CLOCK gene SNP (Single Nucleotide Polymorphism) molecular marker related to feed conversion rate of yellow feather broilers and application of CLOCK gene SNP molecular marker

Abstract

The invention discloses a yellow feather broiler feed conversion rate related CLOCK gene SNP molecular marker and application thereof, and belongs to the technical field of animal genetic breeding and molecular biology. The polymorphism of the SNP molecular marker is G / A, the SNP molecular marker is located at the 5903440th basic group of the chicken chromosome 27 CLOCK gene, and the RS number is rs315082113. The polymorphism of the SNP molecular marker provided by the invention is significantly related to the chicken feed conversion rate character, can be applied to selection of character chicken flocks with low feed conversion rate, improves the efficiency of the broiler chicken industry, provides convenience and technical support for rapid breeding of broiler chickens with low feed conversion rate, can effectively reduce the feed cost in the production process, and has good economic benefits. And economic benefits and competition of enterprises are improved.

Description

Technical Field

[0001] The invention relates to the technical field of animal genetic breeding and molecular biology, and in particular to a CLOCK gene SNP molecular marker associated with the feed conversion rate of yellow-feathered broiler chickens and an application thereof. Background Art

[0002] China is a major poultry country. As an important component of agriculture, the poultry industry undertakes the important task of supporting the daily diet of most residents in my country. Reducing feed conversion rate is very important for improving economic benefits. Mining and utilizing genes related to feed conversion rate is of great significance to chicken production management. How to reduce the feed conversion rate of poultry is one of the key issues in the field of poultry breeding.

[0003] Skeletal muscle has very important physiological functions in animals, such as supporting the body, protecting internal organs, promoting blood circulation, and maintaining movement. Its function and quantity deficiency will cause metabolism and lead to decreased immunity, leading to the occurrence of a series of myogenic diseases. For meat animals, skeletal muscle is the largest edible tissue in the animal carcass, and its quantity and quality directly determine the economic value of the animal. The development of skeletal muscle is regulated by multiple genes, and finding genes that promote skeletal muscle development is of great significance to improving the economic value of animals. Cai et al. found that long noncoding RNA MYH1G-AS inhibits myoblast differentiation, drives the conversion of slow muscle fibers to fast muscle fibers, and causes muscle atrophy. After MYH1G-AS was knocked out, muscle mass increased and muscle fibers enlarged. On the contrary, MYH1G-AS overexpression reduced gastrocnemius muscle mass and reduced muscle fiber size. The CLOCK gene can inhibit the expression of MYH1G-AS, alleviate the muscle mass decline caused by it, and promote skeletal muscle development. Therefore, the CLOCK gene can be used as a candidate gene for chicken feed conversion rate breeding. At present, the SNP molecular markers of the CLOCK gene related to the feed conversion rate of yellow-feathered broilers have not been developed and utilized. Summary of the invention

[0004] In order to solve the above technical problems, the purpose of the present invention is to provide a CLOCK gene SNP molecular marker related to the feed conversion rate of yellow-feathered broiler chickens and its application, so as to solve the problem of the existing lack of SNP molecular markers related to the feed conversion rate of chickens and the screening and breeding of broilers with low feed conversion rate through SNP molecular markers related to the feed conversion rate of chickens.

[0005] The technical solution of the present invention to solve the above technical problems is as follows:

[0006] A CLOCK gene SNP molecular marker associated with the feed conversion rate of yellow-feathered broilers, the SNP molecular marker polymorphism is G / A, is located at the 5903440th base of the CLOCK gene on chicken chromosome 27, and the RS number is rs315082113.

[0007] Furthermore, the sequence of the SNP molecular marker is shown in SEQ ID NO. 1, R is a G>A mutation site, and when R is G, it is a yellow-feathered broiler with low feed conversion rate;

[0008] SEQ ID NO.1: 5'-AGGATTAAGTCCCAGTGTTCTCTGTTCAGCTGTC AGCCAGGAGAGGAGCATTCTCTGACATACAAGTAGTGACCAAGGCTCTGAATATTTCTGCCTGTCAAATCTTCAGCTAATTCGAGCGCTGTATATTTAGCATCCATGAGCAGAAAAATGAAAGCTTTTGGTTATCAGTAGCTTTTGGGGACATCATAAATACTGAGRCACCGAGTTCTAATCATT TTCTTGACACTTTTTTATCACGCAGGTTCATAGCCAAGAACATTATGAAGCTGCAGCGCCTGGGGATAACCCATGTTCTGAATGCAGCAGAGGGGAAGTCATTCATGCATGTGAACACTAATGCAGAATTCTATGAAGGCACAGGCATCACATACCATGGCATTAAAGCTAACGATACGCAGG-3'.

[0009] A primer combination for amplifying the above-mentioned SNP molecular marker, comprising a forward primer as shown in SEQ ID NO.2 and a reverse primer as shown in SEQ ID NO.3;

[0010] SEQ ID NO.2: 5'-TCCCAGTGTTCTCTGTTCAGCT-3';

[0011] SEQ ID NO. 3: 5'-ATCGTTAGCTTAATGCCATGGT-3'.

[0012] A kit for the above-mentioned SNP molecular marker comprises the above-mentioned primer combination.

[0013] Application of the above-mentioned SNP molecular marker or primer combination or kit in screening yellow-feathered broilers with low feed conversion rate.

[0014] A method for screening yellow-feathered broilers with low feed conversion rate, comprising the steps of amplifying and sequencing the SNP molecular markers using PCR technology, screening individuals with the SNP molecular marker genotype of GG as breeder chickens, and increasing the frequency of the SNP molecular marker genotype of GG generation by generation to obtain yellow-feathered broilers with low feed conversion rate.

[0015] Furthermore, PCR amplification is performed using the above primer combination or kit.

[0016] Furthermore, the PCR amplification system was: 2×Taq Master Mix 10 μL, forward and reverse primers 1 μL each, DNA template 1 μL, and ddH2O to 20 μL.

[0017] Furthermore, the PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 15 s, annealing at 56°C for 10 s, extension at 72°C for 30 s, 35 cycles; and extension at 72°C for 5 min.

[0018] The present invention has the following beneficial effects:

[0019] The present invention provides a CLOCK gene SNP molecular marker related to the feed conversion rate of yellow-feathered broiler chickens. In the SNP molecular marker, the genotype frequency and the allele frequency are significantly different between the low feed conversion rate group and the high feed conversion rate group (P < 0.01). In the low feed conversion rate group, the frequency of the allele G is significantly higher than that of the allele A, and the frequency of the genotype GG is higher than that of the genotype G The frequency of A indicates that the polymorphism of the SNP molecular marker provided by the present invention is significantly correlated with the chicken feed conversion rate trait, and can be used to select chicken flocks with low feed conversion rate, improve the efficiency of the broiler industry, and provide convenient and technical support for the rapid breeding of broilers with low feed conversion rate, which can effectively reduce the feed cost in the production process and improve the economic benefits and competitiveness of the enterprise. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Manhattan plot of SNP markers for GWAS analysis of feed conversion rate in Example 1;

[0021] Figure 2 This is the SNP molecular marker genotype sequencing diagram in Example 2. DETAILED DESCRIPTION

[0022] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. If specific conditions are not specified in the embodiments, they are carried out according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0023] Example 1: Screening of SNP molecular markers

[0024] 1872 healthy yellow-feathered broiler chickens were selected, and all the experimental chickens were mixed and fed until 56 days of age. From 56 days of age, they were transferred to individual cages for separate feeding, and the experiment ended at 98 days of age. The daily feed intake, initial test weight and final weight of each chicken were recorded, and the feed conversion rate was calculated. The calculation formula is as follows:

[0025]

[0026] Where, FCR is feed conversion rate; W f is feed consumption; W a To increase the weight of living organisms.

[0027] The lower the FCR value, the lower the feed conversion rate, indicating that less feed is consumed for the same production capacity during the production process, that is, feed is saved. DNA was extracted from each sample, and the DNA sample was quality tested. The DNA concentration was tested using QubitFluorometer, and the DNA fragment size and degradation degree were tested using agarose gel electrophoresis. The test results showed that 99 samples were unqualified, and the qualified 1773 yellow-feathered chicken breeder DNA samples were used for subsequent library construction and sequencing. Simplified genome sequencing was performed using high-throughput production measurement technology. The sequencing data was quality controlled and filtered to remove low-quality sequencing reads and possible false-positive BNP. Feed conversion rate was used as a phenotype and was associated with SNP data for analysis. The EMMAX program (http: / / genetics.cs.ucla.edu / emmax / index.html.) was used for GWAS analysis, and the analysis model was as follows:

[0028] y=Xb+Zu+m+e;

[0029] In the model, y represents the true value of the trait record, X represents the fixed effect association matrix, b represents the fixed effect vector, the fixed effect includes batch effect and three principal component effects, Z represents the additive genetic effect association matrix, u represents the individual additive genetic effect vector, e represents the residual, u~N(0, Gσ 2 α ), e~N(0,Iσ 2 ε α), G represents the genome kinship matrix, I represents the identity matrix, σ 2 α , σ 2 ε α represents the additive genetic effect variance and residual variance, and m represents the SNP marker effect.

[0030] According to the results of association analysis, a SNP molecular marker associated with the feed conversion rate trait of yellow-feathered broiler chickens was found. The molecular marker is located on chromosome 27 of yellow-feathered broiler chickens. Figure 1 As shown in the Manhattan diagram, the mutation site and upstream and downstream sequences of the SNP molecular genetic marker are as follows:

[0031] 5'-AGGATTAAGTCCCAGTGTTCTCTGTTCAGCTGTCAGCCAGGAG AGGAGCATTCTCTGACATACAAGTAGTGACCAAGGCTCTGAATATTTCTGCCTGTCAAATCTTCAGCTAATTCGAGCGCTGTATATTTAGCATCCATGAGCAGAAAAATGAAAGCTTTTGGTTATCAGTAGCTTTTGGGGACATCATAAATACTGAGRCACCGAGTTCTAATCATTTTCTTG ACACTTTTTTATCACGCAGGTTCATAGCCAAGAACATTATGAAGCTGCAGCGCCTGGGGATAACCCATGTTCTGAATGCAGCAGAGGGGAAGTCATTCATGCATGTGAACACTAATGCAGAATTCTATGAAGGCACAGGCATCACATACCATGGCATTAAAGCTAACGATACGCAGG-3'(SEQ ID NO.1). R is the G>A mutation site. When R is G, the chicken has a lower feed conversion rate; 5'- and -3' represent the 5' end and 3' end of the nucleotide sequence, respectively.

[0032] Example 2: Validation of SNP Molecular Markers

[0033] The molecular markers obtained in Example 1 were verified in another yellow-feathered broiler group, with a total of 1773 healthy yellow-feathered broiler individuals. All experimental chickens were mixed and fed until 56 days of age, and then transferred to individual cages for feeding from 56 days of age. The experiment ended at 98 days of age. 150 individuals with low feed conversion rate (FCR less than 3.0) and high feed conversion rate (FCR greater than 3.0) were selected, and blood was taken for DNA extraction. The average FCR of the 150 individuals with low feed conversion rate was 2.6±0.38, and the average FCR of the individuals with high feed conversion rate was 3.4±0.39. The extracted DNA was used as a template for PCR reaction.

[0034] Forward primer: 5′-TCCCAGTGTTCTCTGTTCAGCT-3′ (SEQ ID NO. 2);

[0035] Reverse primer: 5'-ATCGTTAGCTTTAATGCCATGGT-3' (SEQ ID NO. 3).

[0036] PCR amplification system: 2×Taq Master Mix 10μL, forward and reverse primers 1μL each, DNA template 1μL, ddH2O to 20μL.

[0037] PCR reaction conditions: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 15 s, annealing at 56°C for 10 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min.

[0038] The PCR products were sequenced and analyzed using the Sanger sequencing method.

[0039] Analyze the sequencing results and record the corresponding genotype of each individual according to the sequencing peak graph of each sample (such as Figure 2 ), only one peak appeared at the corresponding site in the sequencing map of genotype GG, indicating that the alleles were the same, both G; there were two peaks at the corresponding site in the sequencing map of genotype GA, indicating that the alleles were different, one was G and the other was A. The genotype and allele of SNP molecular markers and feed conversion rate were analyzed by one-way analysis of variance using SPSS26.0, and the results are shown in Tables 1 and 2. In this SNP molecular marker, the genotype frequency and allele frequency were extremely significantly different between the low feed conversion rate group and the high feed conversion rate group (P < 0.01). In the low feed conversion rate, the frequency of the G allele was higher than that of the A allele, and the frequency of the genotype GG was higher than that of the genotype G A The frequency of GG genotype individuals at position 201 showed that the feed conversion rate phenotype was better than that of GA genotype individuals. It further showed that the polymorphism of the screened molecular markers was significantly correlated with the feed conversion rate trait, and it was a SNP site associated with the feed conversion rate trait, which could be used for the breeding of yellow-feathered broilers with low feed conversion rate traits.

[0040] Table 1 Statistical table of the distribution differences of SNP molecular marker genotypes between low feed conversion rate and high feed conversion rate

[0041]

[0042] Table 2 Statistical table of the distribution difference of SNP molecular marker alleles between low feed conversion rate and high feed conversion rate

[0043]

[0044] Example 3: Assisted molecular breeding method for feed conversion efficiency trait of yellow-feathered broiler chickens using SNP molecular marker alleles

[0045] (1) Blood was collected from the wing vein of the individual to be tested, anticoagulated with EDTA, and stored at -20°C for DNA extraction.

[0046] (2) PCR was performed using a kit for amplifying the above-mentioned SNP molecular markers, the kit comprising 2×TaqMaster Mix, forward and reverse primers (forward primer: 5′-TCCCAGTGTTCTC TGTTCAGCT-3′ (SEQ ID NO.2), reverse primer: 5′-ATCGTTAGCTTTAATG CCATGGT-3′ (SEQ ID NO.3), concentration of 10 mmol / L), and ddH2O.

[0047] PCR amplification system: 2×Taq Master Mix 10μL, forward and reverse primers 1μL each, DNA template 1μL, ddH2O to 20μL.

[0048] PCR reaction conditions: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 15 s, annealing at 56°C for 10 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min.

[0049] (3) Sequence the PCR products using the Sanger sequencing method.

[0050] (4) Based on the genotyping results, homozygous individuals with the AA genotype of the SNP marker chr27-6510723 were selected for breeding to reduce feed conversion rate, effectively reducing feed consumption and breeding costs; selecting individuals with this marker to join the core breeding population can achieve the screening of alleles related to this trait, which can provide technical support for accelerating the progress of genetic selection.

[0051] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A CLOCK gene SNP molecular marker associated with feed conversion rate of yellow-feathered broiler chickens, characterized in that: The SNP molecular marker polymorphism is G / A, located at the 5903440th base of the CLOCK gene on chicken chromosome 27, and the RS number is rs315082113.

2. The CLOCK gene SNP molecular marker associated with feed conversion rate of yellow-feathered broiler chickens according to claim 1, characterized in that: The sequence of the SNP molecular marker is shown in SEQ ID NO.1, R is a G>A mutation site, and when R is G, it is a yellow-feathered broiler with low feed conversion rate.

3. A primer combination for amplifying the SNP molecular marker according to claim 1 or 2, characterized in that: It includes a forward primer as shown in SEQ ID NO.2 and a reverse primer as shown in SEQ ID NO.

3.

4. A kit for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: Comprising the primer combination described in claim 3.

5. Use of the SNP molecular marker according to claim 1 or 2, the primer combination according to claim 3, or the kit according to claim 4 in screening yellow-feathered broilers with low feed conversion rate.

6. A method for screening yellow-feathered broilers with low feed conversion rate, characterized in that: The SNP molecular markers according to claim 1 are amplified and sequenced using PCR technology, and individuals with the SNP molecular marker genotype of GG are screened as breeder chickens, and the frequency of the SNP molecular marker genotype of GG is increased generation by generation to obtain yellow-feathered broilers with low feed conversion rate.

7. The method for screening yellow-feathered broilers with low feed conversion rate according to claim 6, characterized in that: PCR amplification is performed using the primer combination described in claim 3 or the kit described in claim 4.

8. The method for screening yellow-feathered broilers with low feed conversion rate according to claim 6, characterized in that: The PCR amplification system was as follows: 2×Taq Master Mix 10 μL, forward and reverse primers 1 μL each, DNA template 1 μL, and ddH2O to 20 μL.

9. The method for screening yellow-feathered broilers with low feed conversion rate according to claim 6, characterized in that: The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 15 s, annealing at 56°C for 10 s, extension at 72°C for 30 s, 35 cycles; and extension at 72°C for 5 min.

Images