Application of molecular genetic marker YZU-LAYER-MGM-2 in identification of high-yield laying hens

Abstract

The invention discloses an application of a molecular genetic marker YZU-LAYER-MGM-2 in identification of high-yield laying hens. Through the molecular genetic marker and the detection method thereof, high-yield laying hens can be identified in an early stage, and the breeding process can be accelerated; according to the molecular genetic marker and the detection method thereof, high-yield laying hens can be identified at an early stage only by taking a small amount of blood, the molecular genetic marker has the advantages of convenience, high flux and labor saving, and the breeding cost can be saved.

Description

Technical Field

[0001] The invention relates to application of molecular genetic marker YZU-LAYER-MGM-2 in identifying high-yield laying hens, and belongs to the field of poultry breeding technology and gene detection. Background Art

[0002] In laying hen production, egg production is one of the key indicators directly linked to breeding benefits. At the same time, egg production is also an important indicator for measuring breeding results. Genetic factors are the key factors that determine the egg-laying potential of chickens. It is currently believed that egg-laying traits are controlled by multiple genes, and gene mutation is one of the genetic principles that cause differences in egg production in a population. In the category of gene mutation, there is a type of situation that only involves a single base mutation, which is called single nucleotide polymorphism (SNP). Using the SNP theory, the unit site information of the mutation within the genome can be associated with the egg production information. Analysis and calculation, screen out SNP sites related to certain specific phenotypes, thereby forming molecular genetic markers for egg production traits, and then guide application.

[0003] By detecting molecular genetic markers, the egg production of individuals can be predicted early, avoiding the problems of long-term manual recording and selection in traditional breeding, accelerating the breeding process, and reducing breeding and labor costs. However, the current detection methods are mostly based on high-throughput sequencing technology or gene chip technology, which has the problems of large errors and high costs compared with the detection method of PCR combined with first-generation sequencing. Summary of the invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide an application of a molecular genetic marker YZU-LAYER-MGM-2 in identifying high-yielding laying hens, which helps to accelerate the breeding process and reduce breeding costs.

[0005] Technical solution: To solve the above technical problems, the present invention provides the use of a molecular genetic marker YZU-LAYER-MGM-2 or a detection kit containing the molecular genetic marker YZU-LAYER-MGM-2 in determining egg production traits, wherein the molecular genetic marker YZU-LAYER-MGM-2 is located at position 23357295 of chromosome Z.

[0006] Wherein, the molecular genetic marker YZU-LAYER-MGM-2 is Z T / - Type or Z C / - type.

[0007] Among them, when the genotype is Z C / - When the genotype is Z, the egg production trait is a high egg production trait; when the genotype is T / - When the type is established, the egg production trait is a low egg production trait.

[0008] The invention also provides the use of a molecular genetic marker YZU-LAYER-MGM-2 or a detection kit containing the molecular genetic marker YZU-LAYER-MGM-2 in identifying high-yield laying hens. The molecular genetic marker YZU-LAYER-MGM-2 is located at position 23357295 of the Z chromosome.

[0009] Wherein, the molecular genetic marker YZU-LAYER-MGM-2 is Z T / - Type or Z C / - type.

[0010] Among them, when the genotype is Z C / - When the type is tested, the chickens to be tested are high-yielding laying hens.

[0011] The invention also provides the use of a specific primer pair of the molecular genetic marker YZU-LAYER-MGM-2 or a kit containing the specific primer pair in determining egg production traits. The nucleotide sequences of the specific primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0012] The method comprises the following steps: using the DNA of the chicken to be tested as a template and using the specific primer pair to perform PCR amplification; when the base at the 95bp position of the amplified product sequence is C, the chicken to be tested has a high egg production trait; when the base at the 95bp position of the amplified product sequence is T, the chicken to be tested has a low egg production trait.

[0013] The invention also provides the use of a specific primer pair of the molecular genetic marker YZU-LAYER-MGM-2 or a kit containing the specific primer pair in identifying high-yielding laying hens. The nucleotide sequences of the specific primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0014] The technical solution of the present invention mainly includes three parts: screening of genetic markers, detection method of the genetic markers, and accuracy verification of the detection method.

[0015] 1. Screening of Molecular Genetic Markers

[0016] 1) Phenotypic determination: The egg production data of 2145 Rock Island Red chickens at different stages were recorded, including egg production from the beginning of laying to 300 days of age, egg production from 301 days to 560 days of age, egg production from 561 days to 651 days of age, and total egg production.

[0017] 2) Whole-genome association analysis: Each individual was genotyped using a 55k gene chip. After the typing data passed quality control and the whole-genome significance threshold was calculated, the 55k variation information was used for whole-genome association analysis with the corresponding phenotypic data to obtain multiple loci significantly associated with egg production at each stage ( Figure 1and Figure 2 ).

[0018] 3) Screening of candidate sites: Overlap analysis of sites significantly correlated at different stages revealed that 4 significant sites were associated with egg production at 301-560 days of age, egg production at 561-651 days of age, and total egg production. Bioinformatics annotation of these 4 sites revealed that they were all located on chromosome Z, with a range of 23.354Mb-23.493Mb, and that these 4 sites were highly linked to each other. Among them, the Top2 site chrZ:23357295 (located at 23357295bp on chromosome Z, rs315990363, and the reference genome is GRCg6a) can be used as the Tag SNP of these 4 sites, which is a splicing polypyrimidine pathway mutation ( Figure 3-5 ). Therefore, chrZ:23357295 was determined as a candidate site.

[0019] 4) Determination of the relationship between the genotype of the genetic marker and egg production

[0020] In this population, there are two genotypes at this locus: Z C / - , Z T / - , the frequency of C is 0.668, and the frequency of T is 0.332. C / - The average total egg production of individuals was 433 eggs, the average total egg production of G / A individuals was 423 eggs, and the average total egg production of Z T / - The average total egg production of each individual was 381 eggs, and there was a statistically significant difference between the groups ( Figure 4 ). Therefore, it is determined that the site Z C / - The genotype has the trait of high egg production and should be selected; determine the locus Z T / - Genotypes with low egg production traits can be eliminated.

[0021] 2. Method for detecting the genetic marker

[0022] 1) Blood collection: 0.1 mL of blood was collected from the venous vein of the chicken to be tested.

[0023] 2) Blood DNA extraction: Use a blood DNA extraction kit to extract blood sample DNA.

[0024] 3) PCR and product quality inspection: PCR amplification is performed using the designed specific primers and the extracted DNA. The amplified product should have a single band and a size of 261 bp. It can be used for subsequent sequencing after passing the agarose gel electrophoresis quality inspection.

[0025] 4) Product sequencing: Sanger sequencing is used to read the base information at the 95th bp of the amplified product.

[0026] 5) Result judgment: If it shows Z C / -If the type is Z, it is a high egg-laying individual; T / - type, it is a low egg-laying trait individual ( Figure 6 ).

[0027] 3. Verification of the accuracy of the genetic marker detection method

[0028] The detection method was validated in another 96 individuals, showing that the Z C / - Individuals with the same genotype have higher egg production, indicating that the genetic markers and the detection method thereof in the present invention can effectively identify high-producing laying hens at an early stage.

[0029] The present invention records the egg production information of more than 2,000 white Leghorn chickens at different stages, and uses 55k gene chips for genotyping. The whole genome association analysis (GWAS) of egg production at different stages, combined with the overlap screening strategy at different stages, screened out a SNP genetic marker (chrZ:23357295, rs315990363, GRCg6a) that is highly correlated with the egg production of the group. In this group, there are two genotypes at this SNP site: Z C / - , Z T / - . Z C / - The average total egg production of each individual is 433 eggs. T / - The average total egg production of individuals was 423 eggs, and there was a statistical difference between the groups. C / - The genotype has a high egg production trait. Based on this, the present invention has developed a blood DNA group detection method for this site and verified it to realize the Z site. C / - Therefore, the genetic marker and its detection method can be used for the early selection of individuals with high egg production traits, which can avoid the problems of long working cycle, high cost, large manpower and wide error of conventional breeding.

[0030] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The molecular genetic marker and its detection method can be used to identify high-yielding laying hens at an early stage, which can accelerate the breeding process; 2. The molecular genetic marker and its detection method only require a small amount of blood sampling to identify high-yielding laying hens at an early stage, which has the advantages of convenience, high throughput, and labor saving, and can save breeding costs; based on the breeding cost of a laying hen from brooding to elimination of 190 yuan / hen, according to the population gene frequency, Z C / - If the individuals with high egg production account for about 67% of the total group, then 32% of the individuals with medium and low egg production can be eliminated early; if 10,000 chickens are raised, excluding the detection cost of this method, about 568,000 yuan can be saved (10,000 × 190 yuan / bird × 32% - 40,000). BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1The screening process of the molecular genetic marker (chrZ:23357295, GRCg6a): ac are the GWAS results of egg production from the first day of laying to 300 days, egg production from 301 days to 560 days, and egg production from 561 days to 651 days, respectively;

[0032] Figure 2 GWAS results for total egg production;

[0033] Figure 3 Overlap analysis of significantly correlated sites in four stages;

[0034] Figure 4 LD analysis revealed that chrZ:23357295 could be used as a Tag SNP for these four loci;

[0035] Figure 5 It is a statistical analysis of the total egg production corresponding to the genotype of the site in the population, that is, the determination of the relationship between the genotype of the genetic marker and egg production. C / - The genotype has the trait of high egg production, Z T / - The genotype has a low egg production trait;

[0036] Figure 6 This is an illustration of the result interpretation of the molecular genetic marker (chrZ:23357295, GRCg6a) detection method: If a single peak of T is present at the 95bp of the detection result, the genotype of the site is determined to be Z T / - , as shown in a; if a single peak is shown, the genotype of the site is determined to be Z C / - , as shown in b. DETAILED DESCRIPTION

[0037] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0038] Example 1. Screening of molecular genetic markers

[0039] 1) Phenotypic determination: The egg production data of 2145 Luodao Red chickens of the same generation (the group was raised in Baoding City, coordinates 115.53, 39.46) at different stages were recorded, including egg production from the beginning of laying to 300 days of age, egg production from 301 days to 560 days of age, egg production from 561 days to 651 days of age, and total egg production.

[0040] 2) Genome-wide association analysis: Each individual was genotyped using a 55k gene chip (the trade name of the gene chip is "Jingxin No. 1", and the test was provided by Beijing Compson Biotechnology Co., Ltd.). The typing data passed quality control (quality control parameters were: filtering individuals with sample detection rate <90%, filtering gene loci with genotype missing rate >10% and minimum allele frequency <5%), and the genome-wide significance threshold was calculated (1 / number of independent SNPs, and the number of independent SNPs was calculated using the parameter --indep-pairwise 25 5 0.2, that is, 25 SNPs were used as a sliding window and 5 SNPs were added each time, and the R value of any other SNP was 0. 2 The number of SNPs with a value greater than 0.2) was analyzed by genome-wide association analysis using a general linear model, with the variant sites that passed quality control being analyzed and the egg production data. Several sites that were significantly associated with egg production at each stage were obtained ( Figure 1 and Figure 2 ).

[0041] 3) Screening of candidate sites: Overlap analysis of sites significantly associated with different stages ( Figure 3 ), and found that 4 significant loci were associated with egg production from 301 days to 560 days of age, egg production from 561 days to 651 days of age, and total egg production. Bioinformatics annotation of the 4 loci revealed that the 4 loci were all located on chromosome Z, with an interval of 23.354Mb-23.493Mb, and the 4 loci were highly linked to each other (Table 1).

[0042] Table 1 Four loci and their annotation information

[0043]

[0044] Among them, the Top2 site chrZ:23357295 (located at 23357295bp on chromosome Z, rs315990363, reference genome is GRCg6a) can be used as the Tag SNP of these four sites ( Figure 4 ), which belongs to the splicing polypyrimidine pathway mutation. Therefore, chrZ:23357295 was determined as a candidate site.

[0045] 4) Determination of the relationship between the genotype of the genetic marker and egg production

[0046] In this population, there are two genotypes at this locus: Z C / - , Z T / - , the frequency of C is 0.668, and the frequency of T is 0.332. C / - The average total egg production of each individual is 433 eggs. T / - The average total egg production of each individual was 423 eggs, and there was a statistically significant difference between the groups ( Figure 5 ). Therefore, it is determined that the site ZC / - The genotype has the trait of high egg production and should be selected; determine the locus Z T / - The genotype has a low egg production trait and can be eliminated. Among them, the definition of high and low egg production is relative to the median egg production level of the group. Statistically significantly higher than the median level is defined as high production, and significantly lower than the median level is defined as low production.

[0047] Example 2 Detection method of the genetic marker

[0048] By using the genetic marker and its detection method of the present invention, chickens with high egg production traits can be identified at an early stage, thereby guiding the subsequent selection work. Taking the detection of the molecular genetic marker of 96 hens as an example, the specific implementation method is as follows:

[0049] 1) Blood collection: Use a blood collection needle and an anticoagulant EDTA vacuum blood collection tube to collect 0.1-0.3 mL of blood from each chicken under the wing vein for subsequent testing.

[0050] 2) Blood DNA group extraction: Use a blood DNA extraction kit (Tiangen Biotechnology, DP348) to extract blood sample DNA according to the operating procedures, measure the DNA concentration, and control the DNA concentration to about 100 ng / μL for subsequent PCR.

[0051] 3) PCR: PCR amplification was performed with the extracted DNA using specific primers designed for the molecular genetic marker (chrZ: 23357295) (see Table 2 for reagents). A 20 μL reaction system was used, and the composition of the reaction system and the reaction procedure are shown in Tables 3 and 4. The amplified product was used for subsequent use.

[0052] Table 2

[0053]

[0054] Table 3

[0055]

[0056] Table 4

[0057]

[0058] 4) Quality inspection and sequencing of amplified products: Take 1 μL of amplified product, mix with 1 μL of nucleic acid dye, cooperate with DNA marker, and perform 1.5% agarose gel electrophoresis on the same batch. After the electrophoresis, if a single band of 261 bp is present, it indicates that the quality inspection has passed and can be used for subsequent sequencing. The sequence of the amplified product is: 5'-ACATGCCATTTGTCAGCAG AGTCATTCTCCTTATGGAATCTGCAGCTTGCAGCGTCAAGCACTTTGTTTCTCCAGT TGTCCTGGGAAAACCACA(T / C)AAGCAGATGATGAGAGGGACATTGAATCTTTTTT TCCTAGATACTAATACCAAAGAAAATAAAATGGATGTCTAAGATACAGCACAAACTCTGTGACTTGCAAAGGGAATCCCTTTCCTTTAATATATCCTAATTGTCACCATCTGCCTCATAGGTTGTCGCCTGG-3'.

[0059] For the amplified products that passed the quality inspection, Sanger sequencing was used to obtain sequencing data and read the base information at the 95 bp.

[0060] 5) Result judgment: If it shows Z C / - If the type is Z, it is a high egg-laying individual; T / - The results showed that among the 96 chickens, the Z C / - There are 61 types, Z T / - According to the result judgment criteria, Z C / - Type individuals, eliminate Z T / - The 61 Z C / - The egg-laying situation of the individuals of this type was checked, among which 54 had an egg-laying amount higher than the group average, and were high-producing individuals, with an accuracy rate of over 88%.

Claims

1. The use of the molecular genetic marker YZU-LAYER-MGM-2 or a detection kit containing the molecular genetic marker YZU-LAYER-MGM-2 in determining egg production traits, characterized in that: The molecular genetic marker YZU-LAYER-MGM-2 is located at position 23357295 of chromosome Z.

2. The use according to claim 1, characterized in that: The molecular genetic marker YZU-LAYER-MGM-2 is Z C / - Type or Z T / - type.

3. The application according to claim 1, characterized in that: When the genotype is Z C / - When the genotype is Z, the egg production trait is a high egg production trait; when the genotype is T / - When the type is established, the egg production trait is a low egg production trait.

4. The use of the molecular genetic marker YZU-LAYER-MGM-2 or a detection kit containing the molecular genetic marker YZU-LAYER-MGM-2 in identifying high-yielding laying hens, characterized in that: The molecular genetic marker YZU-LAYER-MGM-2 is located at position 23357295 of chromosome Z.

5. The application according to claim 4, characterized in that: The molecular genetic marker YZU-LAYER-MGM-2 is Z T / - Type or Z C / - type.

6. The use according to claim 4, characterized in that: When the genotype is Z C / - When the type is determined, the chickens to be tested are high-yielding laying hens.

7. Use of the specific primer pair of the molecular genetic marker YZU-LAYER-MGM-2 according to claim 1 or a kit containing the specific primer pair in determining egg production traits, characterized in that: The nucleotide sequences of the specific primer pair are shown in SEQ ID NO.1 and SEQ ID NO.

2.

8. The use according to claim 7, characterized in that: The following steps are involved: The specific primer pair is used to perform PCR amplification using the DNA of the chicken to be tested as a template; when the base at the 95th bp of the amplified product sequence is C, the chicken to be tested has a high egg production trait; when the base at the 95th bp of the amplified product sequence is T, the chicken to be tested has a low egg production trait.

9. Use of the specific primer pair of the molecular genetic marker YZU-LAYER-MGM-2 according to claim 1 or a kit containing the specific primer pair in identifying high-yielding laying hens, characterized in that: The nucleotide sequences of the specific primer pair are shown in SEQ ID NO.1 and SEQ ID NO.

2.

10. The use according to claim 9, characterized in that: The following steps are involved: The DNA of the chicken to be tested is used as a template and the specific primer pair is used for PCR amplification; when the base at the 95 bp position of the amplified product sequence is C, the chicken to be tested is a high-yielding laying hen.

Images