MiRNA marker kit for detecting multiple sclerosis and application of miRNA marker kit
By detecting the expression level of ebv-miR-BART13-3p, using fluorescence quantitative PCR technology, a simple and accurate diagnosis method for multiple sclerosis is provided, solving the problems of cumbersome and high cost of existing diagnostic methods, and achieving the correct Effective distinction between MS patients.
Patent Information
- Application Number
- CN202411437527.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-15
- Publication Date
- 2024-12-27
AI Technical Summary
The existing multiple sclerosis diagnosis methods are cumbersome, costly, and cannot be objectively quantified, and large-scale screening cannot be achieved, and there is a lack of simple and accurate diagnosis methods.
Using ebv-miR-BART13-3p as a biomarker, the expression level of ebv-miR-BART13-3p is detected by extracting exosomes from plasma, extracting RNA, synthesizing cDNA and using fluorescence quantitative PCR to provide multiple sclerosis. Diagnostic diagnostic kit.
The area under the curve of ebv-miR-BART13-3p is 0.82, demonstrating that it can be used as a biomarker of multiple sclerosis, significantly distinguishing between healthy controls and MS patients, providing a simple and accurate diagnosis method.
Smart Images
Figure CN119193808A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of multiple sclerosis diagnosis, and in particular relates to a miRNA marker kit for detecting multiple sclerosis and an application thereof. Background Art
[0002] Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system (CNS) that occurs in young adults. Recent studies have shown that MS is an autoimmune disease characterized by demyelinating lesions in the white matter of the central nervous system. It is an autoimmune process caused by the interaction of genetically susceptible individuals with environmental factors, and may be related to viral infection, immune regulation disorders, genetic factors, and environmental factors.
[0003] Currently, the diagnosis of MS mainly relies on the knowledge of the subject's clinical history, MRI examination of the brain and spinal cord, and CSF analysis. MRI is usually used to observe MS lesions in the body. It lacks specificity in the early stages of the disease, requires large instruments and is expensive. CSF immunological examinations such as OB provide evidence of damaged immune or inflammatory responses, but this result is not specific to MS. Other central demyelinating diseases such as neuromyelitis optica or other chronic infections may also occur and cannot be effectively distinguished. Although the McDonald criteria have significantly shortened the diagnosis time, the complexity and cumbersomeness of its diagnostic classification scheme and MRI criteria limit its use in daily practice. In general, the current diagnostic methods are cumbersome and costly, rely on the experience of relevant professionals, cannot be objectively quantified, and cannot be screened on a large scale, which is not conducive to clinical popularization. A simple and accurate method is urgently needed. Summary of the invention
[0004] The purpose of the present invention is to provide a biomarker for diagnosing multiple sclerosis.
[0005] The present invention provides application of a biomarker ebv-miR-BART13-3p in preparing a kit for detecting multiple sclerosis.
[0006] It is further defined that the ebv-miR-BART13-3p sequence is as shown in SEQ ID NO.3.
[0007] It is further defined that the application includes:
[0008] (1) Extraction of exosomes from plasma;
[0009] (2) Extraction of RNA from exosomes;
[0010] (3) ebv-miR-BART13-3p cDNA synthesis in exosomes;
[0011] (4) Detect the expression level of ebv-miR-BART13-3p.
[0012] It is further defined that the primer sequences for detecting the biomarker ebv-miR-BART13-3p in step (3) are as shown in SEQ ID NO.1 and SEQ ID NO.2.
[0013] It is further defined that the detection method in step (3) is fluorescence quantitative PCR.
[0014] The present invention provides a multiple sclerosis diagnostic reagent, wherein the reagent is a primer for detecting a biomarker ebv-miR-BART13-3p.
[0015] It is further defined that the primer sequences for detecting the biomarker ebv-miR-BART13-3p are shown in SEQ ID NO.1 and SEQ ID NO.2.
[0016] The present invention provides a kit for detecting the biomarker ebv-miR-BART13-3p, and the kit comprises the above-mentioned diagnostic reagent.
[0017] It is further defined that the kit also includes 10×PCR buffer, MgCl 2 , dNTP mixture and TaqDNA polymerase.
[0018] The present invention provides the above-mentioned multiple sclerosis diagnostic reagent or the above-mentioned multiple sclerosis diagnostic kit, wherein the detection sample includes exosomes.
[0019] Beneficial effect: The average concentrations of ebv-miR-BART13-3p in healthy controls and MS patients were 65.33±11.62fmol / l and 100.95±12.50fmol / l, respectively. The area under the curve of ebv-miR-BART13-3p was 0.82 (95% confidence interval 0.66-0.99), which proved that ebv-miR-BART13-3p can be used as a biomarker for MS. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 Scatter plot of the absolute concentration of ebv-miR-BART13-3p in circulating exosomes; HC: healthy control; MS: multiple sclerosis; P value was obtained by Student t test;
[0021] Figure 2ROC curve analysis of the absolute concentration of ebv-miR-BART13-3p in circulating exosomes; AUC: area under the ROC: area under the ROC curve; CI: confidence interval, confidence interval. DETAILED DESCRIPTION
[0022] Example 1.
[0023] 1. Extraction of plasma exosomes: Extraction of plasma exosomes by polymer precipitation method (kit method)
[0024] The polymer precipitation method is a widely recognized method for extracting exosomes. Its principle is to use chemical reagents to combine with exosomes and co-precipitate, so as to obtain exosomes with sufficient purity for detection. Its advantage is high extraction efficiency, and sufficient exosomes for detection can be extracted from plasma samples <1ml, which is suitable for the study of exosome miRNA expression; its disadvantage is that the extraction purity is slightly lower than that of ultracentrifugation. In this study, the Total exosome isolation reagent (plasma) kit was used to extract plasma exosomes from independent samples for the detection of EBV-miRNA. The steps are briefly described as follows:
[0025] (1) The plasma sample was centrifuged at 2000 g and 20°C for 10 min to remove residual cell debris, and the supernatant was aspirated into a new tube;
[0026] (2) Centrifuge at 10,000 g, 20°C for 10 min and transfer the supernatant to a new tube;
[0027] (3) Take a certain amount of plasma (e.g. 400 μl) and mix with 0.5 times the volume of 1× PBS solution and shake well;
[0028] (4) Add 0.05 times the volume of plasma proteinase K, mix well and bathe in 37°C water for 10 min;
[0029] (5) Add 0.2 times the total volume (plasma + PBS) of exosome precipitation reagent, mix well and let stand at 4°C for 30 min;
[0030] (6) Centrifugation at 10,000 g, 20°C, for 5 min;
[0031] (7) Carefully aspirate and discard the supernatant. Resuspend the exosome pellet with an appropriate amount of 1× PBS solution (50 μl or 100 μl) and use it for subsequent experiments as soon as possible.
[0032] 2. qRT-PCR detection of EBV-miRNA in circulating exosomes by independent samples
[0033] Plasma exosomes from acute MS patients and healthy controls were extracted, and ebv-miR-BART13-3p was detected by independent sample qRT-PCR (forward primer: GGGACGTGTAACTTGCCAGG (SEQ ID NO.1); reverse primer: CAGTGCAGGGTCCGAGGTAT (SEQ ID NO.2)). The obtained Ct value was substituted into the corresponding working curve to calculate the absolute concentration of the miRNA in circulating exosomes. The results showed that the expression level of ebv-miR-BART13-3p in plasma exosomes of acute MS patients (n=14) was significantly higher than that of healthy controls (n=14).
[0034] The mature sequence of ebv-miR-BART13-3p is 5′-UGUAACUUGCCAGGGACGGCUGA-3′ (SEQ ID NO. 3).
[0035] 1. Extraction of total exosome RNA
[0036] The TRIzol-isopropanol precipitation method was used to obtain RNA for detection. The steps are briefly described as follows:
[0037] (1) Add 1 ml of TRIzol to the exosome precipitate in a 1.5 ml Eppendorf tube and mix with a Vortex until fully homogenized;
[0038] (2) Add chloroform (200 μl) with 1 / 5 the volume of TRIzol, cover tightly and mix thoroughly with a Vortex for 30 seconds, and let stand at room temperature for 5-10 minutes;
[0039] (3) Centrifugation at 16,000 g, 20°C, for 10 min;
[0040] (4) Carefully transfer the supernatant into a new 1.5 ml Eppendorf tube and add an equal volume of isopropanol.
[0041] Vortex to mix;
[0042] (5) Place upright in a -20°C refrigerator for at least 2 h;
[0043] (6) Centrifugation at 16,000 g for 15 min at 4 °C;
[0044] (7) Carefully discard the supernatant, add 1 ml of pre-cooled 75% anhydrous ethanol (prepared with DEPC water), and gently shake to wash;
[0045] (8) Centrifuge again at 16,000 g, 4°C for 15 min;
[0046] (9) Carefully discard the supernatant and place it upside down on absorbent paper to dry;
[0047] (10) Add 20 μl of DEPC water to dissolve the precipitate. After it is fully dissolved, place it in a -80°C refrigerator for later use.
[0048] 2. Reverse transcription reaction
[0049] The purpose of reverse transcription is to use reverse transcriptase and specific primers to reverse miRNA 1:1 into complementary cDNA (complementary DNA) for subsequent PCR amplification and quantitative detection.
[0050] (1) The reaction system is as follows: DEPC water 3.5 μl, 5×AMV buffer 2.0 μl, dNTP mixture 1.0 μl, AMV enzyme 0.5 μl, Taqman reverse transcription primer 1.0 μl, RNA stock solution 2.0 μl,
[0051] (2) The reaction condition parameters of reverse transcription are set as follows:
[0052] 1) 16℃ for 30min;
[0053] 2) 42°C for 30 min;
[0054] 3) 85℃ for 5min;
[0055] 4)4℃hold.
[0056] 3. qRT-PCR reaction
[0057] (1) The 20 μl qRT-PCR reaction system was prepared as follows: 14.77 μl double-distilled water, 2.0 μl 10× PCR buffer (without Mg2+), 1.2 μl MgCl2, 0.4 μl dNTP mixture, 0.3 μl Taq DNA polymerase, 0.33 μl Taqman primers + probes, 1.0 μl cDNA stock solution;
[0058] (2) The qRT-PCR reaction condition parameters were set as follows:
[0059] 1) 95℃5min;
[0060] 2) 95℃ for 15s;
[0061] 60℃1min;
[0062] Step 2) Repeat 40 times
[0063] 3)40℃hold.
[0064] 4. qRT-PCR analysis
[0065] (1) Result reading: Ct (cycle threshold) is the cycle threshold, which is the number of cycles when the qRT-PCR reaction reaches a certain fluorescence threshold. The threshold is set within the exponential phase of the amplification curve. In this study, all Ct values were read based on the same PCR instrument at the same set threshold, and the average value of three parallel reactions was used. At the same time, a template-free negative control with the same reaction conditions was set for each EBV-miRNA detection, and its PCR curve and Ct value were analyzed to determine the expression of the EBV-miRNA.
[0066] (2) Relative quantitative analysis: The expression of U6 snRNA (U6 forward primer: CTCGCTTCGGCAGCACATA (SEQ ID NO.4); reverse primer: CGAATTTGCGTGTCATCCT (SEQ ID NO.5)) is relatively stable and is often used as an internal reference gene for relative quantification of exosomes, serum and cell miRNA in research. In this study, U6 snRNA was used as an internal reference gene for relative quantification in the expression of EBV-miRNA in mixed plasma extracted by ultracentrifugation. While determining the Ct value of miRNA in RNA samples, the Ct value of U6 snRNA expression was also detected. 2 -ΔΔCt The expression levels of miRNA in samples were compared by the method. In short, ΔCt = CtmiRNA-CtU6; ΔΔCt = [(CtmiRNA-CtU6) experimental group-(CtmiRNA-CtU6) control group]; the relative content of miRNA expression in the experimental group is expressed as 2 -ΔΔCt .
[0067] (3) Absolute quantitative analysis: The actual concentration of circulating exosomal EBV-miRNA was calculated using the working curve. First, the artificially synthesized EBV-miRNA single-stranded RNA mimics were diluted in equal proportions, and after reversal, the Ct values at different concentrations were detected in the same system to calculate the linear range of the detection and the working curve formula. Furthermore, the Ct value of the actual detected EBV-miRNA was substituted into the formula, corrected by the plasma volume, and the actual concentration of plasma exosomal EBV-miRNA was calculated.
[0068] ROC curve can be used to analyze the accuracy of a certain indicator in distinguishing the disease group from the control group. By analyzing and comparing multiple diagnostic indicators of the disease, it is helpful to evaluate the effect of diagnosis. The area under the curve (AUC) is in the range of 0 to 1, where 1 ≥ AUC > 0.5 indicates that the indicator has the effect of distinguishing the two groups. The closer the AUC is to 1, the better the effect of distinction. In this study, the absolute concentrations of circulating exosomes ebv-miR-BART13-3p in acute MS and healthy controls were used to draw ROC curves and calculate their areas under the curves.
[0069] The results are as follows Figure 1 As shown in Figure 2, the average concentrations of ebv-miR-BART13-3p in healthy controls and MS patients were 65.33±11.62fmol / l and 100.95±12.50fmol / l, respectively. Figure 2 As shown: The area under the curve of ebv-miR-BART13-3p was 0.82 (95% confidence interval 0.66-0.99).
Claims
1. Application of a biomarker ebv-miR-BART13-3p in the preparation of a kit for detecting multiple sclerosis.
2. The use according to claim 1, characterized in that: The ebv-miR-BART13-3p sequence is shown as SEQ ID NO.
3.
3. The use according to claim 1 or 2, characterized in that: The applications include: (1) Extraction of exosomes from plasma; (2) Extraction of RNA from exosomes; (3) ebv-miR-BART13-3p cDNA synthesis in exosomes; (4) Detect the expression level of ebv-miR-BART13-3p.
4. The use according to claim 3, characterized in that: The primer sequences for detecting the biomarker ebv-miR-BART13-3p in step (3) are shown in SEQ ID NO.1 and SEQ ID NO.
2.
5. The use according to claim 3, characterized in that: The detection method in step (3) is fluorescence quantitative PCR.
6. A multiple sclerosis diagnostic reagent, characterized in that: The reagent is a primer for detecting the biomarker ebv-miR-BART13-3p.
7. The diagnostic reagent according to claim 6, characterized in that The primer sequences for detecting the biomarker ebv-miR-BART13-3p are shown in SEQ ID NO.1 and SEQ ID NO.
2.
8. A kit for detecting the biomarker ebv-miR-BART13-3p, characterized in that: The kit comprises the diagnostic reagent of claim 6.
9. The kit according to claim 8, characterized in that The kit also includes 10×PCR buffer, MgCl2, dNTP mixture and Taq DNA polymerase.
10. The multiple sclerosis diagnostic reagent according to claim 6 or 7 or the multiple sclerosis diagnostic kit according to claim 8 or 9, characterized in that: The samples tested include exosomes.