A method for identifying sorghum varieties' resistance to sorghum anthracnose

Abstract

The present invention discloses a method for identifying the resistance of sorghum varieties to sorghum anthracnose. The present invention belongs to the field of biotechnology, and specifically relates to a method for identifying the resistance of sorghum varieties to sorghum anthracnose. The method for identifying the resistance of sorghum varieties to sorghum anthracnose of the present invention comprises the following steps: detecting the genomic DNA of the sorghum to be identified, the sorghum to be identified whose genomic DNA does not contain the InDel molecular marker 1 and the molecular marker 2 has a stronger or candidate higher resistance to sorghum anthracnose than the sorghum to be identified whose genomic DNA contains the InDel molecular marker 1 and the molecular marker 2; InDel molecular marker 1 is a double-stranded DNA molecule whose nucleotide sequence of one chain is the 43rd-50th position of SEQ ID No.1; InDel molecular marker 2 is a double-stranded DNA molecule whose nucleotide sequence of one chain is the nucleotide sequence of SEQ ID No.5.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for identifying the resistance of sorghum varieties to sorghum anthracnose. Background Art

[0002] Anthracnose is a common and devastating disease in sorghum production, particularly in warm, humid tropical and subtropical growing regions. Sorghum anthracnose (Colletotrichum sublineola) not only causes sorghum leaves to wilt, but also rots the stems, leading to plant lodging and even damage to the ear, resulting in smaller grains and a yield reduction of up to 69%-100%. Once established, sorghum leaf diseases spread rapidly, withering all leaves within a few days, leading to severe yield losses. Agricultural and chemical control measures are ineffective, while the promotion and utilization of disease-resistant varieties is both effective and environmentally friendly. Therefore, strengthening the screening of disease-resistant gene resources in sorghum will help accelerate the breeding of disease-resistant varieties.

[0003] Compared to traditional techniques, molecular marker-assisted breeding (MAB) will significantly improve the efficiency of breeding anthracnose-resistant varieties. Molecular markers are genetic markers based on nucleotide sequence variation within the genetic material of individuals and reflect polymorphism at the nucleotide sequence level. InDel markers, or insertion-deletion markers, refer to genome-wide differences between two parents. Specifically, they involve insertions or deletions of varying sizes at the same genomic locus between closely related species or individuals of the same species. InDel markers offer advantages such as rich polymorphism, high density, high accuracy, stable variation, and ease of detection. They also require low DNA quality and sample size, and can even amplify highly degraded DNA. Therefore, InDel markers have made significant progress in molecular marker-assisted breeding, germplasm analysis, molecular-assisted genetic breeding, and population genetic analysis of crops. Therefore, identifying loci associated with anthracnose resistance in sorghum is crucial for screening anthracnose-resistant sorghum varieties, providing a crucial theoretical basis for effective sorghum breeding and possessing significant economic value. Summary of the Invention

[0004] The main problem to be solved by the present invention is how to identify or assist in identifying the anthracnose resistance of sorghum varieties and carry out sorghum breeding.

[0005] In order to solve the above problems, the present invention provides a method for identifying the resistance of sorghum varieties to sorghum anthracnose.

[0006] The present invention first provides a method for identifying the resistance of sorghum varieties to sorghum anthracnose, comprising the following steps:

[0007] Detecting whether the genomic DNA of the sorghum to be identified contains InDel molecular marker 1 and InDel molecular marker 2, the sorghum to be identified whose genomic DNA does not contain the InDel molecular marker 1 and molecular marker 2 has a stronger or higher resistance to sorghum anthracnose than the sorghum to be identified whose genomic DNA contains the InDel molecular marker 1 and / or molecular marker 2;

[0008] The InDel molecular marker 1 is a double-stranded DNA molecule whose nucleotide sequence on one chain is positions 43-50 of SEQ ID No. 1;

[0009] The InDel molecular marker 2 is a double-stranded DNA molecule whose nucleotide sequence on one chain is SEQ ID No. 5.

[0010] In a specific embodiment, the above method includes the following steps:

[0011] (1) Using the genomic DNA of the sorghum to be identified as a template, PCR amplification was performed using identification primer set 1 to obtain PCR product 1;

[0012] (2) identifying the resistance of sorghum to sorghum anthracnose based on whether the PCR product 1 contains the aforementioned InDel molecular marker 1, and obtaining the sorghum primary screening variety to be identified with strong resistance;

[0013] (3) using the genomic DNA of the sorghum variety to be identified obtained in (2) as a template, performing PCR amplification using identification primer set 2 to obtain PCR product 2;

[0014] (4) identifying the resistance of sorghum to sorghum anthracnose based on whether the PCR product 2 contains the aforementioned InDel molecular marker 2, and obtaining the sorghum to be identified with strong resistance, that is, a sorghum variety resistant to sorghum anthracnose;

[0015] The sorghum to be identified whose PCR product 1 does not contain the aforementioned InDel molecular marker 1 has a higher or candidate higher resistance to sorghum anthracnose than the sorghum to be identified whose PCR product contains the aforementioned InDel molecular marker 1;

[0016] The nucleotide sequence of the PCR product 1 may be SEQ ID No. 1 or SEQ ID No. 2.

[0017] The double-stranded DNA molecule at positions 43-50 of SEQ ID No. 1 is molecular marker 1.

[0018] Furthermore, the sorghum to be identified whose PCR product 1 contains the DNA molecule with the nucleotide sequence of SEQ ID No. 2 has a higher or candidate higher resistance to sorghum anthracnose than the sorghum to be identified whose PCR product contains the InDel molecular marker 1 described above (positions 43-50 of SEQ ID No. 1).

[0019] The sorghum to be identified whose PCR product 2 does not contain the aforementioned InDel molecular marker 2 has a higher or candidate higher resistance to sorghum anthracnose than the sorghum to be identified whose PCR product contains the aforementioned InDel molecular marker 2;

[0020] The nucleotide sequence of the PCR product 2 may be SEQ ID No. 5 or SEQ ID No. 6.

[0021] Furthermore, the sorghum to be identified whose PCR product 2 contains the DNA molecule with the nucleotide sequence of SEQ ID No. 6 has a higher or candidate higher resistance to sorghum anthracnose than the sorghum to be identified whose PCR product contains the InDel molecular marker 2 (SEQ ID No. 5) described above.

[0022] The identification primer set 1 consists of a forward primer and a reverse primer, wherein the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker 1 in the sorghum genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker 1 in the sorghum genomic DNA;

[0023] The identification primer set 2 consists of a forward primer and a reverse primer, wherein the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker 2 in the sorghum genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker 2 in the sorghum genomic DNA.

[0024] In a specific embodiment, the PCR amplification reaction system is 25 μl, consisting of 50-100 ng of genomic DNA from sorghum leaves to be tested, 1 μL of forward primer aqueous solution (concentration of 10 pmol / μL), 1 μL of reverse primer aqueous solution (concentration of 10 pmol / μL), 12.5 μL of 2×Taq PCR Master Mix (Nanjing Novozyme Biotechnology Co., Ltd., P111-01) and ddH2O.

[0025] The reaction conditions of the PCR amplification are: pre-denaturation at 95°C for 3 min; 35 cycles of 95°C for 15 sec, 55°C for 15 sec, and 72°C for 30 sec; 72°C for 5 min; and storage at 4°C.

[0026] In a specific embodiment, the identification primer set 1 in the above method consists of primer F and primer R, the nucleotide sequence of primer F is SEQ ID No.3, and the nucleotide sequence of primer R is SEQ ID No.4; the identification primer set 2 consists of primer F1 and primer R1, the nucleotide sequence of primer F1 is SEQ ID No.7, and the nucleotide sequence of primer R1 is SEQ ID No.8.

[0027] The identification primer set 1 and identification primer set 2 in the above-mentioned method also fall within the scope of protection of the present invention.

[0028] The present invention also provides an application of an InDel molecular marker or a substance for detecting the InDel molecular marker, wherein the InDel molecular marker is the InDel molecular marker 1 and the InDel molecular marker 2 described above; the application may be any of the following:

[0029] 1) Use of InDel molecular markers or substances for detecting said InDel molecular markers in identifying or assisting in identifying sorghum's resistance to sorghum anthracnose,

[0030] 2) Application of InDel molecular markers or substances for detecting the InDel molecular markers in sorghum breeding.

[0031] In the above application, the substance contains PCR primers for amplifying a sorghum genomic DNA fragment containing the InDel molecular marker 1 and the InDel molecular marker 2.

[0032] In the above application, the PCR primers are identification primer set 1 and identification primer set 2, the identification primer set 1 consists of a forward primer and a reverse primer, the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker 1 in the sorghum genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker 1 in the sorghum genomic DNA;

[0033] The identification primer set 2 consists of a forward primer and a reverse primer, wherein the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker 2 in the sorghum genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker 2 in the sorghum genomic DNA.

[0034] In the above application, the identification primer set 1 consists of primer F and primer R, the nucleotide sequence of primer F is SEQ ID No.3, and the nucleotide sequence of primer R is SEQ ID No.4; the identification primer set 2 consists of primer F1 and primer R1, the nucleotide sequence of primer F1 is SEQ ID No.7, and the nucleotide sequence of primer R1 is SEQ ID No.8.

[0035] In the above application or method, the sorghum is a sorghum variety or a sorghum inbred line.

[0036] The present invention also provides a method for sorghum breeding, which comprises selecting sorghum whose genomic DNA does not contain the above-mentioned InDel molecular marker 1 and does not contain the above-mentioned InDel molecular marker 2 as a parent for breeding.

[0037] Furthermore, the sorghum having the genomic DNA of SEQ ID No. 2 and SEQ ID No. 6 mentioned above can be selected as a parent. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Results of polyacrylamide gel electrophoresis analysis of 96 sorghum varieties using primers F / R for InDel marker 1. Lane 1 represents the marker (Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number MD206), while the remaining lanes represent sorghum varieties.

[0039] Figure 2 Results of polyacrylamide gel electrophoresis analysis of 96 sorghum varieties using primers F / R for InDel marker 1. Lane 1 represents the marker (Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number MD206), while the remaining lanes represent sorghum varieties.

[0040] Figure 3 Results of polyacrylamide gel electrophoresis analysis of 96 sorghum varieties using primers F / R for InDel marker 1. Lane 1 represents the marker (Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number MD206), while the remaining lanes represent sorghum varieties.

[0041] Figure 4 Results of polyacrylamide gel electrophoresis analysis of 29 sorghum varieties using primers F / R for InDel marker 1. Lane 1 represents the marker (Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number MD206), while the remaining lanes represent sorghum varieties.

[0042] Figure 5Agarose gel electrophoresis results of genotyping of 38 sorghum samples using primers F1 / R1 for molecular marker 2. All lanes represent sorghum samples. DETAILED DESCRIPTION

[0043] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0044] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0045] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.

[0046] The sorghum variety PI 564163 (BTx623) used in the following examples is an American grain sorghum, described in: Bai Chunming, Wang Chunyu, Wang Ping, Zhu Zhenxing, Lu Xiaochun. QTL Analysis of Tannin Content and Color in Sorghum Grains. Journal of Plant Genetic Resources. 2017, 18(5): 860-866. The material is maintained by the Sorghum Research Institute of Liaoning Academy of Agricultural Sciences. The public may obtain this biological material from the applicant for use solely in replicating the experiments of the present invention and may not be used for other purposes.

[0047] The disease-resistant variety IS 3121 used in the following examples is described in Upadhyaya, HD, Pundir, RPS, Dwivedi, SL, Gowda, LLC, Reddy, VG, Singh, S. (2009). Developing a mini core collection of sorghum for diversified utilization of germplasm. It is maintained by the Sorghum Research Institute, Liaoning Academy of Agricultural Sciences. The public may obtain this biological material from the applicant for use solely in replicating the experiments described herein and not for any other purpose.

[0048] Sorghum 233 (IS***) described in the following examples is a mini-core collection of germplasm, which is described in Upadhyaya, HD, Pundir, RPS, Dwivedi, SL, Gowda, LLC, Reddy, VG, Singh, S. 2009. Developing a mini core collection of sorghum for diversified utilization of germplasm. This biological material is available to the public from the applicant for use solely in replicating the experiments described herein and is not intended for any other purpose.

[0049] The sorghum anthracnose fungus (Colletotrichum sublineola) used in the following examples has been described in Yang Xia, Cao Shang, Yu Guangyu, Wang Lulu, Tai Lianmei, Zuo Yuhu, Ke Xiwang, and Guo Yongxia. Isolation and identification of the causative fungus of sorghum anthracnose in Heilongjiang Province. Microbiology Bulletin, 2021, 48(5): 1571-1579. The public may obtain the biological material from the applicant for use only in repeating the experiments of the present invention and may not be used for other purposes.

[0050] Example 1: Method for Identifying Sorghum Varieties' Resistance to Sorghum Anthracnose

[0051] Sorghum variety PI 564163 was used as the reference genome (https: / / phytozome-next.jgi.doe.gov / info / Sbicolor_v3_1_1, Genbank: ABXC00000000.3, updated on April 7, 2017). InDel78535 is located on sorghum chromosome 7, positions 10793210-10793339. The allelic variant types are insertion type (referred to as In-78535 type) or deletion type (referred to as Del-78535 type) of the InDel78535 variant sequence. The nucleotide sequence of InDel78535 is 5'-TGACAGCAAACTTTGTGGATCTACCGGACTTCAGCCCGACGAGGCGACCTGGCGACACCCCGCCGCCGCTGTCC TTGTCCGCCACATCTGAGCATCTCTGGTGAGTTTCTACTGAGTAGAGAGTTGGGAG-3' (SEQ ID No. 1). The InDel78535 variant sequence contains an insertion-deletion mutation of the nucleotide "5'-GGCGACCT-3'", and the 8 bp insertion-deletion fragment is molecular marker 1.

[0052] Sorghum variety PI 564163 was used as the reference genome (Genbank: ABXC00000000.3, updated on April 7, 2017). InDel78554 was located on sorghum chromosome 7, positions 10799213-10799651. The allelic variation types were insertion type (referred to as InDel78554 type) or deletion type (InDel78554 type) of the InDel78554 variant sequence. The nucleotide sequence of InDel78554 was 5'-GCGACCTGCTACTTTCATTTCGGTTCAGCCTTTTTATTTTCTCTCCCTCGTGCTGTCAGCCAGTCTCTATTTCTAAGGCCTTGTTTAGTTCACCTTGAAAACCAAAAAGTTTTCAAGATTCCCTGTCACATCGAA TTTTGTGGCACATGCATGAAATATTAAATATAGACGAAAACAAAAACTAATTACACAGTTTAGCTGTAAATCACGAGACGAATCTTTTGATCCTAGTTAGTCCATGATTGGATAATATTTGTCACAAACAAACGAAAGTGCTACAGTATCGAAAA CTTTTCACTTTTCGGAACTAAACAAGCCTTACGCAGTGCAGTCAAAAAATATTGCAATCACGCAGTGCAGTTTTCCATGACTAAGCGACAGAATAGTATGCAGTTTTTAATGTCGTGCACCACGGCGAAAGGGACTTTCGTCTGTGTTG-3'(SEQ ID No.5).

[0053] The InDel78554 variant sequence contains multiple SNP allelic variations and InDel deletions. The SNP variations occur at positions 32 (T / A), 354 (A / G), 380 (A / T), and 405 (G / deletion) of SEQ ID No. 5 in the sequence listing; a 165-bp InDel variant sequence deletion from positions 70 to 234 of SEQ ID No. 5; and an 89-bp variant sequence from positions 241 to 329 of SEQ ID No. 5. The variant sequence shown in SEQ ID No. 5 is used herein as InDel molecular marker 2 for sorghum anthracnose resistance.

[0054] 1. Use CTAB method to extract genomic DNA from sorghum leaves to be tested

[0055] The sorghum to be tested is sorghum variety PI 564163 (see Table 1 for details).

[0056] The quality and concentration of the genomic DNA of the sorghum leaves to be tested must meet the requirements of PCR. The standards for reaching the standards are: 1% agarose gel electrophoresis shows clear DNA bands, no obvious impurities, and no degradation; UV spectrophotometer NanoDrop2000 (ThermoScientifc, Waltham, MA, USA) detects OD 260nm / OD 280nm Between 1.6-2.0, DNA concentration is above 50ng / μL.

[0057] 2. First genotyping

[0058] A. PCR amplification

[0059] Using the genomic DNA of the sorghum leaves to be tested in step 1 as a template, PCR amplification was performed using identification primer set 1 consisting of upstream primer F and downstream primer R to obtain a PCR amplification product. The PCR amplification reaction was performed on a BIO-RAD T100™ Thermalcycler PCR instrument.

[0060] Upstream primer F: 5′-TGACAGCAAACTTTGTGGATC-3′ (SEQ ID No. 3);

[0061] Downstream primer R: 5′-CTCCCAACTCTCTACTCAGTAGAAAC-3′ (SEQ ID No. 4).

[0062] The reaction system was 25 μL and consisted of 50–100 ng of genomic DNA from sorghum leaves to be tested, 1 μL of an aqueous solution of upstream primer F (concentration of 10 pmol / μL), 1 μL of an aqueous solution of downstream primer R (concentration of 10 pmol / μL), 12.5 μL of 2× Taq PCR Master Mix (Nanjing Novozyme Biotechnology Co., Ltd., P111-01), and ddH O.

[0063] The reaction conditions were as follows: pre-denaturation at 95°C for 3 min; 35 cycles of 95°C for 15 sec, 55°C for 15 sec, and 72°C for 30 sec; 72°C for 5 min; and storage at 4°C.

[0064] B. Result determination

[0065] The PCR amplification product obtained in step 2 (referred to as PCR product 1) was subjected to polyacrylamide gel electrophoresis, and the amplified fragments showed polymorphism in length. The molecular weight of the marker pBR322 DNA / Msp standard, from bottom to top, was 26, 34, 67, 76, 90, 110, 123, 147, 160, 180, 190, 201, 217, 238, 242, 309, 404, 527, and 622.

[0066] PCR identification was performed using identification primer set 1 (F / R). If the size of PCR amplification product 1 was 130 bp (nucleotide sequence: SEQ ID No. 1), the sorghum to be tested was identical to the PCR product of the susceptible variety PI 564163, i.e., the genotype at the InDel78535 locus was the insertion type of the InDel78535 variant sequence (abbreviated as In-78535 type). If the size of PCR amplification product 1 was 122 bp (nucleotide sequence: SEQ ID No. 2), the sorghum to be tested was identical to the PCR product of the resistant variety IS 3121, i.e., the genotype at the InDel78535 locus was the deletion type of the InDel78535 variant sequence (abbreviated as Del-78535 type). The PCR product of the resistant variety had eight fewer nucleotides, 5'-GGCGACCT-3', than that of the susceptible variety. The 8 bp InDel variant sequence is the sorghum anthracnose resistance InDel molecular marker 1, and the nucleotide sequence of the sorghum anthracnose resistance InDel molecular marker 1 is positions 43 to 50 of SEQ ID No. 1.

[0067] In summary, the length of the amplified fragments of identification primer set 1 (F / R) showed polymorphism, and the sizes of the amplified product fragments were 130 bp and 122 bp, respectively, which were consistent with the expected sizes, confirming the effectiveness of the molecular marker InDel78535.

[0068] 3. Second genotyping

[0069] The disease-resistant genotype identified in step 2 was verified using the following identification primers F1 / R1 that labeled InDel78554, and the PCR amplification product (abbreviated as PCR product 2) was detected by 1% agarose gel electrophoresis. The reaction system and reaction conditions were the same as above.

[0070] The information of identification primers F1 / R1 is as follows:

[0071] F1: 5'-GCGACCTGCTACTTTCATTC-3' (SEQ ID No. 7);

[0072] R1: 5'-CAACACAGACGAAAGTCCCT-3' (SEQ ID No. 8).

[0073] The principles of judgment based on agarose gel electrophoresis are as follows:

[0074] PCR identification was performed using identification primer set 2 (F1 / R1). If the size of PCR amplification product 2 was 439 bp (nucleotide sequence: SEQ ID No. 5), the sorghum to be tested was identical to the PCR product of the susceptible variety PI 564163, i.e., the genotype at the InDel78554 locus was an insertion type of the InDel78554 variant sequence (abbreviated as In-78554 type). If the size of PCR amplification product 2 was 270 bp (nucleotide sequence: SEQ ID No. 6), the sorghum to be tested was identical to the PCR product of the resistant variety IS 3121, i.e., the genotype at the InDel78554 locus was a deletion type of the InDel78554 variant sequence (abbreviated as Del-78554 type).

[0075] In summary, the length of the amplified fragments of the identification primer set 2 (F1 / R1) showed polymorphism, and the molecular marker amplified fragments were 439 bp and 270 bp, respectively, which were consistent with the expected size, confirming the validity of the molecular marker InDel78554.

[0076] In summary, the above two markers InDel78535 and InDel78554 were used for step-by-step identification. If in the genome of the sorghum to be tested, marker InDel78535 (molecular marker 1) was identified as a resistant genotype (i.e., the allele type of marker InDel78535 was Del-78535 type), and marker InDel78554 (molecular marker 2) was identified as a resistant genotype (i.e., the allele type of marker InDel78554 was Del-78554 type), then the sorghum to be tested was determined to be a sorghum anthracnose (Colletotrichum sublineola)-resistant variety.

[0077] Example 2: Application of markers InDel78535 and InDel78554 in identifying resistance to anthracnose (Colletotrichum sublineola) in sorghum

[0078] 1. Field phenotype identification (resistance, susceptibility) of sorghum anthracnose

[0079] The tested sorghum anthracnose fungus (Colletotrichum sublineola) was isolated from sorghum leaves. It was identified as a highly pathogenic strain through morphological and molecular biological identification and field pathogenicity determination, and was preserved in the Sorghum Institute of Liaoning Academy of Agricultural Sciences.

[0080] Propagation of sorghum anthracnose pathogen: Inoculate the test strain on a casein lactose hydrolysate medium plate and culture at 24°C with alternating light and dark conditions for about 20 days until the colony produces orange-yellow conidia. Wash the spores with sterile water, filter through double-layer gauze, and adjust the spore count to 1×10 5 Bacterial suspension of 1000 cells / mL is used for inoculation.

[0081] The experiment was conducted at the Sorghum Research Institute of the Liaoning Academy of Agricultural Sciences. From 2020 to 2023, sorghum disease resistance was assessed using field inoculation. Plants were sown in late April in two-row plots, each 5 m long and 0.6 m apart. One seedling was retained in each hole, with approximately 40 seedlings per plot. The experiment was replicated twice annually.

[0082] The inoculation period for identification of sorghum anthracnose resistance is during the plant's trumpet stage. Generally, mid- and late-maturing varieties are inoculated at the 10- to 11-leaf stage, and early-maturing varieties are inoculated at the 9-leaf stage. It is best to choose the evening or a light rainy day for inoculation. Use the spray inoculation method to evenly spray the spore suspension on the leaf surface around the plant's trumpet. The spray volume should be appropriate so that the spore suspension is evenly sprayed without droplets on the leaves. Within 48 hours after inoculation, manually assist with water spraying and moisturizing to increase the pathogen infection rate. About 40 to 50 days after inoculation, the sorghum grains enter the milky stage and the disease is investigated. Visually inspect the disease status of each identification material, focusing on the two leaves above and below the inoculation site. According to the description of disease symptoms, leaf by leaf was investigated and the disease status was recorded. The average disease level was calculated according to the technical specifications for identification of resistance to major sorghum diseases [1,2] ([1] Xu Jing, Liu Kejie, Hu Lan, Jiang Yu, Wang Yan, Zhang Minghui, You Guanglan, Xu Xiude, Wang Yanhong, Huang Xinyang. Technical specifications for identification of sorghum resistance to anthracnose DB 21 / T 2807-2017. Shenyang: Liaoning Provincial Bureau of Quality and Technical Supervision, 2017. [2] Hu Lan, Xu Xiude, Jiang Yu, Liu Kejie, Xu Jing, Zhang Minghui, Dong Huaiyu, Wang Lijuan, Guo Yingwei. Technical specifications for identification of sorghum resistance to target spot disease DB21T2219.1-2014. Shenyang: Liaoning Provincial Bureau of Quality and Technical Supervision, 2014). As long as there are lesions on the leaves and conidia on the lesions, the leaves are considered susceptible. If there are no conidia on the lesions on the leaves, the leaves are considered resistant. The disease resistance of the identified materials was evaluated based on the results of two years.

[0083] Identification and evaluation criteria for anthracnose resistance of sorghum germplasm resources:

[0084] Disease level 1: There are a few small chlorotic spots on the leaves, accounting for less than 5% of the leaf area, and there are no conidia on the spots, which means high resistance to HR

[0085] Disease level 3: There are a small number of lesions on the leaves, accounting for 5.1%-20% of the leaf area, and there are sporadic conidia on the lesions, which is disease-resistant R

[0086] Disease level 5: There are many lesions on the leaves, accounting for 20.1%-40% of the leaf area, and there are conidia on the lesions, which is medium resistance MR

[0087] Disease level 7: The lesions on the leaves are connected, occupying 40.1%-70% of the leaf area, and there are conidia on the lesions, which is susceptible to S.

[0088] Disease level 9: The leaves are covered with lesions, accounting for more than 70.1% of the leaf area, with conidia on the lesions, and the entire leaf is almost dead, which is a high HS

[0089] Although divided into 5 levels, in this study, disease level 3 and above was considered susceptible, and disease level 1 and above was considered resistant.

[0090] The specific results of sorghum anthracnose resistance identification are shown in Table 1.

[0091] 2. Genotyping and identification of 266 sorghum varieties

[0092] The identification primer set 1 and the identification primer set 2 in Example 1 were used to identify the genotypes of the molecular markers InDel78535 and InDel78554 of 266 sorghum varieties. The specific results are shown in Tables 1 and Figure 1-Figure 5 .

[0093] Table 1. Phenotypic results of sorghum anthracnose and genotypic results of InDel78535 and InDel78554 in 266 sorghum varieties

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103] The identification results are shown in Tables 1 and 2: A total of 266 varieties were identified, of which 253 were susceptible varieties and only 13 were resistant varieties.

[0104] The first round of genotyping of the sorghum to be tested, using identification primer 1, resulted in 246 susceptible varieties (the banding pattern of PCR product 1 was identical to SEQ ID No. 1, i.e., the In-78535 genotype) and 20 resistant varieties (the banding pattern of PCR product 1 was identical to SEQ ID No. 2, i.e., the Del-78535 genotype). Subsequently, a second round of genotyping, using identification primer 2, was performed on the 20 resistant sorghum varieties classified in the first round, as well as 15 randomly selected varieties from the 246 susceptible sorghum varieties. This resulted in 25 susceptible varieties (the banding pattern of PCR product 2 was identical to SEQ ID No. 5, i.e., the In-78554 genotype) and 13 resistant varieties (the banding pattern of PCR product 2 was identical to SEQ ID No. 6, i.e., the Del-78554 genotype). After two rounds of genotyping, 13 sorghum varieties were ultimately identified as resistant. The identification method developed by the present invention has an accuracy rate of 100% in identifying sorghum anthracnose resistance.

[0105] Table 2. Phenotypic results of sorghum anthracnose and genotypic statistics of InDel78535 and InDel78554 in 266 sorghum varieties

[0106]

[0107] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. A method for identifying the resistance of sorghum varieties to sorghum anthracnose, characterized in that: The following steps are involved: Detecting whether the genomic DNA of the sorghum to be identified contains InDel molecular marker 1 and InD molecular marker 2, wherein the sorghum to be identified whose genomic DNA does not contain the InD molecular marker 1 and molecular marker 2 has stronger or higher resistance to sorghum anthracnose than the sorghum to be identified whose genomic DNA contains the InD molecular marker 1 and molecular marker 2; The InDel molecular marker 1 is a double-stranded DNA molecule whose nucleotide sequence on one chain is positions 43-50 of SEQ ID No. 1; The InDel molecular marker 2 is a double-stranded DNA molecule whose nucleotide sequence on one chain is SEQ ID No.

5.

2. The method according to claim 1, characterized in that The following steps are involved: (1) Using the genomic DNA of the sorghum to be identified as a template, PCR amplification was performed using identification primer set 1 to obtain PCR product 1; (2) identifying the resistance of sorghum to sorghum anthracnose based on whether the PCR product 1 contains the InDel molecular marker 1 described in claim 1, and obtaining the sorghum primary screening variety to be identified with strong resistance; (3) using the genomic DNA of the sorghum variety to be identified obtained in (2) as a template, performing PCR amplification using identification primer set 2 to obtain PCR product 2; (4) identifying the resistance of sorghum to sorghum anthracnose based on whether the PCR product 2 contains the InDel molecular marker 2 described in claim 1, and obtaining the sorghum to be identified with strong resistance, that is, a sorghum variety resistant to sorghum anthracnose; The sorghum to be identified whose PCR product 1 does not contain the InDel molecular marker 1 described in claim 1 has a higher or candidate higher resistance to sorghum anthracnose than the sorghum to be identified whose PCR product contains the InDel molecular marker 1 described in claim 1; The sorghum to be identified whose PCR product 2 does not contain the InDel molecular marker 2 according to claim 1 has a higher or candidate higher resistance to sorghum anthracnose than the sorghum to be identified whose PCR product contains the InDel molecular marker 2 according to claim 1; The identification primer set 1 consists of a forward primer and a reverse primer, wherein the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker 1 in the sorghum genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker 1 in the sorghum genomic DNA; The identification primer set 2 consists of a forward primer and a reverse primer, wherein the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker 2 in the sorghum genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker 2 in the sorghum genomic DNA.

3. The method according to claim 2, wherein: The identification primer set 1 consists of primer F and primer R, the nucleotide sequence of primer F is SEQ ID No.3, and the nucleotide sequence of primer R is SEQ ID No.4; the identification primer set 2 consists of primer F1 and primer R1, the nucleotide sequence of primer F1 is SEQ ID No.7, and the nucleotide sequence of primer R1 is SEQ ID No.

8.

4. The method according to any one of claims 1 to 3, characterized in that The sorghum is a sorghum variety or a sorghum inbred line.

5. Use of InDel molecule markers or detection of substances marked with said InDel molecules, characterized in that: The InDel molecular markers are the InDel molecular markers 1 and InDel molecular marker 2 described in claim 1; and the application is any one of the following: 1) Use of an InDel molecular marker or a substance for detecting the InDel molecular marker in identifying or assisting in identifying sorghum resistance to sorghum anthracnose; 2) Use of InDel molecular markers or substances for detecting said InDel molecular markers in sorghum breeding, wherein the purpose of said breeding is to select sorghum varieties with strong resistance to sorghum anthracnose; The material contains PCR primers for amplifying a sorghum genomic DNA fragment including the InDel molecular marker 1 and the InDel molecular marker 2; the PCR primers are identification primer set 1 and identification primer set 2, the identification primer set 1 consists of primer F and primer R, the nucleotide sequence of primer F is SEQ ID No. 3, and the nucleotide sequence of primer R is SEQ ID No. 4; the identification primer set 2 consists of primer F1 and primer R1, the nucleotide sequence of primer F1 is SEQ ID No. 7, and the nucleotide sequence of primer R1 is SEQ ID No.

8.

6. The use according to claim 5, characterized in that The sorghum is a sorghum variety or a sorghum inbred line.

7. A method for breeding sorghum, comprising selecting sorghum whose genomic DNA does not contain the InDel molecular marker 1 described in claim 1 and does not contain the InDel molecular marker 2 described in claim 1 as a parent for breeding; the purpose of the breeding is to breed sorghum varieties with strong resistance to sorghum anthracnose.

Images