CAPS molecular marker for rapidly screening herbicide-resistant rice and application of CAPS molecular marker

Abstract

The invention relates to the technical field of rice screening molecular markers, in particular to a CAPS molecular marker for rapidly screening herbicide-resistant rice and application of the CAPS molecular marker. The CAPS molecular marker and a herbicide-resistant target gene ACC1 are co-separated, and the CAPS molecular marker comprises an SNP (Single Nucleotide Polymorphism) site and a primer corresponding to the SNP site, wherein the SNP site is positioned at the 5374th site on a nucleotide sequence shown as SEQ ID NO.3, and the basic group of the SNP site is G; the primer can amplify a 267bp strip in rice genome DNA (Deoxyribonucleic Acid), a herbicide-resistant rice amplified strip is subjected to enzyme digestion by incision enzyme to obtain two strips of 89bp and 178bp, and a non-herbicide-resistant rice amplified strip is subjected to enzyme digestion by incision enzyme to obtain a strip of 267bp. The CAPS molecular marker provided by the invention is closely linked with the resistance of the rice herbicide, is suitable for different rice materials, is simple and convenient to operate, and is stable and reliable in result.

Description

Technical Field

[0001] The invention relates to the technical field of rice screening molecular markers, and in particular to a CAPS molecular marker for rapid screening of herbicide-resistant rice and an application thereof. Background Art

[0002] Rice is one of the most important food crops in my country, and its high and stable yield is related to national security and social stability. Weeds are one of the main reasons affecting rice yield and quality. In recent years, with the promotion of simplified cultivation and the expansion of direct-seeding rice area, the problem of rice field weed damage has become more serious. The annual yield loss in my country due to weed damage accounts for about 15%-20%.

[0003] The use of herbicides is the main means of controlling weeds in rice fields. However, most of the herbicides with good effects are of the biocidal type. Improper application often causes varying degrees of phytotoxicity to rice, affecting its growth and yield. In addition, as the amount of herbicides used gradually increases, the problem of resistant weeds in rice fields and high residues in the soil is becoming increasingly serious.

[0004] Breeding rice varieties with herbicide resistance is the most economical and effective measure to prevent and control weed damage in rice fields. At present, although a number of herbicide-resistant rice germplasms have been successfully obtained through natural mutation, physical and chemical mutagenesis and targeted editing, excellent resistant materials are still scarce. Efficient and rapid screening of germplasm resources with resistance to herbicides is an important part of herbicide-resistant rice breeding, but there are very few corresponding molecular markers. Therefore, it is crucial to develop molecular markers that can be used to identify and assist in the selection of rice herbicide resistance. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a CAPS molecular marker for rapid screening of herbicide-resistant rice and its application. The CAPS molecular marker provided by the present invention is closely linked to rice herbicide resistance, is applicable to different rice materials, is simple and easy to operate, and has stable and reliable results. The present invention can identify and screen the herbicide resistance of rice in the seedling stage through the molecular marker-assisted selection method, which greatly reduces the breeding workload and improves the breeding efficiency. The present invention can be used for molecular marker-assisted selection of rice herbicide resistance to accelerate the breeding process.

[0006] To this end, the present invention provides the following technical solutions:

[0007] In a first aspect, the present invention provides a CAPS molecular marker for rapid screening of herbicide-resistant rice in an optional embodiment, wherein the CAPS molecular marker is co-separated with the herbicide-resistant target gene ACC1, and comprises a SNP site at position 5374 of the nucleotide sequence shown in SEQ ID NO.3, in which the base is mutated to G, and a primer corresponding to the SNP site;

[0008] The primers can amplify a band of 267 bp in rice genomic DNA. After the herbicide-resistant rice amplified band is digested with endonuclease, two bands of 89 bp and 178 bp are obtained. After the herbicide-resistant rice amplified band is digested with endonuclease, a band of 267 bp is obtained.

[0009] Preferably, the primers include an upstream primer and a downstream primer;

[0010] The nucleotide sequence of the upstream primer from the 5' end to the 3' end is shown in SEQ ID NO.1;

[0011] The nucleotide sequence of the downstream primer from the 5' end to the 3' end is shown in SEQ ID NO.2.

[0012] In a second aspect, the present invention provides, in an optional embodiment, a CAPS kit for rapid screening of herbicide-resistant rice, comprising the primers of claim 1 or 2, 2×Phanta Mix Master Mix, ddH2O, Rsa I endonuclease, 10×Buffer and agarose gel electrophoresis.

[0013] In a third aspect, the present invention provides, in an optional embodiment, a method for rapidly screening herbicide-resistant rice germplasm, comprising the following steps:

[0014] S1: Extract genomic DNA from the rice germplasm plants to be tested;

[0015] S2: using the genomic DNA as a template and the primers according to claim 1 to perform PCR amplification to obtain a PCR product;

[0016] S3: digesting the PCR product to obtain a digestion product;

[0017] S4: Detect whether the enzyme cleavage product contains bands of 89 bp, 178 bp and 267 bp. When the enzyme cleavage product contains only the band of 267 bp, the corresponding rice germplasm to be tested is non-herbicide-resistant rice. When the enzyme cleavage product contains two bands of 89 bp and 178 bp, the corresponding rice germplasm to be tested is herbicide-resistant rice.

[0018] Preferably, in step S2, the reaction system of the PCR amplification is: 1 μL of genomic DNA template, 1 μL of upstream primer and downstream primer, 10 μL of 2×PhantaMix Master Mix, and 7 μL of ddH2O. The reaction procedure of the PCR amplification is: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s, 35 cycles; 72°C extension for 5 min.

[0019] Preferably, in step S3, the enzyme digestion reaction system is: 6 μL of PCR product, 0.3 μL of endonuclease, 1.5 μL of 10×Buffer, 7.2 μL of ddH2O; and / or, the enzyme digestion reaction conditions are: digestion at 37° C. for 2 hours. The endonuclease used in the enzyme digestion is Rsa I.

[0020] Preferably, in step S4, the method for detecting whether the enzyme digestion product contains bands of 89 bp, 178 bp and 267 bp is: typing by 2% agarose gel electrophoresis.

[0021] In the present invention, ddH2O refers to double distilled water.

[0022] Preferably, the herbicide is an acetyl-CoA carboxylase herbicide.

[0023] The nucleotide sequence of SEQ ID NO.1 is as follows:

[0024] GCACATAAGATGCAGCTAGACA.

[0025] The nucleotide sequence of SEQ ID NO.2 is as follows:

[0026] TAGGCTGGTCAAGACGCTGTA.

[0027] The nucleotide sequence of SEQ ID NO.3 is as follows:

[0028]

[0029] Compared with the prior art, the present invention has one of the following beneficial effects:

[0030] 1. The CAPS molecular marker provided by the present invention is closely linked to rice herbicide resistance, is applicable to different rice materials, is easy to operate, and has stable and reliable results. The present invention can identify and screen the herbicide resistance of rice in the seedling stage through the molecular marker-assisted selection method, which greatly reduces the breeding workload and improves the breeding efficiency. The present invention can be used for rice herbicide resistance molecular marker-assisted selection to accelerate the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The gel electrophoresis diagram of the PCR product of 4 rice materials amplified by CAPS-I1879V-RsaI marker primer in Example 1 of the present invention, the target band is 267bp, M is Trans 2K Plus DNA Marker, from top to bottom are 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp, 1-4 represent 4 rice materials, among which No. 1 and No. 2 are herbicide-sensitive rice, and No. 3 and No. 4 are herbicide-resistant rice materials;

[0032] Figure 2 The figure is a gel electrophoresis diagram of the digestion products obtained after RsaI digestion of PCR products of four rice materials in Example 1 of the present invention, M is Trans 2KPlus DNA Marker, and from top to bottom are 5000bp, 2000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp, respectively, and 1-4 represent four rice materials, among which No. 1 and No. 2 are herbicide-sensitive rice, and No. 3 and No. 4 are herbicide-resistant rice materials. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0035] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0036] Based on the sequence differences of the herbicide target gene ACC1 (see Figure 2), the molecular marker CAPS-I1879V-RsaI was designed, and the primer sequences were designed as follows:

[0037] Upstream primer: The nucleotide sequence from the 5' end to the 3' end is shown in SEQ ID NO.1, SEQ ID NO.1 is G

[0038] CACATAAGATGCAGCTAGACA;

[0039] Downstream primer: The nucleotide sequence from the 5' end to the 3' end is shown in SEQ ID NO.2, and SEQ ID NO.2 is TAGGCTGGTCAAGACGCTGTA.

[0040] Example 1

[0041] This embodiment provides a method for rapidly screening herbicide-resistant rice germplasm, comprising the following steps:

[0042] Four rice materials with different herbicide resistance were selected for verification;

[0043] S1: Extract genomic DNA from 4 rice materials with different herbicide resistance;

[0044] S2: Using the genomic DNA of the rice plant to be tested as a template, PCR amplification reaction was performed using the CAPS-I2139N-Rsa I labeled primer;

[0045] The above PCR reaction was a 20 μL system, specifically: 1 μL of genomic DNA template, 1 μL of upstream and downstream primers, 10 μL of 2×PhantaMix Master Mix, and 7 μL of ddH2O.

[0046] The PCR amplification program of the above PCR reaction was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min;

[0047] S3: Perform Rsa I restriction enzyme digestion reaction on the PCR product obtained in step S2.

[0048] The above enzyme digestion reaction is a 15 μL system, specifically: 6 μL of PCR product, 0.3 μL of Rsa I restriction endonuclease, 1.5 μL of 10× Buffer, and 7.2 μL of ddH2O. The digestion was performed at 37°C for 2 hours to obtain the digestion product;

[0049] S4: Perform 2% agarose gel electrophoresis typing test on the enzyme cleavage product obtained in step S3. If the enzyme cleavage product has only one 267 bp fragment, the material to be tested is non-herbicide resistant rice; if the enzyme cleavage product contains two bands of 89 bp and 178 bp, the material to be tested is herbicide resistant rice. The names of the selected rice materials and their herbicide resistance (results of the herbicide spraying test at the seedling stage) are shown in Table 1 and Figure 1 shown.

[0050] Table 1 Names and herbicide resistance of four rice materials

[0051] Serial number Material type Herbicide resistance 1 NIP variety Herbicide 2 NJ9108 variety Herbicide 3 376-15-3 variety Herbicide resistance 4 376-15-3 variety Herbicide resistance

[0052] The genomic DNA of the four rice materials in step S2 of this example all amplified a 267 bp fragment using CAPS labeled primers (see the results). Figure 2 ).

[0053] The RsaI digestion product obtained in step S3 was detected by agarose gel electrophoresis. The detection result is as follows: Figure 2 As shown in Table 1, Figure 1 and Figure 2 It can be seen that rice materials No. 1 and No. 2 are not resistant to herbicide spraying, and their PCR products have only one 267bp band after RsaI digestion, which are identified as herbicide-sensitive rice; rice No. 3 and No. 4 are resistant to herbicide spraying, and their PCR products have two bands of 89bp and 178bp after RsaI digestion, which are identified as herbicide-resistant rice. This shows that the rice herbicide resistance CAPS marker of the present invention and its application can identify and screen the resistance of rice to herbicides, and has good application value.

[0054] Although the principles of the present invention are described in detail above in conjunction with the preferred embodiments of the present invention, those skilled in the art should understand that the above embodiments are merely explanations of the exemplary implementations of the present invention, and are not intended to limit the scope of the present invention. The details in the embodiments do not constitute limitations on the scope of the present invention, and any obvious changes such as equivalent transformations, simple replacements, etc. based on the technical solution of the present invention, without departing from the spirit and scope of the present invention, fall within the protection scope of the present invention.

Claims

1. A CAPS molecular marker for rapid screening of herbicide-resistant rice, characterized in that: The CAPS molecular marker is co-separated with the herbicide resistance target gene ACC1, and includes a SNP site at position 5374 of the nucleotide sequence shown in SEQ ID NO.3, in which the base is mutated to G, and a primer corresponding to the SNP site; The primers can amplify a band of 267 bp in rice genomic DNA. After the herbicide-resistant rice amplified band is digested with endonuclease, two bands of 89 bp and 178 bp are obtained. After the herbicide-resistant rice amplified band is digested with endonuclease, a band of 267 bp is obtained.

2. The CAPS molecular marker for rapid screening of herbicide-resistant rice according to claim 1, characterized in that: The primers include an upstream primer and a downstream primer; The nucleotide sequence of the upstream primer from the 5' end to the 3' end is shown in SEQ ID NO.1; The nucleotide sequence of the downstream primer from the 5' end to the 3' end is shown in SEQ ID NO.

2.

3. A CAPS kit for rapid screening of herbicide-resistant rice, characterized in that: The method comprises the primers according to claim 1 or 2, 2×PhantaMix MasterMix, ddH2O, RsaI endonuclease, 10×Buffer and agarose gel electrophoresis.

4. A method for rapid screening of herbicide-resistant rice germplasm, characterized in that: The following steps are involved: S1: Extract genomic DNA from the rice germplasm plants to be tested; S2: using the genomic DNA as a template and the primers according to claim 1 to perform PCR amplification to obtain a PCR product; S3: digesting the PCR product to obtain a digestion product; S4: Detect whether the enzyme cleavage product contains bands of 89 bp, 178 bp and 267 bp. When the enzyme cleavage product contains only the band of 267 bp, the corresponding rice germplasm to be tested is non-herbicide-resistant rice. When the enzyme cleavage product contains two bands of 89 bp and 178 bp, the corresponding rice germplasm to be tested is herbicide-resistant rice.

5. The method for rapid screening of herbicide-resistant rice germplasm according to claim 4, characterized in that: In step S2, the reaction system of the PCR amplification is: 1 μL of genomic DNA template, 1 μL of upstream primer and 1 μL of downstream primer, 10 μL of 2×PhantaMix MasterMix, and 7 μL of ddH2O.

6. The method for rapid screening of herbicide-resistant rice germplasm according to claim 4, characterized in that: In step S2, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min.

7. The method for rapid screening of herbicide-resistant rice germplasm according to claim 4, characterized in that: In step S3, the enzyme digestion reaction system is: 6 μL of PCR product, 0.3 μL of endonuclease, 1.5 μL of 10×Buffer, 7.2 μL of ddH2O; and / or, The reaction conditions of the enzyme digestion are: digestion at 37° C. for 2 hours.

8. The method for rapid screening of herbicide-resistant rice germplasm according to claim 4, characterized in that: In step S3, the endonuclease used for the enzymatic cleavage is Rsa I.

9. The method for rapid screening of herbicide-resistant rice germplasm according to claim 4, characterized in that: In step S4, the enzyme digestion product is detected to see whether it contains bands of 89 bp, 178 bp and 267 bp: typing is performed by 2% agarose gel electrophoresis.

10. The method for rapid screening of herbicide-resistant rice germplasm according to claim 3, characterized in that: The herbicide is an acetyl-CoA carboxylase herbicide.

Images