Gene chip for predicting liver cancer illness risk as well as preparation method and use method of gene chip

Abstract

The invention provides a gene chip for predicting liver cancer disease risk, a preparation method and a use method thereof. The gene chip disclosed by the invention can be used for detecting 10 SNP (Single Nucleotide Polymorphism) sites related to the liver cancer disease risk, and the 10 SNP sites comprise rs11889341, rs1805377, rs886037672, rs2227472, rs1046282, rs4704853, rs1036199, rs10515746, rs4948488 and rs33954691. The detection sensitivity of the gene chip is greater than 80.45%, the specificity is greater than 88.37%, the characteristics of high throughput, simplicity in operation, accurate result and the like of the gene chip can be exerted, and the gene chip has important practical significance on related research and clinical application.

Description

[0001] The invention relates to a gene chip for predicting the risk of liver cancer, a preparation method and a use method, and belongs to the technical field of gene chip detection. Background Art

[0002] Primary liver cancer, usually referred to as liver cancer, refers to a malignant tumor that originates from stem cells or intrahepatic bile duct epithelial cells. The latest research shows that in China, its mortality rate is second only to lung cancer. Liver cancer has the characteristics of high incidence, high mortality, easy recurrence, and easy metastasis. However, most liver cancer patients have already developed to the late stage when diagnosed, and the prognosis is poor. Therefore, early diagnosis, early detection, and early treatment have become the prerequisites for the effective treatment of liver cancer.

[0003] The pathogenesis of liver cancer is extremely complex. Its occurrence, development and metastasis is a complex process with multiple factors and steps, which is closely related to mutations of multiple genes, abnormalities of cell signal transduction pathways and abnormal proliferation of blood vessels. Further exploration of the pathogenesis of liver cancer and understanding of its biological characteristics can lay the foundation for finding new liver cancer biomarkers and effective therapeutic targets.

[0004] At present, the diagnostic methods for liver cancer include histopathological diagnosis, exfoliative cytological diagnosis, immunopathological detection, molecular pathological detection and serological detection. For molecular pathological detection, commonly used technologies include ordinary PCR, fluorescent quantitative PCR, ARMS and other methods. However, these technologies are complicated to operate and cannot achieve simultaneous detection of multiple sites, and cannot meet clinical detection needs. Gene chip is a method that fixes a large number of probe molecules to a solid phase carrier and analyzes the sequence of DNA samples by using the characteristics of nucleic acid molecule hybridization pairing. It can be used for gene expression spectrum analysis, mutation detection, polymorphism analysis and other research work, and can detect multiple samples and individual sites at the same time. Summary of the invention

[0005] The present invention aims to solve the problems of complicated operation and single detection site in the prior art in detecting and predicting liver cancer risk sites, and provides a gene chip for predicting liver cancer risk and its preparation method and use method. Based on the characteristics of low cost, simple operation and high throughput of gene chips, the present invention can detect 10 liver cancer-related SNP sites at one time.

[0006] The first object of the present invention is to provide a gene chip for predicting the risk of liver cancer.

[0007] The second object of the present invention is to provide a method for preparing a gene chip for predicting the risk of liver cancer.

[0008] The third object of the present invention is to provide a method for using a gene chip for predicting the risk of liver cancer.

[0009] The present invention first screens out a group of SNP sites associated with the risk of liver cancer, and evaluates the predictive effectiveness of the screened SNP sites on the risk of liver cancer through a weighted genetic risk score model, and finally prepares a gene chip for predicting the risk of liver cancer, providing technical support for the early diagnosis and prediction of liver cancer.

[0010] The SNP sites are: rs11889341, rs1805377, rs886037672, rs2227472, rs1046282, rs4704853, rs1036199, rs10515746, rs4948488, and rs33954691.

[0011] The amplification primers and detection probes of the SNP sites are:

[0012] The gene chip comprises a solid phase carrier and the above-mentioned probe fixed on the solid phase carrier; The solid phase carrier is a glass sheet, a silicon sheet, a polypropylene membrane, a nitrocellulose membrane or a nylon membrane.

[0013] In a specific embodiment, the method for preparing the gene chip comprises the following steps: The solid support is pretreated by modifying the surface chemical groups; The 5' end of the probe is labeled so that the probe is covalently bound to the surface-modified solid phase carrier; Immobilizing the probe on a solid support; The solid phase carrier obtained in step (3) was dried and stored at 4°C.

[0014] The method for fixing the probe on the solid phase carrier is an in-situ synthesis method or a spotting method to fix the probe.

[0015] In a specific embodiment, the method for using the gene chip comprises the following steps: DNA extraction: extract DNA from the sample to be tested; PCR amplification: PCR amplification of sample DNA; Hybridization reaction: spotting the fluorescently labeled amplified product obtained in step (3) and the hybridization buffer onto the gene chip to perform a hybridization reaction; Scanning and result analysis: Place the gene chip after the reaction on a scanner for scanning, obtain hybridization signals and analyze the results.

[0016] The PCR amplification steps are: denaturation at 95°C for 5 minutes; 94°C for 30 seconds, 65°C for 60 seconds, and 72°C for 30 seconds, for a total of 30 cycles; extension at 72°C for 5 minutes; The hybridization reaction temperature is 40-55°C and the time is 50-70 minutes.

[0017] The hybridization buffer is specifically a 2× hybridization buffer, including 50% formamide, 10×SSC and 0.2% SDS.

[0018] In summary, this application has at least the following beneficial effects: Based on the high throughput advantage of gene chips, multiple SNP sites and multiple samples can be detected in just one experiment, which has important practical significance for research and clinical applications.

[0019] SNP is different from traditional biomarkers in that it has the advantages of good stability, easy detection, and non-invasiveness. The 10 SNP sites disclosed in the present invention have a prediction sensitivity of greater than 80.45% and a specificity of greater than 88.37% in the risk of liver cancer. DETAILED DESCRIPTION

[0020] The present application is further described in detail below with reference to the embodiments.

[0021] Example 1 Preparation of gene chip Design and screening of primers and probes First, 10 loci associated with the risk of liver cancer were identified, including rs11889341, rs1805377, rs886037672, rs2227472, rs1046282, rs4704853, rs1036199, rs10515746, rs4948488, and rs33954691. The relevant information of the above SNP loci was obtained from the NCBI gene SNP database (https: / / www.ncbi.nlm.nih.gov / snp / ), and the corresponding primers and probes were designed using Beacon Designer software (as shown in Table 1).

[0022] Table 1: PCR amplification primers and probes for the SNP sites to be detected

[0023] The probes in Table 1 were amino-modified at the 5' end.

[0024] Chip preparation The AD1500 gene chip spotter of Bio-Dot Company was used to perform spray spotting on the modified glass slide according to the computer preset program. The spotting temperature was 15℃-30℃, the humidity was 55%-65%, and the spotting volume was about 60nL. The gene chip after spotting was fixed in an 80℃ oven for 2h and then stored at 4℃ in the dark for later use.

[0025] Example 2 Detection of SNPs based on gene chips DNA extraction The DNA in the peripheral blood samples was extracted using the Qiagen DNA midi kit. The specific operation steps were carried out according to the instructions. The extracted DNA was measured for concentration using a NanoDrop ultraviolet spectrophotometer and then stored in a -80°C refrigerator.

[0026] 2. PCR Amplification The extracted DNA was amplified using multiplex PCR. The PCR amplification system is shown in Table 2.

[0027] Table 2

[0028] Among them, the ratio between the primers in the upstream primer set and the downstream primer set is 1:1:1:1:1:1:1:1:1.

[0029] PCR amplification conditions: denaturation at 95°C for 5 min; 30 cycles at 94°C for 30 s, 65°C for 60 s, and 72°C for 30 s; extension at 72°C for 5 min; 3. Fluorescent labeling of amplified products The PCR product obtained in step (ii) was used as a template for a second PCR, and Cy3 labeling was added. The second PCR reaction system is shown in Table 3.

[0030]

[0031] The labeled product was placed in a 65°C oven for drying.

[0032] 4. Hybridization reaction Preheat the hybridization box and hybridization solution at 42℃ for 15min, start adding samples in a dark environment, pipette hybridization buffer into the PCR reagent tube to dissolve the dried labeled product. Add an appropriate amount of ddH2O to the hybridization tank to keep it moist. Put in the chip with dots, then put in the cover glass, and add the dissolved labeled product to the corresponding cover glass hole. After adding, cover the hybridization box lid and put it in a water bath adjusted to 40℃ overnight.

[0033] After hybridization, wash the chip in chip washing solution. First, prepare chip washing solution A (1×SSC, 10% SDS), washing solution B (0.05×SSC), and washing solution C (95% ethanol). After preparation, wash the chip in washing solution A for 3 minutes, rinse with water, and then wash in washing solution B for 3 minutes, rinse with water, and then rinse in washing solution C for 2 minutes, blow dry, and place on the chip scanner for inspection.

[0034] 5. Scanning and result analysis The gene chip was scanned using Scan Array 4000 scanner, and the hybridization results were determined based on the hybridization signals of each probe.

[0035] Example 3 The corresponding relationship between liver cancer and SNP sites is shown in Table 4.

[0036]

[0037] Example 4: Validation test of SNP sites for predicting liver cancer risk Construction of a risk scoring model for liver cancer The SNP data and clinical information of 180 liver cancer tissues and 20 normal tissues were downloaded from the GEO database of the National Center for Biotechnology Information (NCBI).

[0038] The weight of each SNP site was obtained by fitting the logistic regression model based on the relevant data of the SNP sites obtained above, and a weighted genetic risk score model was constructed. The weighted genetic risk score model was used to assess the risk of the overall population sample, and the ROC curve was used to evaluate the predictive efficiency of the model to determine the predictive ability of the 10 SNP sites in this application for the risk of liver cancer.

[0039] The three genotypes of each SNP were scored as follows: wild homozygous type was 0 points, heterozygous type was 1 point, and homozygous mutant type was 2 points.

[0040] The weight of each SNP locus and the scores of the three genotypes of each SNP are obtained through the above Logistic regression model to construct a weighted genetic risk score model: Weighted genetic risk score model: rs11889341×0.524+rs1805377×0.472+rs886037672×0.569+rs2227472×0.388+rs1046282×0.341+rs4704853×0.572+rs1036199×0.437+rs10515746×0.486+rs4948488×0.364+rs33954691×0.636.

[0041] The ROC curve and the calculated AUC value were used to determine the predictive efficacy of the scoring model. The score used 80% AUC as the difference between high and low liver cancer risk, with a sensitivity of 80.45% and a specificity of 90.74%, indicating that the risk scoring model constructed using the 10 SNP sites has a good predictive efficacy for liver cancer risk.

[0042] Validation of the liver cancer risk scoring model Liver cancer tissues from 28 patients with liver cancer and liver tissues from 30 normal subjects were collected from clinical settings. The liver cancer and normal tissues in the present invention were obtained from hospitals and approved by the Medical Research Ethics Committee. All subjects signed informed consent forms.

[0043] The collected tissues were scanned by gene chip through the experimental steps described in Example 2 to obtain the final results.

[0044] According to the results obtained from the gene chip scanning, the weighted genetic risk score was obtained by the model described in Example 3, and the ROC curve and The AUC values ​​were calculated, and the obtained sensitivity was 83.68% and the specificity was 88.37%, which proved that the SNP site described in the present invention has an excellent clinical predictive effect.

[0045] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

Claims

1. A gene chip for predicting the risk of liver cancer, characterized in that: The gene chip comprises a solid phase carrier and probes fixed on the solid phase carrier for detecting 10 SNP sites related to predicting the risk of liver cancer. The 10 SNP sites are: rs11889341, rs1805377, rs886037672, rs2227472, rs1046282, rs4704853, rs1036199, rs10515746, rs4948488, and rs33954691.

2. The gene chip for predicting the risk of liver cancer according to claim 1, characterized in that: The probe sequences of the 10 SNP sites are: Locus rs11889341 Wild-type probe GAACATCTTATTCTTTTACCACTGCT, Mutation probe GAACATCTTATTTTTTTACCACTGCT; Locus rs1805377 Wild-type probe TTTGATTTTCTTTTCAGTTCTAGGCC, Mutation probe TTTGATTTTCTTTTCAATTCTAGGCC; Locus rs886037672 Wild-type probe GGTTGGTCTCATGTGCTCGAAATTTC, Mutation probe GGTTGGTCTCATGTGCTCAAAATTTC; Locus rs2227472 Wild-type probe ATATATACACAATGGAATACTATTCA, Mutation probe ATATATACACAATGGAAAACTATTCA; Locus rs1046282 Wild-type probe GGGAGAAACCCACAGCCCTTTGTTAG, Mutation probe GGGAGAAACCCACGGCCCTTTGTTAG; Locus rs4704853 Wild-type probe TCTCCCCTACCCCAAGAGGCTTTGGC, Mutation probe TCTCCCCTACCCCCAGAGGCTTTGGC; Locus rs1036199 Wild-type probe TGAAGTCTCTCTGCCGAGTCGGTGCA, Mutation probe TGAAGTCTCTCTGCAGAGTCGGTGCA; Locus rs10515746 Wild-type probe ACATTTACAGACCATAGCAACTCCCA, Mutation probe ACATTTACAGACCATTGCAACTCCCA; Locus rs4948488 Wild-type probe AATGTTTTAATGGCCAGAGCTAACTG, Mutation probe AATGTTTTAATGGCAAGAGCTAACTG; Locus rs33954691 Wild-type probe AGCTGCAGCACACATGCGTGAAACCT, Mutation probe AGCTGCAGCACACATGCATGAAACCT.

3. The gene chip according to claim 1 or 2, characterized in that: The solid phase carrier is a glass sheet, a silicon sheet, a polypropylene membrane, a nitrocellulose membrane or a nylon membrane.

4. The method for preparing a gene chip according to any one of claims 1 to 3, characterized in that: The preparation method of the gene chip comprises the following steps: The solid support is pretreated by modifying the surface chemical groups; Labeling the 5' end of the probe according to claims 1 to 3 so that the probe is covalently bound to the surface-modified solid phase carrier; Immobilizing the probe on a solid support; The solid phase carrier obtained in step (3) was dried and stored at 4°C.

5. The preparation method according to claim 4, wherein in step (3), the probe is fixed by an in-situ synthesis method or a spotting method.

6. Use of the gene chip according to any one of claims 1 to 3 in preparing a product for predicting the risk of liver cancer, characterized in that: The method of using the product comprises the following steps: DNA extraction: extract DNA from the sample to be tested; PCR amplification: PCR amplification of sample DNA; Hybridization reaction: spotting the fluorescently labeled amplified product obtained in step (3) and the hybridization buffer onto the gene chip to perform a hybridization reaction; Scanning and result analysis: Place the gene chip after the reaction on a scanner for scanning, obtain hybridization signals and analyze the results.

7. The use according to claim 5, characterized in that The PCR amplification steps in step (2) are as follows: denaturation at 95°C for 5 minutes; 94°C for 30 seconds, 65°C for 60 seconds, and 72°C for 30 seconds, for a total of 30 cycles; and extension at 72°C for 5 minutes.

8. The use according to claim 5, characterized in that The hybridization reaction temperature in step (3) is 40-55°C and the time is 50-70 minutes.

9. The use according to claim 5, characterized in that The hybridization buffer in step (3) is specifically 2× hybridization buffer, including 50% formamide, 10× SSC and 0.2% SDS.

Images