Full-knockout mutants of first and second ACS genes in plant and application of full-knockout mutants

Abstract

The invention relates to the technical field of gene engineering, in particular to a first-class and second-class ACS gene complete knockout mutant in a plant and application thereof, the mutant does not have first-class and second-class ACS functional genes and only retains third-class ACS functional genes; when the gene mutant of the type is applied to plant breeding, the stress resistance of plants can be greatly improved, and the gene mutant has an important economic value for important crop ACS gene family function regulation and control and stress-tolerant new variety cultivation.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, in particular to a plant having a first type and a second type. ACS Gene knockout mutants and their applications. Background Art

[0002] Soil salinization refers to the process in which salt in the bottom soil or groundwater rises to the surface with capillary water, and after the water evaporates, the salt accumulates in the surface soil. Soil salinization has a serious impact on agricultural production. It will cause the soil quality to decline, affect the growth of crops, and even lead to reduced crop yields or failure to grow. Plant salt-alkali resistance refers to the ability of plants to adapt to and resist high salt and high alkalinity in the soil. Under alkaline stress, high pH values ​​will cause changes in osmotic potential in plants, imbalance in ion concentration, metabolic disorders in plants, and severe damage to cell membranes. These adverse factors will inhibit the growth and development of plants, and even directly lead to plant death.

[0003] Ethylene is one of the most important plant hormones in nature and the simplest olefin gas plant hormone. On the one hand, it can affect the growth and development of plants, including seed germination, leaf senescence, fruit ripening, etc. On the other hand, it can regulate the response of plants to various biological and abiotic stresses, including pathogen invasion, drought stress, cold stress, and salinity stress. The biosynthesis of ethylene follows the 1-aminocyclopropane-1-carboxylic acid (ACC)-dependent pathway, in which ACC synthase (ACS) catalyzes the formation of ACC from S-adenosylmethionine, which is the rate-limiting step. ACS are encoded by a multi-gene family and are divided into three categories based on the characteristics of the C-terminal sequence: the first type of ACS protein has a longer C-terminus and has two kinase phosphorylation sites, including three mitogen-activated protein kinase (MAPK) phosphorylation sites and one calcium-dependent protein kinase (CDPK) phosphorylation site; the second type of ACS protein has a shorter C-terminus than the first type and has only one CDPK phosphorylation site; the third type of ACS protein has the shortest C-terminus and has no identifiable phosphorylation site. There are 8 functional ACS proteins in the genome of the model plant Arabidopsis thaliana. ACS The genes are ACS2, ACS4, ACS5, ACS6, ACS7, ACS8, ACS9 and ACS11 , the above encoding has the function ACS The genes are divided into three categories. ACS include ACS2 and ACS6, the second category ACS include ACS4, ACS5, ACS8, ACS9 and ACS11 , the third category ACS include ACS7 . ACS How to adjust different types ACS The process of plant stress resistance response has not been reported. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems in the related art. To this end, the first object of the present invention is to provide a plant having a first type and a second type. ACS Gene knockout mutant; The second purpose of the present invention is to provide an application of a mutant.

[0005] In order to achieve the first purpose, the technical solution adopted by the present invention is: The first and second types in a plant ACS A knockout mutant lacking the first ACS and the second category ACS Functional genes, only the third category is retained ACS Functional genes.

[0006] In order to achieve the second purpose, the technical solution adopted by the present invention is: Application of a mutant, wherein the mutant is of the first and second types in the above-mentioned plant ACS A gene knockout mutant, wherein the application includes using the mutant for plant breeding.

[0007] Furthermore, the breeding includes using the mutant to cultivate seeds with improved plant resistance to stress.

[0008] Furthermore, the stress resistance includes improving the salt-alkali resistance of plants.

[0009] Furthermore, the breeding comprises the following steps: S1. Targeted knockout of plant classes I and II ACS Gene, construction of gene editing vector; S2, transforming the gene editing vector into Agrobacterium to obtain transformed Agrobacterium; S3. Obtain transgenic plants by transforming Agrobacterium to infect recipient plant explants or inflorescences, and obtain T0 generation seeds.

[0010] Furthermore, the plant in step S1 is Arabidopsis thaliana, and the target ACS8 Gene fragment I and ACS8 The nucleotide sequence between gene fragments II is shown in SEQ NO.1, and the targeting ACS11The nucleotide sequence after gene fragment II is shown in SEQ NO.2, and the simultaneous knockout ACS8 , ACS11 Dual-gene gene editing vector; In step S3, Arabidopsis CS16644 ( acs2 / acs4 / acs5 / acs6 / acs9) As receptor, transfer ACS8 and ACS11 Dual gene editing vector.

[0011] Further, ACS8 The nucleotide sequence of gene fragment I is shown in SEQ NO.3. ACS8 The nucleotide sequence of gene fragment II is shown in SEQ NO.4. ACS11 The nucleotide sequence of gene fragment I is shown in SEQ NO.5. ACS11 The nucleotide sequence of gene fragment II is shown in SEQ NO.6.

[0012] Furthermore, in step S1, ACS8 and ACS11 The primers used in the dual gene editing vector include AtACS8- DT1-BsF , AtACS8-DT1-F0, AtACS11-DT2-R0 and AtACS11-DT2-BsR ; AtACS8-DT1-BsF The nucleotide sequence from the 5' end to the 3' end is shown in SEQ NO.9; AtACS8-DT1-F0 The nucleotide sequence from the 5' end to the 3' end is shown in SEQ NO.10; AtACS11-DT2-R0 The nucleotide sequence from the 5' end to the 3' end is shown in SEQ NO.11; AtACS11-DT2-BsR The nucleotide sequence from the 5' end to the 3' end is shown in SEQ NO.12.

[0013] Furthermore, the breeding includes breeding of agricultural crops and horticultural crops.

[0014] Furthermore, the agricultural crops include one or more of rice, wheat, corn, cotton, soybean, rapeseed, potato, fruits and vegetables, and the horticultural crops include one or more of trees and flowers.

[0015] The above one or more technical solutions in the embodiments of the present invention have at least one of the following technical effects: The first and second categories provided by the present invention ACS A knockout mutant lacking the first ACS and the second category ACS Functional genes, only the third category is retained ACSFunctional gene. Taking the model plant Arabidopsis thaliana as an example, this type of mutant is seven mutants acs2 / acs4 / acs5 / acs6 / acs8 / acs9 / acs11 The results of the salt-alkali stress experiment showed that the germination rate of this type of gene mutant seeds under salt-alkali stress conditions was faster than that of wild-type seeds. The root length growth of WT plants was significantly inhibited by salt-alkali stress, while the root length growth of this type of gene mutant plants was almost not inhibited and was significantly higher than that of WT. In addition, the survival rate of this type of gene mutant plants was significantly higher than that of WT plants, indicating that this type of gene mutation can greatly improve plant salt-alkali resistance and is of great significance for important crops. ACS The regulation of family functions and the breeding of new salt-alkali tolerant varieties are of great value. At the same time, the present invention also provides the application of the above-mentioned gene mutants in plant breeding, which is expected to provide seeds with stress resistance for crop planting.

[0016] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The embodiment 1 of the present invention provides ACS8 Schematic diagram of the targeting sites.

[0018] Figure 2 The embodiment 1 of the present invention provides ACS11 Schematic diagram of the targeting sites.

[0019] Figure 3 The embodiment 1 of the present invention provides ACS8 and ACS11 Double gene editing vector ACS8 and ACS11 Map of gene editing sites.

[0020] Figure 4 The wild-type and gene mutant seeds provided in Experimental Example 1 of the present invention were cultured for 84 hours and the relationship between time and germination rate under saline-alkali treatment was shown.

[0021] Figure 5 This is a growth status diagram of the wild-type and gene mutant plants provided in Experimental Example 2 of the present invention after being treated with salt and alkali for 14 days.

[0022] Figure 6 This is a diagram of the root growth status of wild-type and gene mutant plants under salt-alkali treatment provided in Experimental Example 3 of the present invention. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. The following embodiments are used to illustrate the present invention, but cannot be used to limit the scope of the present invention.

[0024] In the following examples, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0025] A plant of the first and second categories ACS The first type of gene knockout mutant ACS and the second category ACS Functional genes, only the third category is retained ACS Functional gene. Taking the model plant Arabidopsis thaliana as an example, the mutation type is seven mutants acs2 / acs4 / acs5 / acs6 / acs8 / acs9 / acs11.

[0026] Example 1 (I) Category I and Category II ACS Construction of gene mutants.

[0027] Build for the first and second categories ACS Gene editing vectors, fully knocking out the first and second ACS gene, and only the third class is retained ACS The gene expression and trait mutants, taking the model plant Arabidopsis as an example, include the following steps: (1) ACS8&ACS11-pHEE401E Gene editing vector construction.

[0028] By targeting ACS8 The nucleotide sequence between gene fragment Ⅰ and gene fragment Ⅱ is shown in SEQ NO.1 and the target ACS11 The nucleotide sequence of the latter part of gene fragment II is shown in SEQ NO.2, and the simultaneous knockout ACS8 , ACS11 Gene editing vectors for dual genes, targeting sites such as Figure 1 and Figure 2 As shown; The nucleotide sequence of SEQ NO.1 from 5' to 3' is as follows: TTGGAAATTGGCTGCGTCG; The nucleotide sequence of SEQ NO.2 from 5' to 3' is as follows: TTCCCCATGAACTTCGCCA; Among them, BOX1 is gene fragment Ⅰ, and BOX2 is gene fragment Ⅱ; ACS8 The nucleotide sequence of gene fragment I is shown in SEQ NO.3. ACS8 The nucleotide sequence of gene fragment II is shown in SEQ NO.4. ACS11 The nucleotide sequence of gene fragment I is shown in SEQ NO.5. ACS11 The nucleotide sequence of gene fragment II is shown in SEQ NO.6.

[0029] The nucleotide sequence of SEQ NO.3 from 5' to 3' is as follows: CAAATGGGTCTAGCAGAAAATCAG; The nucleotide sequence of SEQ NO.4 from 5' to 3' is as follows: TTTCAAGATTATCATGGCCTT; The nucleotide sequence of SEQ NO.5 from 5' to 3' is as follows: CAAATGGGTCTTGCTGAAAACCAG; The nucleotide sequence of SEQ NO.6 from 5' to 3' is as follows: TTCCAAGATTACCATGGCTTG.

[0030] The targeting sgRNA sequences are as follows: ACS8 sgRNA (as shown in SEQ NO.7), the nucleotide sequence of SEQ NO.7 from 5' to 3' is as follows: TTTGGAAATTGGCTGCGTCGGGG; ACS11 sgRNA (as shown in SEQ NO.8), the nucleotide sequence of SEQ NO.8 from 5' to 3' is as follows: TTTCCCCATGAACTTCGCCATGG; Design primers based on sgRNA AtACS8-DT1-BsF (as shown in SEQ NO.9), AtACS8-DT1-F0 (as shown in SEQ NO.10) and AtACS11-DT2-R0 (as shown in SEQ NO.11), AtACS11-DT2-BsR (as shown in SEQ NO.12), perform PCR reaction according to the information provided under the PCR fragment sequence, pHEE401-2sgRNA The reaction mixture and reaction conditions constructed are as follows: The reaction system is as follows: 10×KOD plus buffer 5 μL <![CDATA[MgSO4(25 mM)]]> 3 μL dNTPs (2 mM, Toyobo) 4 μL KOD plus (Toyobo) 1 μL pCBC-DT1T2 (diluted 200 times) 1 μL SEQ NO.9(20 μM) 1 μL SEQ NO.10 (1 μM) 1 μL SEQ NO.11 (1 μM) 1 μL SEQ NO.12 (20 μM) 1 μL <![CDATA[ddH2O]]> 32 μL

[0031] The reaction process is as follows: Pre-denaturation at 94°C for 2 min; denaturation at 94°C for 15 s; annealing at 60°C for 30 s; extension at 68°C for 1 min, 30 cycles; final extension at 68°C for 5 min.

[0032] Relevant primer sequences in the reaction system: The nucleotide sequence of SEQ NO.9 from 5' to 3' is as follows: ATATATGGTCTCGATTGTTGGAAATTGGCTGCGTCGGTT; The nucleotide sequence of SEQ NO.10 from 5' to 3' is as follows: TGTTGGAAATTGGCTGCGTCGGTTTTAGAGCTAGAAATAGC; The nucleotide sequence of SEQ NO.11 from 5' to 3' is as follows: AACTGGCGAAGTTCATGGGGAACAATCTCTTAGTCGACTCTAC; The nucleotide sequence of SEQ NO.12 from 5' to 3' is as follows: ATTATTGGTCTCGAAACTGGCGAAGTTCATGGGGAACAA; The vector was digested with restriction endonuclease Bsa I produced by New England Biotechnology Co., Ltd. pHEE401E , and using T4 DNA ligase produced by New England Biotechnology Co., Ltd. AtACS8-CRISPR and AtACS11- CRISPR and pHEE401E Connect to obtain gene editing vector ACS8&ACS11-pHEE401E , the reaction system is specifically as follows: Purified PCR fragment (100 ng / μl) 2 μL pHEE401 (100 ng / μl) 2 μL 10×T4 DNA Ligase Buffer (NEB) 1.5 μL 10×BSA 1.5 μL Bsal restriction endonuclease (NEB) 1 μL T4 DNA Ligase (HC, NEB) 1 μL <![CDATA[ddH2O]]> 6 μL

[0033] The reaction procedure is: 37 ℃ 5h; 50 ℃ 5 min; 80 ℃ 10 min; The ligation product was transformed into competent E. coli DH5ɑ by heat shock method, and then spread on LB solid plate containing 50 μg / mL kanamycin and cultured at 37°C overnight. Single colonies were picked and PCR identified with primers U6-26p-F and U6-29p-R. The positive clone colonies were placed in a shaking tube for shaking. After shaking evenly, the restriction vector was extracted using the enzyme vector extraction kit (Axygen) and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing verification to obtain the correct ACS8&ACS11-pHEE401EGene editing vectors.

[0034] U6-26p-F (as shown in SEQ NO.13), the nucleotide sequence of SEQ NO.13 from 5' to 3' is as follows: TGTCCCAGGATTAGAATGATTAGGC; U6-29p-R (as shown in SEQ NO.14), the nucleotide sequence of SEQ NO.14 from 5' to 3' is as follows: AGCCCTCTTCTTTCGATCCATCAAC.

[0035] (2) Screening and identification of gene-edited Arabidopsis thaliana.

[0036] Using the constructed multi-gene editing vector ACS8&ACS11-pHEE401E Transform GV3101 Agrobacterium. The specific process is as follows: add 1 μg DNA to 200 μL Agrobacterium competent cells, place on ice for 30 min, then freeze with liquid nitrogen for 1 min, and then warm at 37 °C until thawed. Add 1 mL YEP liquid medium to the tube and culture at 28 °C for 4 h. Collect the bacteria by centrifugation and spread them on LB plates containing 50 μg / mL kanamycin, 25 μg / mL gentamicin and 25 μg / mL rifampicin, place them in a 28 °C incubator and culture them upside down. Pick a single colony and perform PCR identification using primers U6-26p-F and U6-29p-R. Shake the positive clones identified by PCR to OD 600 When the concentration is greater than 1.0, it is used for infection of Arabidopsis inflorescence.

[0037] The commercial Arabidopsis mutant CS16644 ( acs2 / acs4 / acs5 / acs6 / acs9) As the receptor, the multi-gene editing vector was transformed by Agrobacterium-mediated infection of Arabidopsis inflorescence to obtain the first and second types of ACS Gene knockout mutants.

[0038] The specific process of Arabidopsis inflorescence infection is as follows: centrifuge the transformed bacterial solution, collect the precipitate, and then resuspend the bacteria with the prepared transformation solution (10 mM 1 / 2MS, 2.5 mM MES, 5% sucrose, 1 mg / mL 6-BA). MES is the abbreviation of fatty acid methyl ester sulfonate, and 6-BA is the abbreviation of 6-Benzylaminopurine. Before infecting the Arabidopsis inflorescence, add SilwetL-77 (50 mL / L). SilwetL-77 is a highly efficient silicone surfactant that can greatly reduce the surface tension of water. The inflorescence part of Arabidopsis is fully contacted with the bacterial solution. After the infection is completed, it is first cultured in the dark for 24 hours, and then cultured under natural light conditions until the end of the growth cycle. After harvesting the T0 generation seeds, they are screened with hygromycin screening medium and combined with ACS8-F , ACS8-R and ACS11-F , ACS11-R Primers were used for genome PCR identification and sequencing was used to detect whether the editing site was edited and the editing form, and the edited T1 generation seeds were obtained. The edited plants with single peak homozygous editing sites were cultured and screened in soil. After maturity, T2 generation seeds were collected and spread on antibiotic-free 1 / 2 MS medium. After growing for 8 days under natural light conditions, seedlings were transplanted. After two weeks of soil culture, the genome was extracted and used Cas9-F and Cas9-R Primers were used for genomic PCR to identify whether the Cas 9 protein was isolated, and then the strains with isolated Cas 9 protein were harvested to obtain homozygous mutants for subsequent phenotypic observation and determination of various related indicators.

[0039] ACS8-F (as shown in SEQ NO.15), the nucleotide sequence of SEQ NO.15 from 5' to 3' is as follows: ATGGGTCTCTTGTCAAAGA; ACS8-R (as shown in SEQ NO.16), the nucleotide sequence of SEQ NO.16 from 5' to 3' is as follows: ATCTCAGCTCCGGTTCTCC; ACS11-F (as shown in SEQ NO.17), the nucleotide sequence of SEQ NO.17 from 5' to 3' is as follows: ATGTTGTCAAGCAAAGTTG; ACS11-R (as shown in SEQ NO.18), the nucleotide sequence of SEQ NO.18 from 5' to 3' is as follows: GGTTGGTTATGAGAACTCC; Cas9-F (as shown in SEQ NO.19), the nucleotide sequence of SEQ NO.19 from 5' to 3' is as follows: CTCGATCGGCCTCGATATTGG; Cas9-R (as shown in SEQ NO.20), the nucleotide sequence of SEQ NO.20 from the 5' end to the 3' end is as follows: CAATGAGATTCCCGAACAGGC; The specific method of genomic PCR is: sampling, extracting genomic DNA, and performing PCR amplification using ACS8-F, ACS8-R and ACS11-F, ACS11-R primers; the PCR amplification system is: 2×Taq PCR Mix (10μl), ddH2O (8μl), ACS8-F (10μmol / L, 0.5μL), ACS8-R (10μmol / L, 0.5μl), template DNA (1μl).

[0040] The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, for 30 cycles; final extension at 72°C for 10 min; and storage at 4°C.

[0041] Finally got the first category of knockout ACS and the second category ACS Functional genes, only the third category is retained ACS Functional gene acs2 / acs4 / acs5 / acs6 / acs8 / acs9 / acs11 Seven homozygous strains, among which ACS8 / ACS11 There are -1 and +1 mutations at the target site (sgRNA), such as Figure 3 As shown, leading to ACS8 Translation terminated prematurely at position 78 (470 amino acids in total), ACS11 Translation terminates prematurely at position 121 (461 amino acids in total). This mutation has no adverse effect on the normal growth and development of Arabidopsis. Gene-edited homozygous lines have -1 and -1 mutations at the target site, resulting in ACS8 and ACS11 The translation was terminated prematurely.

[0042] Experimental Example 1: Phenotype during germination period under salt-alkali stress.

[0043] Arabidopsis seeds containing gene mutants and wild-type Arabidopsis seeds were sterilized with 1% (v / v) NaClO for 2 min to 3 min, washed with sterile distilled water for 6 to 8 times, and planted on normal 1 / 2 MS medium and 1 / 2 MS medium containing 10 mM NaHCO3. After two days of dark treatment, they were placed in an Arabidopsis culture box under the conditions of 20°C to 22°C, long daylight (16 h light, 8 h dark), relative humidity of 60% to 70%, and light intensity of 90 μmol m -2 s -1 ~110 μmolm -2 s -1 The germination rate was counted every 12 hours. Microsoft Excel was used to count the germination rates of different materials and calculate their mean values ​​and standard errors. like Figure 4 The results showed that under normal growth conditions, there was no significant difference in the germination rate between wild type (WT) seeds and seeds containing gene mutants, while under saline-alkali stress conditions, the germination rate of this type of gene mutant seeds was faster than that of wild type seeds, indicating that the germination of Arabidopsis seeds containing gene mutants can tolerate saline-alkali stress.

[0044] Experimental Example 2: Salt-alkali stress survival rate experiment.

[0045] Arabidopsis seeds containing gene mutants and wild-type Arabidopsis seeds were sterilized with 1% (v / v) NaClO for 2-3 min, washed 6-8 times with sterile distilled water, and sown on normal 1 / 2 MS medium and 1 / 2 MS medium containing 10 mM NaHCO3. After two days of dark treatment, they were placed in an Arabidopsis incubator under the conditions of 20°C-22°C, long daylight (16 h light, 8 h dark), relative humidity of 60%-70%, and light intensity of 90-110 μmol m -2 s -1 After 14 days of growth, the survival rates of WT plants and plants containing gene mutants were counted. Figure 5 As shown; The results show that: Under normal culture conditions, there was no significant difference in the survival rate between WT plants and plants containing gene mutants. Under saline-alkali stress, the survival rate of this type of gene mutant plants was significantly higher than that of WT plants, showing obvious salt-alkali resistance.

[0046] Experimental Example 3: Root growth experiment under salt-alkali stress.

[0047] Arabidopsis seeds containing gene mutants and wild-type Arabidopsis seeds were sterilized with 1% (v / v) NaClO for 2–3 min, washed 6–8 times with sterile distilled water, and spread on 1 / 2 MS medium. After two days of dark treatment, the seeds were placed in an Arabidopsis incubator under the conditions of 20–22°C, long daylight (16 h light, 8 h dark), relative humidity of 60%–70%, and light intensity of 90–110 μmol m -2 s -1 After growing for 6 days, they were transferred to medium containing 0 and 3 mM NaHCO3, respectively, and the root length was counted every 1 day; Figure 6 The results showed that under normal culture conditions, there was no significant difference in root length between WT plants and plants containing gene mutants. However, under saline-alkali stress, the root length growth of WT plants was inhibited, while the root length growth of plants containing this type of gene mutants was almost not inhibited, and was significantly higher than WT, showing obvious salt-alkali resistance. Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The first and second types of a plant ACS A gene knockout mutant, characterized in that The mutant does not have the first type ACS and the second category ACS Functional genes, only the third category is retained ACS Functional genes.

2. An application of a mutant, characterized in that: The mutants are the first and second types in the plant according to claim 1 ACS A gene knockout mutant, wherein the application includes using the mutant for plant breeding.

3. The use of the mutant according to claim 2, characterized in that: The breeding includes cultivating seeds with improved plant stress resistance using the mutant.

4. The use of the mutant according to claim 3, characterized in that: The stress resistance includes improving the salt-alkali resistance of plants.

5. The use of the mutant according to claim 2, characterized in that: The breeding comprises the following steps: S1. Targeted knockout of plant classes I and II ACS Gene, construction of gene editing vector; S2, transforming the gene editing vector into Agrobacterium to obtain transformed Agrobacterium; S3. Obtain transgenic plants by transforming Agrobacterium to infect recipient plant explants or inflorescences, and obtain T0 generation seeds.

6. The use of the mutant according to claim 5, characterized in that: The plant in step S1 is Arabidopsis thaliana, and the target ACS8 Gene fragment I and ACS8 The nucleotide sequence between gene fragments II is shown in SEQ NO.1, and the targeting ACS11 The nucleotide sequence after gene fragment II is shown in SEQ NO.2, and the simultaneous knockout ACS8 , ACS11 Dual-gene gene editing vector; In step S3, Arabidopsis CS16644 ( acs2 / acs4 / acs5 / acs6 / acs9) As receptor, transfer ACS8 and ACS11 Dual gene editing vector.

7. The use of the mutant according to claim 6, characterized in that: ACS8 The nucleotide sequence of gene fragment I is shown in SEQ NO.

3. ACS8 The nucleotide sequence of gene fragment II is shown in SEQ NO.

4. ACS11 The nucleotide sequence of gene fragment I is shown in SEQ NO.

5. ACS11 The nucleotide sequence of gene fragment II is shown in SEQ NO.

6.

8. The use of the mutant according to claim 6, characterized in that: Step S1 builds ACS8 and ACS11 The primers used in the dual gene editing vector include AtACS8-DT1-BsF , AtACS8-DT1-F0, AtACS11-DT2-R0 and AtACS11- DT2-BsR ; AtACS8-DT1-BsF The nucleotide sequence from the 5' end to the 3' end is shown in SEQ NO.9; AtACS8-DT1-F0 The nucleotide sequence from the 5' end to the 3' end is shown in SEQ NO.10; AtACS11-DT2-R0 The nucleotide sequence from the 5' end to the 3' end is shown in SEQ NO.11; AtACS11-DT2-BsR The nucleotide sequence from the 5' end to the 3' end is shown in SEQ NO.

12.

9. The use of the mutant according to any one of claims 2 to 8, characterized in that: The breeding includes breeding of agricultural crops and horticultural crops.

10. The use of the mutant according to claim 9, characterized in that: The agricultural crops include one or more of rice, wheat, corn, cotton, soybean, rapeseed, potato, fruits and vegetables, and the horticultural crops include one or more of trees and flowers.

Images