Chemical conversion method of rhodobacter sphaeroides and application thereof

Abstract

The invention relates to a chemical conversion method of Rhodobacter sphaeroides engineering bacteria, and belongs to the field of genetic engineering. According to the method, the transformant of the rhodobacter sphaeroides can be obtained only through one-step transformation, two-step strain screening is not needed, knockout of RshI genes encoding restriction endonuclease in the rhodobacter sphaeroides is not needed, the genetic modification process of the rhodobacter sphaeroides can be simplified, the genetic modification flux of the rhodobacter sphaeroides can be improved, screening is accelerated, and target strains are obtained; the period of applying the rhodobacter sphaeroides to industrial production is greatly shortened.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology and specifically to a chemical transformation method of Rhodobacterium sphaeroides and its application in the production of coenzyme Q10. Background Art

[0002] Rhodobacter sphaeroides is a photosynthetic bacterium of the genus Rhodobacter Sphaeroides. It has multiple metabolic modes and can produce coenzyme Q10, 5-aminolevulinic acid, carotenoids and hydrogen, etc. It is widely used in food, medicine, hydrogen production and other fields.

[0003] Coenzyme Q10 high-yielding Rhodobacterium sphaeroides can be obtained in a variety of ways. For example:

[0004] (1) Isolating and purifying Rhodobacter sphaeroides in different environments (such as sewage, soil, seawater, etc.) can obtain strains with high coenzyme Q10 production;

[0005] (2) Screening high-CoQ10-producing strains by chemical and physical mutagenesis;

[0006] (3) Through synthetic biology and molecular biology methods, genes related to the coenzyme Q10 synthesis pathway can be overexpressed and genes related to the side pathway can be knocked out.

[0007] According to literature reports, the transformation methods of Rhodobacter sphaeroides are mainly combined transformation methods and electroporation transformation methods. Transformation, which is the transfer of exogenous DNA into Rhodobacter sphaeroides, is the first step in the rational design of metabolic pathways and is also a common technical means in synthetic biology and molecular biology. References: Mougiakos,I.,Orsi,E.,Ghiffary,MRetal.Efficient Cas9-based genome editing of Rhodobacter sphaeroides formetabolic engineering.Microb Cell Fact.2019.Ind AC,Porter SL,Brown MT,BylesED,de Beyer JA,Godfrey SA,Armitage JP.Inducible-expression plasmid for Rhodobacter sphaeroides and Paracoccus denitrificans. Appl Environ Microbiol. 2009. Jun D, ​​Saer RG, Madden JD, Beatty JT. Use of new strains of Rhodobacter sphaeroides and a modified simple culture medium to increase yield and facilitate purification of the reaction center. Photosynth Res. 2014.

[0008] Combined transformation is co-cultivated by donor bacteria (generally Escherichia coli containing exogenous DNA) and spherical red bacteria (recipient bacteria), and the exogenous DNA is delivered by the donor bacteria to the spherical red bacteria. This method needs to transform the exogenous DNA into Escherichia coli first, and the obtained Escherichia coli transformants and spherical red bacteria are cultured to a suitable state respectively, and then the ratio of Escherichia coli and spherical red bacteria is adjusted for co-cultivation, and then the co-cultured bacterial solution is coated on a culture medium containing nalidixic acid, and the transformants of spherical red bacteria are obtained by inhibiting the growth of Escherichia coli. At present, this method is applied to the genetic modification of most spherical red bacteria, such as plasmid transformation, CRISPR-Cas9 gene editing, etc. However, this method needs to first obtain the transformants of Escherichia coli, and then perform spherical red bacteria transformation, and screen the spherical red bacteria transformants. At the same time, it is limited by the ratio of Escherichia coli to spherical red bacteria, co-cultivation mode and other factors. Not only is the operation process cumbersome, the cycle is long, and it is not easy to achieve high throughput. In addition, the current results of our laboratory show that the efficiency of transforming Rhodobacter sphaeroides by conjugation transformation of certain plasmids (such as plasmids with pIND4 as the vector backbone) is very low, and there are basically no positive clones.

[0009] The electroporation method mainly uses a strong instantaneous electric field to allow exogenous DNA to enter the recipient cell. At present, the electroporation method of Rhodobacter sphaeroides is rarely used, and there are only a few cases of pIND4 plasmid transformation. Reference: Use of new strains of Rhodobacter sphaeroides and a modified simple culture medium to increase yield and facilitate purification of the reaction centre. The main reasons are:

[0010] (1) The electroporation transformation method has high requirements for the purity (no ion residue) and quantity (ug level) of exogenous DNA;

[0011] (2) The electroporation cuvette transformation method is not suitable for high-throughput transformation;

[0012] (3) Although the use of high-throughput electroporation plates can meet the needs of high-throughput transformation, the cost is too high.

[0013] (4) Compared with the electroporation transformation shown in the literature, it is necessary to knock out the endogenous restriction endonuclease gene RshI of Rhodobacter sphaeroides.

[0014] As we all know, chemical transformation is a common transformation method for model microorganisms such as Escherichia coli and Saccharomyces cerevisiae. Its principle is to increase the permeability of the cell membrane through the action of chemical reagents, and then use heat shock to allow exogenous DNA to enter the bacteria through the pores of the cell membrane. Reference: Tripp JD, Lilley JL, Wood WN, Lewis LK. Enhancement of plasmid DNA transformation efficiencies in early stationary-phase yeast cell cultures. Yeast. 2013 May; 30 (5): 191-200. doi: 10.1002 / yea.2951. Epub 2013 April 12. PMID: 23483586; PMCID: PMC3656150.

[0015] Compared with conjugative transformation, chemical transformation only requires one transformation and does not require separation of donor bacteria and recipient bacteria. Compared with electroporation transformation, the process is simple, no electroporation equipment is required, and the cost is low. Therefore, the establishment of a high-throughput chemical transformation method for Rhodobacter sphaeroides can simplify the process of genetic modification of Rhodobacter sphaeroides, improve the throughput of genetic modification of Rhodobacter sphaeroides, accelerate the screening of target strains, and greatly shorten the design-build-test-learn cycle of the metabolic pathway of Rhodobacter sphaeroides, thereby enabling its application in industrial production. Summary of the invention

[0016] In order to overcome the problems existing in the prior art, in the first aspect, the present disclosure provides a method for chemical transformation of an engineered bacterium of Rhodobacter sphaeroides. Compared with the combined transformation method, this method does not require two-step strain screening, and only requires one-step transformation to obtain transformants of Rhodobacter sphaeroides. Compared with electroporation transformation, it does not require high DNA purity, and no additional electroporation equipment is required. There is no need to knock out the RshⅠ gene encoding the restriction endonuclease RshⅠ in Rhodobacter sphaeroides, which makes the operation more convenient and greatly shortens time and cost.

[0017] To achieve the above objectives, the present disclosure adopts the following specific solutions:

[0018] A chemical transformation method for preparing an engineered bacterium of Rhodobacter sphaeroides comprises the following steps:

[0019] (1) Activating the Rhodobacter sphaeroides host bacteria and conducting liquid culture: Selecting Rhodobacter sphaeroides that has been cultured in a solid culture medium in the dark for two to three days in good condition as the host bacteria, and reactivating the Rhodobacter sphaeroides host bacteria in a liquid culture medium until OD660 = 1.0 to 2.5. OD660 refers to the absorbance value of a solution at a wavelength of 600 nm.

[0020] (2) collecting the bacterial cells obtained in step (1) by centrifugation and subjecting them to chemical treatment to prepare competent cells;

[0021] (3) adding a plasmid carrying the target gene to the competent cells obtained in step (2);

[0022] (4) subjecting the product obtained in step (3) to heat shock treatment;

[0023] (5) The heat-shocked bacterial cells are transferred to a liquid culture medium for cultivation, and after cultivation, an engineered bacterial clone of Rhodobacter sphaeroides containing a plasmid carrying the target gene is obtained.

[0024] In some specific embodiments, the Rhodobacter sphaeroides host bacteria used in step (1) is Rhodobacter sphaeroides (strain deposit number CGMCC No. 7.275) or wild-type Rhodobacter sphaeroides (ATH2.4.1) (purchased from ATCC BAA-808).

[0025] In some specific embodiments, the chemical treatment in step (2) includes: pretreatment with a chemical agent that increases cell membrane permeability;

[0026] Preferably, the chemical treatment in step (2) comprises: pretreatment with one or two of the following reagents: β-mercaptoethanol, lithium acetate (LiAc), calcium chloride (CaCl2), dimethyl sulfoxide (DMSO), tris (hydroxymethylaminomethane) (Tris), ethylenediaminetetraacetic acid (EDTA) and dithiothreitol (DTT);

[0027] Preferably, the chemical treatment in step (2) comprises: pretreatment with Tris (pH 7.2)-DTT (dithiothreitol).

[0028] In some specific embodiments, the chemical treatment temperature of step (2) is 0 degrees Celsius to 42 degrees Celsius.

[0029] In some specific embodiments, the temperature of the heat shock treatment in step (4) is 35 degrees Celsius to 42 degrees Celsius.

[0030] In some specific embodiments, the plasmid in step (3) is a pIND4 plasmid or a pBBR1MCS2 plasmid, wherein:

[0031] The upstream primer of pIND4 plasmid is SEQ ID NO: 1, and the downstream primer of pIND4 is SEQ ID NO: 2;

[0032] The upstream primer of the pBBR1MCS2 plasmid is SEQ ID NO:3, and the upstream primer of the pBBR1MCS2 plasmid is SEQ ID NO:4.

[0033] In some specific embodiments, the size of the plasmid carrying the target gene added in step (3) is 3kb-15kb, and the amount of plasmid added is 0.5ug-1ug;

[0034] Preferably, the size of the plasmid carrying the target gene is 5 kb-11 kb.

[0035] In some specific embodiments, the liquid culture medium described in step (1) contains: (NH4)2SO4, Ajinomoto MSG, corn flour, KH2PO4, K2HPO4, glucose, MgSO4, NaCl, yeast extract, trace elements stock1 (0.1g / L CoCl2·6H2O, 3g / L MnSO4·H2O), FeSO4·7H2O.

[0036] In a second aspect, the present invention provides a method for identifying the positive rate of chemical transformation of an engineered bacterium of Rhodobacter sphaeroides, wherein the primer sequence used is:

[0037] The upstream primer sequence is SEQ ID NO: 7;

[0038] The upstream primer sequence is SEQ ID NO:8.

[0039] In a third aspect, the present invention provides Rhodobacter sphaeroides prepared using the method described above.

[0040] In a fourth aspect, the present invention provides a method for preparing coenzyme Q10:

[0041] (1) culturing the engineered Rhodobacter sphaeroides prepared by any of the methods disclosed in the present invention under conditions suitable for producing coenzyme Q10;

[0042] (2) Recovering coenzyme Q10 from the culture of the aforementioned engineered bacteria Rhodobacter sphaeroides. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Schematic diagram of primer design for removing the RshI restriction site from the pBBR1MCS2 plasmid in Example 3.

[0044] Figure 2 The electrophoresis diagram of the positive rate of the colony PCR verification clones in Example 4, wherein 1-8: randomly selected transformant clones; 9: negative control of Rhodobacter sphaeroides 2.4.1; 10: negative control of water as template. A: SD544 / pBBR1MCS2 / 35℃; B: SD544 / pBBR1MCS2 / 42℃; C: SD544 / pBota00793 / 35℃; D: SD544 / pBota00793 / 42℃; E: SD512 /

[0045] pBBR1MCS2 / 35℃; F: SD512 / pBBR1MCS2 / 42℃; G: ATH2.4.1 / pBota00793 / 35℃; H: ATH2.4.1 / pBota00793 / 42℃; B-11: SD544 negative control; E-9: ATH2.4.1 negative control; E-10: no template; F-9: pBBR1MCS2 positive control.

[0046] Figure 3 This is a statistical graph comparing the growth of transformant strains obtained by different transformation methods in Example 7, with the abscissa being the strain name and the ordinate being OD660.

[0047] Figure 4 This is a statistical chart comparing the yields of coenzyme Q10 in the transformant strains obtained by different transformation methods in Example 7, with the abscissa being the strain name and the ordinate being the yield of coenzyme Q10.

[0048] Figure 5 This is the result of introducing the pIND4 plasmid and the pBBR1MCS2 plasmid into the SD544 strain (strain deposit number CGMCC No.7.275) by the combined transformation method. The numbers in the figure represent the multiples and times of gradient dilution of Escherichia coli with Rhodobacter sphaeroides, i.e. 5-fold dilution, a total of 12 dilutions. DETAILED DESCRIPTION

[0049] In the present disclosure, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology and laboratory operation procedures used herein are terms and routine procedures widely used in the corresponding fields. At the same time, in order to better understand the present disclosure, the definitions and explanations of the relevant terms are provided below.

[0050] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0051] As used herein, the terms "comprising," "having," "including," and "containing" should be construed as open-ended terms (ie, meaning "including, but not limited to, ").

[0052] In this article, "and / or" refers to and includes any and all possible combinations of one or more items in the associated listed items. For example, a composition comprising A and / or B can be interpreted as a composition comprising A, a composition comprising B, or a composition comprising A and B.

[0053] All numerical designations, such as pH, temperature, time, concentration, and molecular weight, including ranges, are approximate and are optionally varied (+) or (-) in increments of 1.0 or 0.1, as appropriate, or by variations of + / -15%, 10%, 5%, 2%. It should be understood that all numerical designations are preceded by the term "about". It should also be understood that the agents described herein are exemplary only and that equivalents thereof are known in the art. When referring to measurable values ​​such as amounts or concentrations, the term "about" as used herein is meant to include variations within 20%, 10%, 5%, 1%, 0.5%, or 0.1% of the specified amount.

[0054] The term "vector" generally refers to a nucleic acid molecule that can self-replicate in a suitable host or a nucleic acid molecule that can insert a target gene fragment into a host genome, which transfers the target gene fragment carried into a host cell and / or between host cells. The vector may include a vector that is mainly used to insert DNA or RNA into a cell, a vector that is mainly used to replicate DNA or RNA, and a vector that is mainly used for the expression of transcription and / or translation of DNA or RNA. The vector also includes a vector with a variety of the above functions. The vector may be a polynucleotide that can be transcribed and translated into a polypeptide when introduced into a suitable host cell. Typically, the vector can produce a desired expression product by culturing a suitable host cell containing the vector.

[0055] The term "host cell" refers to a cell into which an exogenous nucleic acid has been introduced, including progeny of such cells. Host cells include "transformants" and "transformed cells", including primary transformed cells and progeny derived therefrom (regardless of the number of passages). The nucleic acid content of the progeny may not be exactly the same as that of the parent cell, but may contain mutations. Mutant progeny are included herein, and the mutant progeny have the same function or biological activity as screened or selected in the original transformed cell.

[0056] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0057] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific examples, and the advantages and features of the present invention will become clearer as the description progresses. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are carried out according to conventional conditions in the art, for example, Sambrook and Russeii et al., Molecular Cloning: Laboratory Manual (3rd Edition) (2001), the conditions described in CSHL Press, or according to the conditions recommended by the manufacturer. Unless otherwise stated, the experimental materials and reagents used in the following examples are all commercially available.

[0058] Example

[0059] Example 1: Construction of transformation vector

[0060] In order to develop a chemical transformation method for Rhodobacter sphaeroides, this embodiment provides a method for constructing a transformation vector for the invention of a chemical transformation method for Rhodobacter sphaeroides.

[0061] (1) Construction of transformation vector

[0062] In this example, plasmid pIND4 (synthesized by Shenzhen BGI Genomics Co., Ltd.) was used to construct the vector required for gene expression or plasmid pBBR1MCS2 (purchased from Addgene, plasmid

[0063] #85168) was used to construct the vector required for GFP expression. When constructing the plasmid, the above vector was used as a PCR template, and the linearized vector DNA fragment was amplified with the following primers:

[0064] Upstream and downstream primers for pIND4:

[0065] pIND4-F:GGCGCCGTGGTGCGG(SEQ ID NO:1)

[0066] pIND4-R:GCTAGACGGTATTTCACACCGCATATG(SEQ ID NO:2)

[0067] Upstream and downstream primers of pBBR1MCS2:

[0068] pBBR1MCS2-F:AATTGCGTTGCGCTCACTGCC (SEQ ID NO:3)

[0069] pBBR1MCS2-R:GCGTTAATATTTTGTTAAAATTCGCGTTAAATTT (SEQ ID NO:4)

[0070] use High-Fidelity 2X Master Mix was used for amplification.

[0071] PCR conditions were as follows: start: 98°C for 30 seconds; extension: 98°C for 10 seconds, 57°C for 10 seconds, 72°C for 30 seconds / kb, 30 cycles; final extension: 72°C for 30 seconds.

[0072] The amplified PCR product was digested with DpnI, and then the DNA was cleaned and recovered using the AxyPrep PCR cleaning kit. Finally, the concentration of the cleaned DNA fragments was measured by Nanodrop to obtain the transformation vectors pIND4 and pBBR1MCS2.

[0073] Plasmid inserts (eg, promoters, terminators, genes) are amplified using the same PCR method as linearized DNA.

[0074] All PCR templates were synthesized by BGI.

[0075] The primer information required for each plasmid to construct the insert fragment is as follows:

[0076] The linearized insert fragment and vector DNA fragment were inserted into the vector by Gibson assembly (https: / / www.nature.com / articles / nmeth.1318) The HiFiDNAAssembly (NEB E5520S) kit was used to connect different fragments to complete the target plasmid construction. The construction method was the method described in the kit instructions. The constructed plasmid was verified by BGI sequencing.

[0077] Example 2: Effect of different heat shock temperatures on chemical conversion efficiency

[0078] This example tests the effect of different heat shock temperatures on chemical conversion efficiency.

[0079] (1) Strain culture medium:

[0080] Liquid medium (1L): 5g (NH4)2SO4, 1g Ajinomoto MSG, 1g corn flour, 1g KH2PO4, 1g K2HPO4, 10g glucose monohydrate, 4g MgSO4·7H2O, 8g CaCO3, 4g NaCl, 25 2g yeast extract, 2mL trace element stock1 (0.1g / L CoCl2·6H2O, 3g / L MnSO4·H2O), 2.4g FeSO4·7H2O, adjust pH to 6.85-6.9 with 6M NaOH. If necessary, add corresponding antibiotics, such as 25mg kanamycin.

[0081] Solid culture medium (1L): 2.5g (NH4)2SO4, 1g Ajinomoto MSG, 2g corn flour, 0.5g KH2PO4, 0.5g K2HPO4, 10g glucose monohydrate, 1.5g MgSO4·7H2O, 2g NaCl, 10g yeast extract, 1mL trace element stock1 (0.1g / L CoCl2·6H2O, 3g / L MnSO4·H2O), 2.4g FeSO4·7H2O, adjust pH to 6.85-6.9 with 6M NaOH. Add 13g agar. Sterilize at 121 degrees Celsius for 15 minutes. If necessary, add corresponding antibiotics, such as 25mg kanamycin, when the temperature drops to about 60 degrees Celsius.

[0082] (2) Reagent preparation:

[0083] 500mM Tris (pH 7.2): Dissolve 39.4g Tris-HCl in 450mL ddH2O, adjust pH to 7.2 with 2M NaOH, then continue to add ddH2O to a final volume of 500mL

[0084] 100mM Tris (pH 7.2)-200mM CaCl2-15% glycerol: Dissolve 5.5g CaCl2 in 50mL 500mM Tris (pH 7.2), add 75mL water, and mix with an equal volume of 30% glycerol before use.

[0085] 100 mM Tris (pH 7.2) 40% PEG-6000: Add 20 g PEG-6000 to 30 ml 100 mM Tris (pH 7.2) until PEG is completely dissolved, then continue to add 100 mM Tris (pH 7.2) to a final volume of 50 mL and sterilize at 121 degrees Celsius for 20 minutes.

[0086] (3) Preparation of competent cells:

[0087] Colonies of Rhodobacter sphaeroides SD544 (strain collection number CGMCC No. 7.275) and wild-type Rhodobacter sphaeroides (ATH2.4.1) were picked from the plates and placed in 3 ml of liquid culture medium. Cultured overnight at 30 degrees Celsius and 200 rpm, and the OD660 value of Rhodobacter sphaeroides was recorded. 50 ml of new liquid culture medium was used to dilute the bacterial OD660 to 0.1, and cultured overnight at 30 degrees Celsius and 200 rpm until OD660 = 1.0-2.5.

[0088] Centrifuge the calcium carbonate to the bottom of the centrifuge tube at 4 degrees Celsius, 500 rpm, for 2 minutes, while the bacteria are still in suspension. Transfer the supernatant to a new centrifuge tube and centrifuge at 3500 rpm for 1 minute to collect the bacteria. Resuspend the cells with 30 mL of 500 mM Tris (pH 7.2) in an ice bath and place on ice for 30 minutes. Centrifuge at 3500 rpm for 5 minutes to collect the bacteria, resuspend the cells with 1.2 mL of 100 mM Tris (pH 7.2)-200 mM CaCl2-15% glycerol, and place on ice for 1 hour. The cells are competent cells.

[0089] (4) Chemical transformation:

[0090] Add 4ug pBBR1MCS2 plasmid to 50ul competent cells, mix well, add an equal volume of 100mMTris (pH 7.2) 40% PEG-6000, and mix gently. Place on ice for 10 minutes. Heat shock at 35 degrees Celsius and 42 degrees Celsius for 2 minutes, place at 32 degrees Celsius for 20 minutes, add 750uL liquid culture medium and incubate overnight. Resuspend cells and pipette 25ul transformation solution onto 25ug / ml Kan solid plate.

[0091] (5) Experimental results:

[0092] Under heat shock conditions of 35 degrees Celsius and 42 degrees Celsius, pBBR1MCS2 can be chemically transformed into Rhodobacter sphaeroides ATH2.4.1 and SD544 (strain collection number is CGMCC No.7.275). The heat shock temperature of 42 degrees Celsius has a higher transformation efficiency than the heat shock temperature of 35 degrees Celsius. For the ATH2.4.1 strain, the transformation efficiency at a heat shock temperature of 42 degrees Celsius is 3.6 times that of a heat shock temperature of 35 degrees Celsius. For SD544 (strain collection number is CGMCC No.7.275), the heat shock temperature is 42 degrees Celsius, and the transformation efficiency of pBBR1MCS2 reaches 3.5X10 4 , the results are shown in Table 1.

[0093] Table 1 Effect of heat shock temperature on chemical transformation efficiency

[0094] Plasmids Rhodobacter sphaeroides Heat shock temperature Number of transformants Transformation efficiency (CFU / ug) pBBR1MCS2 ATH2.4.1 35 24 1034 pBBR1MCS2 ATH2.4.1 42 82 3630 pBBR1MCS2 SD544 35 800 35400 pBBR1MCS2 SD544 42 820 36285

[0095] Example 3: Effect of RshI cleavage site (i.e. PvuI cleavage site) on chemical transformation efficiency of Rhodobacter sphaeroides

[0096] Lynn SP isolated and purified the type II restriction endonuclease RshI from Rhodopseudomonas sphaeroides ATH2.4.1 in 1979. The enzyme recognizes the 5'-CGATCG-3' site and cuts between T and C. References: Lynn SP, Cohen LK, Gardner JF, Kaplan S. Characterization of a site-specific restriction endonuclease from Rhodopseudomonas sphaeroides. J Bacteriol. 1979 May; 138(2): 505-9. doi: 10.1128 / jb.138.2.505-509.1979. PMID: 312287; PMCID: PMC218205. When DNA is transformed into Rhodopseudomonas sphaeroides, it may be recognized and cut by RshI, thereby destroying the integrity of the plasmid. Jun, D. After knocking out the RshI gene of Rhodobacter sphaeroides (which encodes the RshI restriction endonuclease), the pIND4 plasmid can be transformed into Rhodobacter sphaeroides by electroporation. Reference: Jun, D., Saer, RG, Madden, J. Det al. Use of new strains of Rhodobacters phaeroides and a modified simple culture medium to increase yield and facilitate purification of the reaction centre. Photosynth Res 120, 197–205 (2014).

[0097] https: / / doi.org / 10.1007 / s11120-013-9866-6.

[0098] There is one RshI recognition site on the pBBR1MCS2 plasmid, and it is necessary to determine whether the number of RshI recognition sites has an effect on the efficiency of chemical transformation.

[0099] (1) Target plasmid construction:

[0100] use High-Fidelity 2X Master Mix (DNA polymerase) was used to amplify the plasmid pBBR1MCS2 using primers oBota01423 / oBota01424. Figure 1 As shown, the PCR product was directly transformed into DH5a. The resulting clones were subjected to plasmid extraction to obtain plasmid pBOTA00793 without RshI recognition site.

[0101] oBota01423:gaagaggcccgcacagaccgcccttccca(SEQ ID NO:5)

[0102] oBota01424:ggtctgtgcgggcctcttcgctattacgcc(SEQ ID NO:6)

[0103] (2) Verification of plasmid construction results:

[0104] Randomly selected clones were subjected to Sanger sequencing to confirm that the RshI restriction site was removed while the amino acid sequence was not changed.

[0105] (3) Preparation of competent cells

[0106] Same as Example 2.

[0107] (4) Chemical transformation

[0108] Same as Example 2.

[0109] pBBR1MCS2 and pBOTA00793 were transformed into ATH2.4.1 and SD544 (strain deposit number is CGMCC No. 7.275) respectively. The number of clones obtained is shown in Table 2:

[0110] Table 2: Effect of RshI restriction site (i.e. PvuI restriction site) on chemical transformation efficiency of Rhodobacter sphaeroides

[0111]

[0112]

[0113] (5) Experimental results:

[0114] The results are consistent with those in Example 2, and the heat shock temperature of 42 degrees Celsius has a higher transformation efficiency. Based on the transformation results of ATH2.4.1 and SD544 (strain deposit number is CGMCC No.7.275), pBOTA00793 does not have a higher transformation efficiency than pBBR1MCS2. The results of this study indicate that the RshI restriction site recognition sequence does not affect the transformation efficiency in this patent.

[0115] Example 4: Chemical transformation positive rate identification

[0116] In Example 3, we transformed pBBR1MCS2 and pBOTA00793 into Rhodobacter sphaeroides ATH2.4.1 and SD544 (strain deposit number: CGMCC No. 7.275) by chemical transformation, and were able to obtain a considerable number of transformants.

[0117] In this example, cPCR was used to verify the positive rate of the transformants obtained in Example 3. The polymerase used for identification was 2x Taq (NoviZan, P111-01), the PCR system and procedure were in accordance with the instructions, and the primers used for identification were Bota-01366 / Bota-01367, and the primer sequences were:

[0118] Bota-01366:atgacagtgacctggacccc(SEQ ID NO:7)

[0119] Bota-01367:CGTGAGTGATGAAGGCCTTAGG(SEQ ID NO:8)

[0120] Verification results such as Figure 2 As shown, the transformants obtained under all conditions were positive.

[0121] Example 5: Optimization of culture medium, effects of different Tris treatment times and plasmid transformation amounts on chemical transformation efficiency of Rhodobacter sphaeroides

[0122] The liquid culture medium used for chemical transformation in Examples 2 and 3 contains calcium carbonate, which makes the culture medium turbid, making it difficult to detect OD660, and it is difficult to observe whether the culture medium is contaminated before inoculation. In addition, when performing the competent state, it is necessary to first centrifuge to remove calcium carbonate, and the operation steps are cumbersome.

[0123] The purpose of this example is to study the effect of the presence or absence of calcium carbonate in the liquid culture medium on the chemical transformation efficiency.

[0124] At the same time, this example explores the effects of Tris treatment time and plasmid transformation amount on the chemical transformation efficiency of Rhodobacter sphaeroides.

[0125] Except that the liquid culture medium was treated with or without calcium carbonate, 500 mM Tris (pH 7.2) for 0.5 h and 1 h, and the amount of plasmid added was 0.5 ug and 1 ug, the other steps were the same as in Example 2. The transformation plasmid was pBBR1MCS2, and the Rhodobacter sphaeroides host strain was SD544 (strain deposit number is CGMCC No. 7.275).

[0126] Experimental results:

[0127] Removing calcium carbonate from the liquid culture medium significantly improved the chemical transformation efficiency of Rhodobacter sphaeroides. The results are shown in Table 3.

[0128] Extending the Tris treatment time from 0.5 h to 1 h did not significantly improve the chemical transformation efficiency of Rhodobacter sphaeroides.

[0129] There is little difference in transformation efficiency between 0.5ug and 1ug plasmid. In most conditions (no calcium carbonate, 0.5h Tri treatment), 0.5ug plasmid actually yields more clones.

[0130] Table 3: Effects of calcium carbonate, Tris treatment time and plasmid transformation amount on chemical transformation efficiency of Rhodobacter sphaeroides

[0131]

[0132] Example 6: Effect of DTT treatment on chemical transformation efficiency of Rhodobacter sphaeroides

[0133] Compared with pBBR1MCS2, pIND4 plasmid has better plasmid stability. Without adding antibiotics, the plasmid survival rate of clones transformed with pIND4 plasmid was 100% after 160 stable passages. Under the same conditions, the plasmid survival rate of clones transformed with pBBR1MCS2 was only 60% after 100 passages, and the plasmid was completely lost after 150 passages. References: Inui M, Nakata K, Roh JH, Vertès AA, Yukawa H. Isolation and molecular characterization of pMG160, a mobilizable cryptic plasmid from Rhodobacter blasticus. Appl Environ Microbiol. 2003 Feb; 69 (2): 725-33. doi: 10.1128 / AEM.69.2.725-733.2003. PMID: 12570988; PMCID: PMC143669. Secondly, pIND4 has an IPTG inducible element. 0.1 mM IPTG induction can increase protein expression by about 300 times. This feature is particularly important for the expression of toxic proteins. Therefore, references: Ind AC, Porter SL, Brown MT, Byles ED, de Beyer JA, Godfrey SA, Armitage JP. Inducible-expression plasmid for Rhodobacter sphaeroides and Paracoccus denitrificans. Appl Environ Microbiol. 2009 Oct; 75(20): 6613-5. doi:

[0134] 10.1128 / AEM.01587-09.Epub 2009Aug 14.PMID:19684165; PMCID:PMC2765152.

[0135] As attached Figure 5 As shown, during the experiment, it was found that there were no transformants (engineered bacteria clones of Rhodobacter sphaeroides) when the pIND4 plasmid was transformed by combined transformation. According to Example 5, the transformation efficiency of pIND4 was only 272ug / CFU. In this example, Rhodobacter sphaeroides was treated with Tris (pH 7.2)-DTT (dithiothreitol) to explore the effect of DTT treatment of Rhodobacter sphaeroides on the transformation efficiency of pIND4.

[0136] The strain culture conditions were the same as those in Example 5 without calcium carbonate medium.

[0137] Preparation of 100mM Tris (pH7.2)-100mM DTT: weigh 0.77125g DTT and put it into 50mL 100mM Tris, pH7.2, and filter it with a 0.22um filter membrane for sterilization.

[0138] The strains of Rhodobacter sphaeroides are: ATH2.4.1, SD544 (the strain collection number is CGMCC No.7.275).

[0139] The transformation plasmids were pIND4 and pBBR1MCS2, and the transformation amount of plasmid was 1ug.

[0140] Collect the cells, resuspend them in 30mL 100mM Tris (pH 7.2)-DTT, and place them on ice for 1.0h, or at 30 degrees Celsius for 1.0h. Collect the cells at 3800 rpm for 5 minutes, and add 8ml of 100mM Tris (pH 7.2)-200mM CaCl2 -15% glycerol to resuspend the cells. Measure the OD660 of the cells and record it. The OD660 is between 12-14. The cells are competent cells of Rhodobacter sphaeroides. After 50ul aliquots, they can be frozen and stored in a -80 refrigerator for one year.

[0141] Place competent cells taken out of -80 freezer on ice for 30 minutes; after competent cells melt, add 10ul plasmid to different wells of 1.1ml deep-well plate, pipette several times to mix DNA and competent cells thoroughly. Add 60ul (equal volume) cold 100mM Tris (pH 7.2) 40% PEG-6000, and gently pipette to mix the two phases; place the cell-plasmid mixture on ice for 20 minutes. Heat shock at 42 degrees Celsius for 2 minutes, and put back on ice for 5 minutes. Add 800ul liquid culture medium and recover at 30 degrees Celsius overnight. Spread 25 microliters of transformation solution on the resistance plate. Culture at 30 degrees Celsius until clones appear.

[0142] The specific results are shown in Table 4:

[0143] The competent transformation pIND4 plasmid prepared by treating Rhodobacter sphaeroides with 100 mM Tris (pH 7.2) without DTT for 1 h had a transformation efficiency of only 272 CFU / ug.

[0144] The competent cells prepared by treating Rhodobacter sphaeroides with 100 mM Tris (pH 7.2)-DTT at 30 degrees Celsius for 0.5 h were used to transform pIND4, and the transformation efficiency was approximately ten times higher than that prepared by using 100 mM Tris (pH 7.2) without DTT treatment.

[0145] The competent transformation pIND4 prepared by treating Rhodobacter sphaeroides with 100 mM Tris (pH 7.2)-DTT at 4 degrees Celsius for 1 hour had a 59-fold increase in transformation efficiency compared to the competent transformation prepared with 100 mM Tris (pH 7.2) without DTT treatment.

[0146] The competent cells prepared by treating Rhodobacter sphaeroides with 100 mM Tris (pH 7.2)-DTT at 4 degrees Celsius for 0.5 h for transformation of pBBR1MCS2 had a transformation efficiency 1.76 times higher than that prepared by treating with 100 mM Tris (pH 7.2) without DTT.

[0147] Under optimal conditions, the efficiency of pIND4 plasmid transformation of Rhodobacter sphaeroides reached 16,048 CFU / ug;

[0148] The efficiency of transformation of Rhodobacter sphaeroides with pBBR1MCS2 plasmid reached 59,840 CFU / ug.

[0149] Table 4: Effect of DTT pretreatment on chemical transformation efficiency of Rhodobacter sphaeroides

[0150]

[0151]

[0152] Example 7: Comparison of Coenzyme Q10 Yields between Chemical Transformation and Binding Transformation

[0153] At present, the mainstream transformation method of Rhodobacter sphaeroides is combined transformation. This example studies the effect of Rhodobacter sphaeroides transformants obtained by chemical transformation and combined transformation on the production of coenzyme Q10.

[0154] The method for obtaining the transformants of Rhodobacter sphaeroides by chemical transformation is the same as that in Example 6.

[0155] The method for obtaining the transformants of Rhodobacter sphaeroides by combined transformation method is as follows:

[0156] The hemA gene was knocked out from Escherichia coli S17 strain (ATCC 47055) to obtain the hemA knockout Escherichia coli S17 strain (hereinafter referred to as S17 hemA^). The target plasmid was transformed into S17 hemA^.

[0157] The transformation process is as follows: add 2 μl of the target plasmid to 50 μl of S17 hemA^ competent medium, place on ice for 30 minutes, and then heat shock at 42°C and quickly place on ice for 2 minutes. Add 5-aminolevulinic acid (ALA) to 400 μl SOB medium to form a liquid culture medium containing 50 μg / ml 5-aminolevulinic acid; resuscitate at 37°C for 1 hour. Transfer 200 μl of the resuscitated bacterial liquid to 400 μl of liquid culture medium containing kanamycin (26 μg / ml) and 10 ALA (50 μg / ml), and culture at 37°C overnight. On the same day, pick a single clone of the sphaeroides Rhodobacterium strain and transfer it to 400 μl fermentation medium (see (4) Strain culture for detailed formula), and culture it at 30°C 800 rpm overnight. For the preparation method of SOB culture medium, see

[0158] https: / / cshprotocols.cshlp.org / content / 2018 / 3 / pdb.rec102723.full?rss ＝1 .

[0159] On the second day, measure OD600, wash the transformed S17hemA cultured overnight with LB (liquid medium) twice, and adjust OD600 to 0.4-0.6 with 15LB. Collect the Rhodobacterium sphaeroides (strain collection number is CGMCC No.7.275) by centrifugation. Adjust OD660 to 1.5 with LB. Dilute Escherichia coli with Rhodobacterium sphaeroides in a 5-fold gradient, then pipette 25ul of mixed bacteria onto a solid plate containing kanamycin, and culture at 30°C for 3-5 days until a single clone of the Rhodobacterium sphaeroides strain appears, and verify.

[0160] The examples explore the effects of chemically transformed clones and combined transformed clones on the production of coenzyme Q10.

[0161] The transformation hosts are: ATH2.4.1, SD544 (strain deposit number is CGMCC No.7.275). The transformation plasmids are: pBBR1MCS2 and pBOTA00793. The information of the transformed strains is shown in Table 5:

[0162] Table 5. Plasmid and strain information used to compare the performance of chemically transformed and conjugated transformed clones

[0163]

[0164]

[0165] (4) Coenzyme Q10 determination

[0166] ①Instrument:

[0167] Agilent 1290infinity II UHPLC System with DAD.

[0168] Centrifuge (Eppendorf, 5810R; Thermo, Multifuge X pro)

[0169] Oscillator (OHRUS and DM)

[0170] ②Chromatographic column:

[0171] Thermo Scientific Hypersil ODS(C18)Column,2.1x150 mm,3μm Cat#30103-152130

[0172] ③Chemical reagents:

[0173] CoQ10

[0174] Ethanol (EtOH), Sigma-Aldrich,

[0175] Methanol (MeOH), Sigma-Aldrich

[0176] Isopropyl alcohol (IPA), Sinopharm,

[0177] ④ Consumables

[0178] 2mL vials, Agilent

[0179] 50mL ampoule volumetric flask, thermo

[0180] 96-well deep well plate, A-gen

[0181] Microplate, 0.5mL, U, Agilent

[0182] ⑤Methods

[0183] Standard preparation

[0184] 1) Weigh 25.00 mg Coenzyme Q10 and 25.00 mg 4-hydroxybenzoic acid into a 50 ml ampoule.

[0185] 2) Make up to volume with isopropyl alcohol (IPA).

[0186] Calibration standard preparation

[0187] Dilute the standards to 10, 50, 100, 200, 300, 500 ppm with IPA and transfer to injection vials.

[0188] Sample preparation

[0189] Transfer 100 μl of R. sphaeroides culture to each well of a 96-well deep well plate. Add 500 μl of IPA to each well. Oscillate on a shaker at 2000 rpm for 20 minutes. Shake the plate on a shaker at 40°C, 800 rpm for 90 minutes. For fermentation samples, centrifuge at 6000 rpm / 10 minutes. Transfer 200 μl to a 0.5 ml Agilent microplate.

[0190] Analytical methods

[0191] Mobile phase B1: 1:1 EtOH / MeOH

[0192] Mobile phase A1: H2O

[0193] Injection volume 2μl

[0194] Pump cleaning: 10% IPA

[0195] Needle cleaning: 75% IPA

[0196] Column temperature: 55°C

[0197] Flow rate: 0.55ml / min

[0198] Wavelength: 275nm and 256nm

[0199] Table 6. Serial dilution

[0200] Time (min) A1(％) B1(％) 0 90 10 0.2 90 10 0.5 0 100 2 0 100 2.01 90 10 3 90 10

[0201] (5) Experimental results:

[0202] The experimental results are as follows Figure 3, indicating that there was no significant difference in bacterial growth and coenzyme Q10 production between the clones obtained by chemical transformation and the clones obtained by combination transformation.

[0203] Example 8: Application of high-throughput Rhodobacterium sphaeroides transformation method

[0204] The 20 plasmids in Table 7 were transformed into spheroid erythrocytes using the same method as in Example 6. The sizes of the transformed plasmids ranged from 5 kb to 11 kb, and the genes expressed by the plasmids were also different.

[0205] The specific steps are as follows:

[0206] Preparation of competent cells:

[0207] Pick monoclonal colonies of Rhodobacter sphaeroides SD544 (strain deposit number: CGMCC No. 7.275) from the plate and place them in 3 ml liquid culture medium. Culture overnight at 30 degrees Celsius, 200 rpm, and record the OD660 value of Rhodobacter sphaeroides. Dilute the bacterial OD660 to 0.1 with 50 ml of new liquid culture medium, and culture overnight at 30 degrees Celsius, 200 rpm until OD660 = 1.2-2.0.

[0208] Centrifuge at 3000 rpm for 5 minutes to collect the cells.

[0209] 7.2)-DTT resuspend cells, place on ice for 1 hour. Collect bacteria by centrifugation at 3500 rpm for 5 minutes at 4 degrees Celsius, resuspend cells with 8mL 100mM Tris (pH 7.2)-200mM CaCl2-15% glycerol, measure OD660 of bacteria and record, OD660 is between 12-14. If the density of bacteria is too high, adjust OD660. This cell is competent cell. Dispense competent cells into sterile eight-tube strips according to 50ul, store in a -80 degree Celsius refrigerator, this competent cell can be stored for about 1 year.

[0210] Conversion:

[0211] Add 1ug plasmid to 50ul competent cells, mix well, add an equal volume of 100mM Tris (pH7.2)-40% PEG-6000, and mix gently. Place on ice for 20 minutes. Heat shock at 42 degrees Celsius for 2 minutes, place on ice for 5 minutes, add 400ul liquid culture medium to a 96-well deep-well plate, and transfer the heat-shocked bacteria to the liquid culture medium. Incubate overnight at 800 rpm, and pipette 100ul of the transformation solution onto a 25ug / ml Kan solid plate.

[0212] Experimental results:

[0213] 20 plasmids were transformed into SD544 (strain deposit number CGMCC No.7.275) by chemical transformation, and the plasmid sizes ranged from 5kb to 11kb, and transformants were obtained, that is, 100% of the plasmids were able to obtain transformants by this method. Combined with the vector size, the method described in this example is applicable to the transformation of one or more target genes or expression cassettes below 12kb.

[0214] Table 7. High-throughput chemical transformation of 20 plasmids into Rhodobacter sphaeroides

[0215]

[0216]

[0217] Note: + represents the number of clones. If + is the number of clones in the single digit, ++ is the number of clones in the tens digit.

[0218] +++ represents clones in the hundreds, ++++ represents clones in the thousands, and +++++ represents clones in the tens of thousands; - represents no clones

[0219] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A chemical transformation method for preparing an engineered bacterium of Rhodobacter sphaeroides, comprising the following steps: (1) activating the Rhodobacterium sphaeroides host bacteria and conducting liquid culture; (2) collecting the bacterial cells obtained in step (1) by centrifugation and subjecting them to chemical treatment to prepare competent cells; (3) adding a plasmid carrying the target gene to the competent cells obtained in step (2); (4) subjecting the product obtained in step (3) to heat shock treatment; (5) The heat-shocked bacterial cells are transferred to a liquid culture medium for cultivation, and after cultivation, an engineered bacterial clone of Rhodobacter sphaeroides containing a plasmid carrying the target gene is obtained.

2. The chemical conversion method according to claim 1, wherein The Rhodobacter sphaeroides host bacteria used in the step (1) is Rhodobacter sphaeroides (strain collection number CGMCC No. 7.275) or wild-type Rhodobacter sphaeroides (ATH2.4.1) (purchased from ATCC BAA-808).

3. The chemical conversion method according to claim 1, wherein The liquid culture medium described in step (1) contains: (NH4)2SO4, Ajinomoto MSG, corn flour, KH2PO4, K2HPO4, glucose, MgSO4, NaCl, yeast extract, trace elements stock1 (0.1g / L CoCl2·6H2O, 3g / L MnSO4·H2O), and FeSO4·7H2O.

4. The chemical conversion method according to claim 1, wherein The chemical treatment in step (2) includes: pretreatment with a chemical reagent that can increase cell membrane permeability; Preferably, the chemical treatment in step (2) comprises: pretreatment with one or two of the following reagents: β-mercaptoethanol, lithium acetate (LiAc), calcium chloride (CaCl2), dimethyl sulfoxide (DMSO), tris (hydroxymethylaminomethane) (Tris), ethylenediaminetetraacetic acid (EDTA) and dithiothreitol (DTT); Preferably, the chemical treatment in step (2) comprises: pretreatment with Tris (pH 7.2)-DTT (dithiothreitol).

5. The chemical conversion method according to claim 1, wherein: The chemical treatment temperature of step (2) is 0 degrees Celsius to 42 degrees Celsius.

6. The chemical conversion method according to claim 1, wherein The plasmid in step (3) is pIND4 plasmid or pBBR1MCS2 plasmid, wherein: The upstream primer of pIND4 plasmid is SEQ ID NO: 1, and the downstream primer of pIND4 is SEQ ID NO: 2; The upstream primer of pBBR1MCS2 plasmid is SEQ ID NO:3, and the upstream primer of pBBR1MCS2 plasmid is SEQ ID NO:

4.

7. The chemical conversion method according to claim 1, wherein The size of the plasmid carrying the target gene added in step (3) is 3kb-15kb, and the amount of plasmid added is 0.5ug-1ug; Preferably, the size of the plasmid carrying the target gene is 5 kb-11 kb.

8. The chemical conversion method according to claim 1, wherein The temperature of the heat shock treatment in step (4) is 35 degrees Celsius to 42 degrees Celsius.

9. A method for identifying the positive rate of chemical transformation of Rhodobacter sphaeroides engineered bacteria, wherein: Primer sequences used: The upstream primer sequence is SEQ ID NO: 7; The upstream primer sequence is SEQ ID NO:

8.

10. An engineered bacterium of Rhodobacter sphaeroides obtained by any method described in claims 1-8.

11. Use of the engineered bacterium Rhodobacter sphaeroides according to claim 10 in producing coenzyme Q10.

12. A method for preparing coenzyme Q10, the method comprising: (1) culturing the engineered bacterium Rhodobacter sphaeroides according to claim 10 under conditions suitable for producing coenzyme Q10; (2) Recovering Coenzyme Q10 from the culture of engineered bacteria of Rhodobacter sphaeroides.

Images