this plasmid vector, seamless editing of the fruit fly genome is achieved, reducing the difficulty and efficiency of homologous recombination junctions, and improving the accuracy and reliability of genome editing.
Smart Images

Figure CN115772540B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering and relates to a plasmid vector for seamless editing of Drosophila genomes, a construction method thereof, and applications thereof. Background Art
[0002] Currently, the third-generation gene editing technology CRISPR / Cas9 endonuclease is widely used for editing Drosophila genomes. This enzyme can act on specific genomic sequences under the guidance of sgRNA to generate DNA double-strand breaks. The homologous directed repair mechanism can be used to achieve specific knockout or knock-in of target genes. If an attP site is knocked in while knocking out a gene, then later, the phiC31 integrase can be used to mediate gene recombination between the attB site and the attP site, thereby introducing different gene mutations at the target gene knockout position. Since the homologous recombination mediated by phiC31 integrase has a relatively high efficiency, this method is widely used. However, this method will introduce more than 50 bp of foreign sequences at both ends of the knocked-in gene during use, bringing unpredictable effects to experimental results. To achieve seamless editing of Drosophila genomes, researchers combined the CRISPR / Cas9 technology with the piggyBac transposase. First, the CRISPR / Cas9 technology was used to introduce gene mutations and screening markers using the principle of homologous directed repair. Then, the piggyBac transposase was used to precisely remove the screening markers, achieving the effect of seamless editing of the genome. When applying this principle to the knockout process of Drosophila genomes, the screening markers can be conveniently and efficiently removed by hybridization means. The specific method can be found in the published article by the inventor. When using the CRISPR / Cas9 technology to introduce gene mutations and screening markers, the homologous sequences on both sides of the knocked-out gene must be precisely ligated to the vector TTAA sequence. Otherwise, it will not be recognized and excised by the piggyBac transposase later, so it is impossible to insert the two homologous arms separately using restriction endonucleases. Instead, the two homologous arms and the screening marker DsRed with ITRs on both sides can only be ligated to the vector by homologous recombination of multiple fragments in a homologous recombination manner. However, the homologous recombination ligation of multiple fragments is difficult, and its efficiency is limited by the size, concentration of the fragments, and the concentration of different fragments in the reaction system. Therefore, the ligation efficiency is usually low. Summary of the Invention
[0003] An object of the present invention is to provide a plasmid vector for seamless editing of Drosophila genomes in view of the above-mentioned deficiencies of the prior art.
[0004] Another object of the present invention is to provide a construction method of the plasmid vector.
[0005] Still another object of the present invention is to provide applications of the plasmid vector.
[0006] The object of the present invention can be achieved by the following technical solutions:
[0007] A plasmid vector pGX-DsRed-ITRs-TTAA for seamless editing of Drosophila genome, wherein the pGX-DsRed-ITRs-TTAA contains a 3’ITRS-DeRed-5’ITRS element. The DsRed gene does not contain a BbsI recognition site. The upstream and downstream of the DsRed gene sequence are respectively the 3' and 5' ITRs of the piggyBac transposon. BbsI and BsaI endonuclease sites are introduced into the 3' and 5' ITRs respectively, and are adjacent to the TTAA sequence. The schematic diagram of the main elements of the plasmid vector pGX-DsRed-ITRs-TTAA is as Figure 1 shown.
[0008] As a preference of the present invention, the backbone vector pGX-attP-DsRed of the pGX-DsRed-ITRs-TTAA is obtained by synonymous mutation to eliminate the BsaI endonuclease recognition site contained in the AmpR gene based on the M5-ΔUAST-Rpr-FRT_DsRed plasmid. The sequence of the M5-ΔUAST-Rpr-FRT_DsRed plasmid is shown in SEQ ID NO.2.
[0009] As a further preference of the present invention, the sequence of the plasmid vector pGX-DsRed-ITRs-TTAA is shown in SEQ ID NO.1, and the plasmid map is shown in Figure 2 .
[0010] The construction method of the plasmid vector pGX-DsRed-ITRs-TTAA of the present invention comprises the following steps:
[0011] (1) Obtaining pGX-attP-DsRed by synonymous mutation to eliminate the BsaI endonuclease recognition site contained in the AmpR gene in the backbone vector M5-ΔUAST-Rpr-FRT_DsRed;
[0012] (2) Amplifying a fragment containing the 3’TR-DeRed-5’TR sequence from the vector pSHD-DsRed. In the fragment containing the 3’TR-DeRed-5’TR sequence, the 3’TR-DeRed-5’TR sequence is directly connected to TTAA, and Bsal and Bbsl restriction enzyme sites and backbone vector homologous sequences are introduced at the upstream and downstream respectively. There is no BbsI recognition site in the DsRed gene of the 3’TR-DeRed-5’TR sequence;
[0013] (3) The pGX-attP-DsRed vector obtained in step (1) is digested with KpnI-HF + SpeI, and the obtained fragment is ligated with the 3’TR-DeRed-5’TR sequence obtained in step (2) by a multi-fragment homologous recombinase to obtain the plasmid vector pGX-DsRed-ITRs-TTAA.
[0014] As a preference of the present invention, in step (1), a synonymous mutation GGG→GGT is introduced by overlap-PCR, and the fragment containing the BsaI digestion site in the original vector backbone M5-ΔUAST-Rpr-FRT_DsRed is excised through the upstream and downstream HindIII and ScaI digestion sites, and the linear backbone fragment is ligated with the point-mutated fragment by a single-fragment homologous recombinase.
[0015] As a preference of the present invention, step (1) includes the following steps:
[0016] (I) The M5-ΔUAST-Rpr-FRT_DsRed vector is digested with HindIII-HF + ScaI-HF, and the long fragment with a length of 3318 bp is recovered and named A;
[0017] (II) Obtain the AmpR fragment containing synonymous point mutations: Using the M5-ΔUAST-Rpr-FRT_DsRed vector as a template, and using X33+X28 and X29+X35 as primers respectively, use Q5 high-fidelity enzyme to amplify a fragment B with a length of 1220 bp and a fragment C with a length of 451 bp; Using the equimolar mixture of fragment B and C as a template, and using X33+X35 as primers, use Q5 high-fidelity enzyme to amplify a fragment D with a length of 1634 bp; Among them, the primer X33 sequence is ATTTAAGTGTATACTTCGGT, the primer X28 sequence is TGGAGCCGGTGAGCGTGGTTCTCGCGGTATCATTGCA, the primer X29 sequence is TGCAATGATACCGCGAGAACCACGCTCACCGGCTCCA, and the primer X35 sequence is TTCTCAGAATGACTTGGTTG;
[0018] (III) Ligate to obtain the backbone vector pGX-attP-DsRed containing the synonymous point mutation AmpR sequence: Ligate fragment A and D in a 10 uL single-fragment homologous recombinase system, and verify to obtain the vector pGX-attP-DsRed.
[0019] As a preference of the present invention, step (2) includes the following steps: Using the pSHD-DsRed vector as a template, and using X23+X26 and X24+X25 as primers respectively, use Q5 high-fidelity enzyme to amplify to obtain fragment F with a length of 926bp and fragment G with a length of 866bp; wherein the primer X23 sequence is CTAGCACATATGCAGGTACCGGTCTCATTAACCCTAGAAAGATAATCATAT, the primer X26 sequence is CTCCCAGCCCATAGTCTTTTTCTGCATTACGGGGCCG, the primer X24 sequence is GCATGGAGATCTTTACTAGTGAAGACGGTTAACCCTAGAAAGATAGTCTGCG, and the primer X25 sequence is CGGCCCCGTAATGCAGAAAAAGACTATGGGCTGGGAG; the pSHD-DsRed vector sequence is as shown in SEQ ID NO.3.
[0020] As a preference of the present invention, step (3) includes the following steps:
[0021] (i) Double-digest the newly obtained vector pGX-attP-DsRed in step 1 with KpnI-HF+SpeI, and recover the long fragment with a length of 3133bp, named E;
[0022] (ii) Connect the fragments F, G and E in a multi-fragment homologous recombination enzyme system to obtain the vector pGX-DsRed-ITRs-TTAA containing the synonymous point-mutated DsRed sequence.
[0023] The application of the plasmid vector pGX-DsRed-ITRs-TTAA of the present invention in constructing a homologous arm donor plasmid required for seamless editing of the Drosophila genome.
[0024] A method for constructing a seamless editing donor plasmid of the Drosophila genome, comprising the following steps:
[0025] (1) PCR amplification to obtain 5' and 3' homologous arms, the primer sequences include complementary sequences homologous to the backbone vector -TTAA- and sequences that are basically complementary to the target gene and have synonymous mutations in the primers; at least one of the 5' and 3' homologous arms does not contain restriction enzyme cleavage sites of BbsI and BsaI;
[0026] (2) Double-digest the pGX-DsRed-ITRs-TTAA vector with BbsI+XhoI, and recover the long fragment with a length of 4784bp;
[0027] (3)Ligate one side of the homologous arm with the vector fragment of 4784 bp obtained in step (2), and then insert the other side of the homologous arm; when one side of the homologous arm contains the restriction enzyme cleavage sites of BbsI or BsaI, first insert the homologous arm without these two cleavage sites, and then insert the other side of the homologous arm after success; if neither the upstream nor the downstream homologous arms contain these two cleavage sites, either side of the homologous arm can be inserted arbitrarily, and then insert the other side of the homologous arm after success; the ligation method between the homologous arm and the vector fragment is selected from homologous recombination or T4 ligase ligation. When ligating the homologous arm with the digested vector, it is recommended to use the method of homologous recombination for ligation to ensure the correct ligation direction. If you want to use T4 ligase for ligation, correct sequences need to be designed on both sides of the homologous arm so that the sticky ends obtained by digestion are the same as those of the vector. Since the sticky ends on both sides of the homologous arm are the same, there will be two insertion directions, forward and reverse, and PCR identification is required to obtain the correctly oriented insertion. No matter how the homologous arm and the vector are ligated, be sure to determine the correct inserted sequence by sequencing.
[0028] Detailed description of the present invention
[0029] The purpose of plasmid modification in the present invention is: to obtain a vector with pigggBac transposon 3' and 5' ITRS upstream and downstream of the DsRed sequence respectively, and the 3' and 5' ITRS contain Bsal and Bbsl cleavage sites and are adjacent to the TTAA sequence. The schematic diagram of the main components of the target vector is as Figure 1 .
[0030] Problems to be solved and technical means:
[0031] Both the 3 and 5' ITRS need to be directly connected to TTAA, and there should be no other bases between them in order to be recognized and accurately removed by the pigggBac transposase. Therefore, a restriction enzyme with a cleavage site outside the recognition site needs to be selected so that the TTAA sequence remains after digestion. Bsal and Bbsl enzymes are selected for the 3' and 5' ITRS respectively. The cleavage sites of these two restriction enzymes are located downstream of the recognition site. By designing the cleavage site as the TTAA sequence, TTAA sticky ends can be generated after digestion.
[0032] The 3’TR-DeRed-5’TR sequence can be amplified from the vector pSHD-DsRed. In order to directly connect this sequence with TTAA and introduce Bsal and Bbsl cleavage sites at the upstream and downstream respectively, this part of the sequence is added to the 5’ end when designing the primers. In order for the amplified fragment to be ligated to the backbone vector M5-ΔUAST-Rpr-FRT_DsRed vector by the method of homologous recombination, sequences homologous to this vector also need to be added to the primers. The following are the sequences of the primers used for amplification:
[0033]
[0034] Note: The bold text is the TTAA sequence, the italic text is the recognition sites of Bsal and Bbsl endonucleases, and the underlined text is the homologous sequence with the backbone vector.
[0035] Sequencing found that there is a BbsI recognition site GAAGAC on the DsRed gene of the plasmid vector pSHD-DsRed, as Figure 5 shown. To prevent the gene from being cut during use, the corresponding amino acid can be subjected to a synonymous mutation AAG→AAA to eliminate the restriction site. The codon still encodes lysine and does not affect the protein function. The method is to introduce the mutation by overlap-PCR. The primer sequences used are as follows:
[0036]
[0037] Note: The bold underlined text is the introduced synonymous mutation.
[0038] Figure 3 The initial backbone vector M5-ΔUAST-Rpr-FRT_DsRed used in the present invention was sequenced and found to have a BSal recognition site GGTCTC on the AmpR gene of the plasmid, as Figure 6 shown. To prevent the gene from being cut during use, the corresponding amino acid can be subjected to a synonymous mutation GGG→GGT to eliminate the restriction site. The codon still encodes glycine and does not affect the protein function. The method is to introduce the mutation by overlap-PCR, excise the fragment containing the BsaI restriction site in the original vector backbone through the upstream and downstream HindIII and ScaI restriction sites, and ligate the linear backbone fragment with the point-mutated fragment through a single-fragment homologous recombination enzyme. The primer sequences used are as follows:
[0039]
[0040]
[0041] Note: The bold underlined text is the introduced synonymous mutation.
[0042] Beneficial effects:
[0043] For the restriction enzyme cleavage sites upstream and downstream of DsRed, two restriction endonucleases BbsI and BsaI with cleavage sites downstream of the recognition sites were used, ensuring that the sticky ends generated by enzyme digestion were TTAA sequences. Thus, after homologous recombination, the transposon elements 5’TR and 3‘TR upstream and downstream of DsRed in the vector were both adjacent to the TTAA sequence. In the present invention, BbsI endonuclease site and BsaI endonuclease site were introduced into the 5‘TR and 3‘TR of the piggyBac transposon respectively, facilitating the insertion of the upstream and downstream homologous arms required for homologous recombination. Through such a design, when constructing the homologous arm donor plasmid required for seamless editing of the Drosophila genome, one side of the homologous arm can be introduced into the vector by single enzyme digestion first. After correct sequencing identification, the remaining side of the homologous arm can be introduced by another endonuclease. Since the efficiency of single-fragment homologous recombination is much higher than that of multi-fragment homologous recombination, the present invention reduces the difficulty of obtaining the donor plasmid required for seamless editing. Brief Description of the Drawings
[0044] Figure 1 Schematic diagram of the main elements of the plasmid vector pGX-DsRed-ITRs-TTAA.
[0045] Figure 2 Plasmid map of pGX-DsRed-ITRs-TTAA.
[0046] Figure 3 Plasmid map of M5-ΔUAST-Rpr-FRT_DsRed.
[0047] Figure 4 Plasmid map of pSHD-DsRed, the source plasmid of the DsRed sequence and the piggyBac transposons on both sides used in the present invention. Since there is a BbsI recognition site GAAGAC on the DsRed gene, it is necessary to perform synonymous mutation on its corresponding amino acid to eliminate this enzyme cleavage site.
[0048] Figure 5 Schematic diagram of the BbsI recognition site on the DsRed gene in the pSHD-DsRed plasmid.
[0049] Figure 6 Schematic diagram of the BSal recognition site GGTCTC on the AmpR gene in the backbone vector M5-ΔUAST-Rpr-FRT_DsRed.
[0050] Figure 7 Double enzyme digestion map of M5-ΔUAST-Rpr-FRT_DsRed vector with HindIII-HF + ScaI-HF.
[0051] Figure 8 Gel electrophoresis result of the amplified fragment for obtaining the AmpR fragment with synonymous point mutation.
[0052] Figure 9 pGX-attP-DsRed sequencing result fragment.
[0053] Figure 10 Gel running result of the amplified DsRed fragment containing synonymous point mutations.
[0054] Figure 11 Double digestion result of pGX-attP-DsRed vector with KpnI-HF + SpeI.
[0055] Figure 12 pGX-DsRed-ITRs-TTAA vector sequencing result fragment.
[0056] Figure 13 Gel running result of the amplification products of Kis-2455-5’arm and Kis-2455-3’arm.
[0057] Figure 14 Double digestion result of pGX-DsRed-ITRs-TTAA vector with BbsI + XhoI.
[0058] Figure 15 pGX-DsRed-ITRs-TTAA-3’arm vector sequencing result fragment.
[0059] Figure 16 Double digestion result of pGX-DsRed-ITRs-TTAA-3’arm vector with NheI + BsaI.
[0060] Figure 17 Sequencing result fragment of the donor plasmid successfully inserted with the homologous arms Kis-2455-3’arm and Kis-2455-5’arm. Specific implementation mode
[0061] Construction process of plasmid pGX-DsRed-ITRs-TTAA in Example 1:
[0062] 1. Eliminate the BsaI endonuclease recognition site contained in the AmpR gene in the backbone vector M5-ΔUAST-Rpr-FRT_DsRed
[0063] 1) Double digestion of M5-ΔUAST-Rpr-FRT_DsRed vector: HindIII-HF + ScaI-HF (NEB, buffer Cutsmart, 50uL system), Figure 7 The left figure shows the predicted enzyme digestion bands by software, 3318bp + 1590bp, Figure 7 The right figure shows the fragments obtained after actual enzyme digestion. Recover the long fragment with a length of 3318bp (indicated by the red arrow) and name it A.
[0064] 2) Obtain the AmpR fragment with synonymous point mutations: Using the M5-ΔUAST-Rpr-FRT_DsRed vector as a template, and X33+X28 and X29+X35 as primers respectively, use Q5 high-fidelity enzyme to amplify to obtain fragment B with a length of 1220 bp and fragment C with a length of 451 bp. Figure 8 The left figure shows the gel electrophoresis result of the amplified fragments. Recover the two fragments (indicated by the red arrows). Using the equimolar mixture of fragment B and C as a template, and X33+X35 as primers, use Q5 high-fidelity enzyme to amplify to obtain fragment D with a length of 1634 bp, a fragment larger than 1.5 kb ( Figure 8 indicated by the red arrow in the right figure). The sequence of primer X33 is ATTTAAGTGTATACTTCGGT, the sequence of primer X28 is TGGAGCCGGTGAGCGTGGTTCTCGCGGTATCATTGCA, the sequence of primer X29 is TGCAATGATACCGCGAGAACCACGCTCACCGGCTCCA, and the sequence of primer X35 is TTCTCAGAATGACTTGGTTG.
[0065] 3) Ligate to obtain a new vector containing the AmpR sequence with synonymous point mutations and name it pGX-attP-DsRed: Ligate fragment A and D in a 10 μL single-fragment homologous recombination enzyme (Clone ExpressII One Step Cloning Kit_C112_Vazyme) system. Transform the ligation product into DH5α competent cells. Select 4 colonies with positive PCR results for sequencing. The sequencing results show that all 4 plasmids contain the designed mutations ( Figure 9 , marked with a red box), and there are no non-specific point mutations at other positions.
[0066] 2. Obtain the DsRed fragment with synonymous point mutations: Using the pSHD-DsRed vector as a template, and X23+X26, X24+X25 as primers respectively, use Q5 high-fidelity enzyme to amplify. The amplification product of X23+X26 is 926 bp, and the amplification product of X24+X25 is 866 bp. Figure 10The running gel results of the amplified fragments were obtained. Two fragments (indicated by the red arrows) were recovered and named F and G respectively. The primer X23 sequence is CTAGCACATATGCAGGTACCGGTCTCATTAACCCTAGAAAGATAATCATAT, the primer X26 sequence is CTCCCAGCCCATAGTCTTTTTCTGCATTACGGGGCCG, the primer X24 sequence is GCATGGAGATCTTTACTAGTGAAGACGGTTAACCCTAGAAAGATAGTCTGCG, and the primer X25 sequence is CGGCCCCGTAATGCAGAAAAAGACTATGGGCTGGGAG.
[0067] 3. Obtain the target vector containing the synonymous point mutation DsRed sequence:
[0068] 1) Double digest the new vector pGX-attP-DsRed obtained in step 1: KpnI-HF + SpeI (NEB, buffer Cutsmart, 50 uL system), Figure 11 The left figure shows the predicted enzyme digestion bands by software, 3133 bp + 1775 bp, Figure 11 The right figure shows the fragments obtained after actual enzyme digestion. The long fragment with a length of 3133 bp (indicated by the red arrow) was recovered and named E.
[0069] 2) Ligate to obtain a new vector containing the synonymous point mutation DsRed sequence and name it pGX-DsRed-ITRs-TTAA: Ligate fragments F, G, and E in a 10 uL multi-fragment homologous recombination enzyme (CloneExpress MuleiS One Step Cloning Kit_C113_Novoprotein) system. The ligation product was transformed into DH5a competent cells, and the bacterial solutions of 2 colonies with positive PCR results were sequenced. The sequencing results ( Figure 12 ) showed that both plasmids contained the designed mutations (marked with red frames), and there were no non-specific point mutations at other positions.
[0070] Example 2 Construction of the homologous arm plasmid required for seamless editing using the plasmid pGX-DsRed-ITRs-TTAA The following case is the experimental process of constructing the homologous arm plasmid required for the point mutation Gln2455TERM of the Kismet gene using the plasmid pGX-DsRed-ITRs-TTAA of the present invention. Experimental purpose: Clone the Kismet homologous arm with point mutations into the plasmid vector pGX-DsRed-ITRs-TTAA.
[0071] Experimental process:
[0072] 1. Design and construct the scheme and the required primer sequences, and obtain the 5' and 3' homologous arms by PCR amplification. The primer sequences are as follows:
[0073]
[0074] Note: The bold part is the TTAA sequence, the italic font is the sequence homologous to the backbone vector, and the underlined font is the introduced synonymous mutation
[0075] (1) Using the genomic DNA of Drosophila with the genotype used for embryo injection as a template, amplify the 5' and 3' homologous arms respectively: The amplification primers for Kis-2455-5'arm are X74 + X75 = 1624bp; the amplification primers for Kis-2455-3'arm are X76 + X77 = 1844bp. The gel electrophoresis results of the amplification products are as follows. Recover the two fragments (indicated by the red arrows), and name them Kis-2455-5'arm and Kis-2455-3'arm ( Figure 13 ).
[0076] 2. Double digestion of the pGX-DsRed-ITRs-TTAA vector: BbsI + XhoI (NEB, buffer 2.1, 50uL system). The enzyme digestion bands predicted by the software are 4784bp + 66bp. Figure 14 The fragment obtained after actual enzyme digestion is recovered. The long fragment with a length of 4784bp (indicated by the red arrow) is named pGX-DsRed-ITRs-TTAA_B+X.
[0077] 3. Ligate the Kis-2455-3'arm containing synonymous point mutations to the pGX-DsRed-ITRs-TTAA plasmid vector and name it pGX-DsRed-ITRs-TTAA-3'arm: Ligate the fragment Kis-2455-3'arm and pGX-DsRed-ITRs-TTAA_B+X in a 10uL single-fragment homologous recombination enzyme (Clone Express II OneStep Cloning Kit_C112_ Novoprotein) system. The ligation product is transformed into DH5a competent cells, and the bacterial solutions of 2 colonies with positive PCR results are selected for sequencing. The sequencing results show that both plasmids contain the designed mutations (marked by the red frame), and there are no non-specific point mutations at other positions ( Figure 15 )
[0078] 4. Double digestion of the pGX-DsRed-ITRs-TTAA-3'arm vector: NheI + BsaI (NEB, buffer Cutsmart, 50uL system). Figure 16The fragment obtained after enzymatic digestion, the long fragment with a length of 6602bp was recovered (indicated by the red arrow), named pGX-DsRed-ITRs-TTAA-3’arm_N+B.
[0079] 5. From Kis-2455-5’arm to the plasmid vector pGX-DsRed-ITRs-TTAA: The fragment Kis-2455-5’arm and pGX-DsRed-ITRs-TTAA-3’arm_N+B were ligated in a 10uL single-fragment homologous recombination enzyme (Clone Express II One Step Cloning Kit_C112_Vazyme) system. The ligation product was transformed into DH5α competent cells, and the bacterial solutions of 2 colonies with positive PCR results were selected for sequencing. The sequencing results showed that Kis-2455-5’arm was successfully inserted into both plasmids, and there were no non-specific point mutations at other positions ( Figure 17 ).
[0080] Through the above steps, we successfully obtained the homologous arm donor vector required for constructing Drosophila with the Kismet-Gln2455TERM point mutation. For the subsequent steps of constructing transgenic Drosophila, please refer to the article published by the inventors in the journal Hereditas in 2019 (Wang Jue, Huang Juan, Xu Rui*: Achieving seamless editing of the Drosophila genome using CRISPR / Cas9 and piggyBac, Hereditas, 2019, 41(5): 422-29.).
Claims
1. A plasmid vector pGX-DsRed-ITRs-TTAA for seamless editing of the Drosophila genome, characterized in that The described pGX-DsRed-ITRs-TTAA contains a 3’ ITRS -DeRed-5’ ITRS element, where the DsRed gene does not contain a BbsI recognition site. The upstream and downstream of the DsRed gene sequence are the 3' and 5' ITRS of the piggyBac transposon respectively. BbsI and BsaI endonuclease sites are introduced into the 3' and 5' ITRS respectively, and they are adjacent to the TTAA sequence. The backbone vector pGX-attP-DsRed of the pGX-DsRed-ITRs-TTAA is obtained by synonymous mutation to eliminate the BsaI endonuclease recognition site contained in the AmpR gene based on the M5-ΔUAST-Rpr-FRT_DsRed plasmid. The sequence of the M5-ΔUAST-Rpr-FRT_DsRed plasmid is shown in SEQ ID NO.
2. The sequence of the plasmid vector pGX-DsRed-ITRs-TTAA is shown in SEQ ID NO.
1.
2. The construction method of the plasmid vector pGX-DsRed-ITRs-TTAA according to claim 1, characterized in that Comprising the following steps: (1) Obtaining pGX-attP-DsRed by synonymous mutation to eliminate the BsaI endonuclease recognition site contained in the AmpR gene in the backbone vector M5-ΔUAST-Rpr-FRT_DsRed shown in SEQ ID NO.2; (2) Amplifying a fragment containing the 3’ TR-DeRed-5’ TR sequence from the vector pSHD-DsRed shown in SEQ ID NO.
3. In the fragment containing the 3’ TR-DeRed-5’ TR sequence, the 3’ TR-DeRed-5’ TR sequence is directly connected to TTAA, and Bsal and Bbsl restriction enzyme sites and backbone vector homologous sequences are introduced upstream and downstream respectively. There is no BbsI recognition site in the DsRed gene of the 3’ TR-DeRed-5’ TR sequence; (3) Double-digesting the pGX-attP-DsRed vector obtained in step (1) with KpnI-HF + SpeI, and ligating the obtained fragment with the 3’ TR-DeRed-5’ TR sequence obtained in step (2) through a multi-fragment homologous recombinase to obtain the plasmid vector pGX-DsRed-ITRs-TTAA.
3. The construction method according to claim 2, wherein In step (1), the synonymous mutation GGG→GGT is introduced by overlap-PCR, and the fragment containing the BsaI restriction enzyme site in the original vector backbone M5-ΔUAST-Rpr-FRT_DsRed is excised through the upstream and downstream HindIII and ScaI restriction enzyme sites. The digested linear fragment and the point-mutated fragment are ligated through a single-fragment homologous recombinase.
4. The construction method according to claim 2, characterized in that Step (1) comprises the following steps: (I) Double-digesting the M5-ΔUAST-Rpr-FRT_DsRed vector with HindIII-HF + ScaI-HF, recovering the long fragment with a length of 3318bp, and naming it A; (II) Obtaining the AmpR fragment with synonymous point mutations: Using the M5-ΔUAST-Rpr-FRT_DsRed vector as a template, and using X33+X28 and X29+X35 as primers respectively, a fragment B with a length of 1220 bp and a fragment C with a length of 451 bp were amplified using Q5 high-fidelity enzyme; Using the equimolar mixture of fragment B and C as a template, and using X33+X35 as primers, a fragment D with a length of 1634 bp was amplified using Q5 high-fidelity enzyme; Among them, the primer X33 sequence is ATTTAAGTGTATACTTCGGT, the primer X28 sequence is TGGAGCCGGTGAGCGTGGTTCTCGCGGTATCATTGCA, the primer X29 sequence is TGCAATGATACCGCGAGAACCACGCTCACCGGCTCCA, and the primer X35 sequence is TTCTCAGAATGACTTGGTTG; (III) Connecting to obtain the backbone vector pGX-attP-DsRed containing the AmpR sequence with synonymous point mutations: Fragment A and D were ligated by a single-fragment homologous recombinase, and the vector pGX-attP-DsRed was verified.
5. The construction method according to claim 2, wherein (2) The steps include the following: Using the pSHD-DsRed vector as a template, and using X23+X26 and X24+X25 as primers respectively, a fragment F with a length of 926 bp and a fragment G with a length of 866 bp were amplified using Q5 high-fidelity enzyme; (3) Among them, the primer X23 sequence is CTAGCACATATGCAGGTACCGGTCTCATTAACCCTAGAAAGATAATCATAT, the primer X26 sequence is CTCCCAGCCCATAGTCTTTTTCTGCATTACGGGGCCG, the primer X24 sequence is GCATGGAGATCTTTACTAGTGAAGACGGTTAACCCTAGAAAGATAGTCTGCG, and the primer X25 sequence is CGGCCCCGTAATGCAGAAAAAGACTATGGGCTGGGAG.
6. The construction method according to claim 5, wherein (3) The steps include the following: (i) The newly obtained vector pGX-attP-DsRed in step 1 was digested with KpnI-HF+SpeI double enzymes, and a long fragment with a length of 3133 bp was recovered and named E; (ii) The fragments F, G, and E were ligated in a multi-fragment homologous recombinase system to obtain the vector pGX-DsRed-ITRs-TTAA containing the DsRed sequence with synonymous point mutations. (7) Use of the plasmid vector pGX-DsRed-ITRs-TTAA described in claim 1 in constructing a homologous arm donor plasmid required for seamless editing of the Drosophila genome.
8. A method for constructing a seamless editing donor plasmid of Drosophila genome, characterized in that (8) The steps include the following: (1)PCR amplification was used to obtain 5' and 3' homologous arms. The primer sequences contained complementary sequences homologous to the backbone vector -TTAA- and sequences that were substantially complementary to the target gene and had synonymous mutations in the primers; at least one of the 5' and 3' homologous arms did not contain restriction enzyme cleavage sites for BbsI and BsaI. (2)The pGX-DsRed-ITRs-TTAA vector with the sequence shown in SEQ ID NO.1 was double digested with BbsI + XhoI, and a long fragment with a length of 4784 bp was recovered. (3)One side homologous arm was ligated to the vector fragment with a length of 4784 bp obtained in step (2), and then the other side homologous arm was inserted; when one side homologous arm contained restriction enzyme cleavage sites for BbsI or BsaI, the homologous arm without these two enzyme cleavage sites was inserted first, and after success, the other side homologous arm was inserted; if neither the upstream nor the downstream homologous arm contained these two enzyme cleavage sites, either side homologous arm could be inserted arbitrarily, and after success, the other side homologous arm was inserted; the ligation method between the homologous arm and the vector fragment was selected from homologous recombination or ligation with T4 ligase.