A method for constructing a macrophage-specific fluorescent reporter mouse model
By inserting the Cre-P2A-mCherry element into the mouse C1qc gene locus using CRISPR/Cas9 gene editing technology, a macrophage-specific fluorescent reporter mouse model was constructed. This solved the problem of difficulty in real-time tracking of macrophage function in existing technologies, and enabled efficient tracking and functional studies of microglia and spleen macrophages.
Patent Information
- Application Number
- CN202411024443.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-29
- Publication Date
- 2026-07-28
- Estimated Expiration
- 2044-07-29
AI Technical Summary
Existing technologies make it difficult to construct animal models that can track and study macrophage function in different tissues and organs in real time, especially microglia and macrophage subpopulations in the spleen.
Using CRISPR/Cas9 genome editing technology, the Cre-P2A-mCherry element was inserted into the mouse C1qc gene site to construct a macrophage-specific fluorescent reporter mouse model, realizing that the expression of Cre and mCherry is driven by the C1qc promoter. Flow cytometry was used to verify that mCherry is highly expressed in microglia in mouse brains and macrophages in spleen.
This study enabled specific tracing of microglia and splenic macrophages, providing an animal model for studying their functions and laying the foundation for research on complex immune functions in the body.
Smart Images

Figure CN119214127B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for constructing a macrophage-specific fluorescent reporter mouse model, belonging to the field of genetic engineering and genetic modification technology. Background Technology
[0002] Macrophages are immune cells in the body that perform phagocytic activity. Essentially, they are white blood cells located within tissues, participating in both non-specific defense (innate immunity) and specific defense (cell-mediated immunity) in vertebrates. Their main functions are to clear cellular debris and engulf invading pathogens as fixed or free cells, and to activate lymphocytes or other immune cells to respond to pathogens. Macrophages are immune cells with multiple functions and are important subjects in the study of phagocytosis, cell-mediated immunity, and analytical immunology.
[0003] However, macrophages are a highly heterogeneous cell population, exhibiting unique phenotypes and functions in different tissues and organs and in complex microenvironments. For example, microglia are macrophages residing in the central nervous system (CNS) that can rapidly initiate immune responses in the event of tissue damage or disease, mainly by presenting antigens, secreting pro-inflammatory or anti-inflammatory cytokines and chemokines, and phagocytizing pathogens or apoptotic cells. The most prevalent macrophages in the liver are hepatic resident macrophages (KCs), which possess innate immune functions, maintain immune tolerance, clear pathogens, and undergo functional differentiation upon stimulation by different signals, subsequently activating pro-inflammatory responses. The most prevalent macrophage population in the spleen is red pulp macrophages (RPMs), which are located in the red pulp of the spleen. Their main function is to clear senescent red blood cells and play a role in controlling infection and inducing innate and adaptive immunity. Therefore, in order to further study the function of macrophages in different tissues and organs and to achieve real-time tracking of them, it is essential to construct a macrophage-specific fluorescent reporter mouse genetic model, which is of great significance for macrophage function research. Summary of the Invention
[0004] The purpose of this invention is to provide a method for constructing a macrophage-specific fluorescent reporter mouse model, providing a mouse model that can trace microglia in the mouse brain and macrophage subsets in the spleen, thus providing an alternative to the prior art.
[0005] To achieve the above objectives, the technical solution of the present invention for constructing a macrophage-specific fluorescent reporter mouse model is as follows: A method for constructing a macrophage-specific fluorescent reporter mouse model includes the following steps: using CRISPR / Cas9 genome editing technology, the Cre-P2A-mCherry element is inserted into the mouse C1qc gene locus at a specific site to obtain a macrophage-specific fluorescent reporter mouse model.
[0006] The beneficial effects of the above technical solution are as follows: The method for constructing a macrophage-specific fluorescent reporter mouse model is a pioneering invention. This invention, for the first time, uses CRISPR / Cas9 genome editing technology to edit the C1qc gene locus, obtaining a novel C1qc-CreChy gene knock-in mouse model (i.e., a macrophage-specific fluorescent reporter mouse model). This model demonstrates that the expression of Cre and mCherry is directly driven by the C1qc promoter. Flow cytometry verified that mCherry expression is high only in microglia in the mouse brain and macrophages in the spleen, while mCherry expression was not detected in other immune cells. This allows for the tracking of these two types of macrophages for studying their function. This invention provides a usable animal model for studying macrophage heterogeneity and a novel animal model for studying complex immune functions in the body.
[0007] Furthermore, the mouse model prepared by this invention can be used to create a mouse model with conditional gene knockout in macrophages, laying the foundation for studying complex immune functions and immune changes in vivo.
[0008] As a further improvement, the target sequence of the mouse C1qc gene locus is: C1qc-sgRNA: 5'-TGGGTCCAACGACCATCCTGAGG-3' (shown in SEQ ID NO.1).
[0009] The beneficial effects of the above technical solution are that the above sgRNA can be used to achieve stable, successful and efficient knock-in of gene elements, laying the foundation for the successful construction of mouse models.
[0010] Furthermore, this invention inserts the Cre-P2A-mCherry element directly after the start codon and before exon 1 of the C1qc gene. Compared with the traditional method of inserting the expression element directly before the stop codon, this invention can ensure higher expression levels of Cre and mCherry without disrupting the expression of the internal gene C1qc, resulting in better Cre activity and higher fluorescence intensity of mCherry.
[0011] As a further improvement, the Cre-P2A-mCherry element also includes a 5' homologous arm sequence and a 3' homologous arm sequence.
[0012] As a further improvement, the nucleotide sequence of the Cre-P2A-mCherry element is shown in SEQ ID NO.2.
[0013] As a further improvement, during site-specific insertion, Cas9 mRNA, sgRNA, and Cre-P2A-mCherry element DNA were mixed and injected into mouse zygotes. The surviving zygote cells were then transplanted into the fallopian tubes of pseudopregnant mice to obtain Founder mice.
[0014] As a further improvement, the construction method includes genotyping Founder mice, screening out mouse individuals with Cre-P2A-mCherry element sequence insertion in their genome and correct insertion site, and obtaining a macrophage-specific fluorescent reporter mouse model. Attached Figure Description
[0015] Figure 1 This refers to the C1qc-CreChy gene knock-in mouse construction strategy in Example 1 of this invention; Figure 2 The sequencing results of the C1qc-CreChy gene knock-in mouse in Example 1 of this invention; Figure 3 This is an example of the detection of mCherry expression in the spleen of C1qc-CreChy gene knock-in mice in Example 2 of the present invention (wherein, (A) is a schematic diagram of the gating of different cell populations in the spleen of C1qc-CreChy gene knock-in mice detected by flow cytometry; (B) is a superimposed diagram of the peaks of mCherry expression levels in B cells, neutrophils, monocytes and macrophages in the spleen of C1qc-CreChy gene knock-in mice). Figure 4 This diagram illustrates the gates of different cell populations in the brain of a C1qc-CreChy gene knock-in mouse in Example 3 of this invention, and shows the expression level of mCherry in different cell populations. Detailed Implementation
[0016] Macrophages are important immune cells in mammals, exhibiting strong heterogeneity. They display unique phenotypes and functions in different tissues and organs, as well as in complex microenvironments. Therefore, constructing an animal model capable of real-time tracking of macrophages is of great significance for studying the function of macrophages in different tissues and organs. Based on this, this invention provides a method for constructing a macrophage-specific fluorescent reporter mouse model.
[0017] Based on extensive prior research, this invention has discovered that the C1qc gene is specifically expressed in mouse brain microglia and spleen red pulp macrophages, suggesting its potential as a marker for real-time macrophage tracking. Subsequently, this invention first edited the C1qc gene locus using CRISPR / Cas9 genome editing technology to obtain a C1qc-CreChy gene knock-in mouse model. Then, flow cytometry was used to analyze the expression pattern of mCherry in this model (i.e., a macrophage-specific fluorescent reporter mouse model). The results showed that mCherry expression was high only in spleen macrophages and brain microglia, while no mCherry expression was detected in other cell populations. This demonstrates that the C1qc-CreChy gene knock-in mouse model can also achieve specific expression of Cre recombinase in these two types of macrophages. The construction of this macrophage-specific mCherry fluorescent reporter mouse genetic model provides a better animal genetic model for elucidating the function of macrophages in various diseases.
[0018] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto; however, these embodiments are merely examples and do not constitute any limitation on the scope of the present invention. Modifications or substitutions to the details and form of the present invention can be made without departing from the spirit and scope of the present invention, but such modifications and substitutions all fall within the scope of protection of the present invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, such as those described in Sambrook et al.'s *Molecular Cloning: A Laboratory Manual* (Sambrook J & Russell DW. *Molecular Cloning: A Laboratory Manual*. 2001), or the instructions provided by the product manufacturer. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent manufacturers.
[0019] A specific embodiment of the method for constructing a macrophage-specific fluorescent reporter mouse model according to the present invention: This invention, for the first time, utilizes CRISPR / Cas9 genome editing technology to edit the C1qc gene locus, resulting in a novel C1qc-CreChy gene knock-in mouse model. This model demonstrates that the expression of Cre and mCherry is directly driven by the C1qc promoter. Flow cytometry analysis confirmed that mCherry expression is highly concentrated only in microglia of the mouse brain and macrophages of the spleen, while mCherry expression is undetectable in other immune cells. This allows for the tracking of these two types of macrophages for functional studies. The specific implementation steps are as follows: Example 1: Construction of the C1qc-CreChy gene knock-in mouse model This embodiment designs a targeting sgRNA for the mouse C1qc start codon site and synthesizes a homologous recombination template. After injecting the sgRNA into mouse zygotes, homologous recombination allows the template to be inserted into the target site, thus completing the construction of the C1qc-CreChy gene knock-in mouse. The specific steps include the following: 1. Determination of the firing sequence In the early stages of this invention, a large number of experiments and analyses were conducted, and it was found that the C1qc gene is expressed only in mouse brain microglia and spleen red pulp macrophages, but not in other immune cells. Therefore, the C1qc gene was selected as the gene editing site.
[0020] To insert the Cre-P2A-mCherry element into the C1qc gene site for simultaneous expression of Cre and mCherry with C1qc, a target site was designed near the start codon of the C1qc gene. Using the online design website CRISPOR (http: / / crispor.tefor.net / ), one sgRNA was designed (selected based on proximity to the start codon, high specificity, and high efficiency). The sgRNA sequence is as follows: C1qc-sgRNA: 5'-TGGGTCCAACGACCATCCTGAGG-3' (shown in SEQ ID NO.1).
[0021] 2. Obtaining recombinant template DNA Design a recombinant template DNA sequence containing the following elements, such as Figure 1 As shown: (1) 5' homologous arm and 3' homologous arm sequences: Homologous arms serve as templates in the process of homologous recombination, ensuring that the foreign DNA sequence is accurately inserted into the target site; (2) P2A linker sequence: By inserting the P2A peptide sequence between two genes, the protein can be automatically cleaved during translation, thereby enabling the independent expression of multiple proteins. In the example, by inserting P2A between the Cre, mCherry, and C1qc genes, it can be ensured that the three genes of Cre, mCherry, and C1qc can be translated and cleaved normally to form three independent proteins, each performing its normal biological function. Without the P2A sequence, the three genes of Cre, mCherry, and C1qc would translate into one large protein, unable to perform its normal biological function; (3) Cre sequence: Cre recombinase is an enzyme protein derived from bacteriophage P1 with a molecular weight of about 38 kDa. It has the ability to recognize and catalyze homologous recombination between two LoxP sites, thereby leading to DNA deletion, translocation and other phenomena. (4) mCherry sequence: mCherry is a red fluorescent dye widely used in biotechnology. It is mainly used as a tracer, including molecular labeling and cellular component localization. This dye is not only used for live cell imaging and tracking experiments, but also as a reporter gene to study the level and pattern of gene expression.
[0022] The nucleotide sequence of the recombinant template DNA is shown in SEQ ID NO.2. Specifically, positions 1-752 from the 5' end are the 5' homologous arm sequence; positions 753-1805 from the 5' end are the Cre sequence; positions 1806-1871 from the 5' end are the P2A linker sequence; positions 1872-2579 from the 5' end are the mCherry sequence; positions 2580-2645 from the 5' end are the P2A linker sequence; and positions 2646-3399 from the 5' end are the 3' homologous arm sequence. Synthesized and provided by Genscript Biotech Inc.
[0023] 3. Microinjection Founder mice with C1qc-CreChy gene knock-in were obtained via microinjection: Cas9 mRNA, sgRNA, and recombinant template DNA were mixed to a final concentration of sgRNA (50 ng / µL), Cas9 mRNA (50 ng / µL), and template DNA (10 ng / µL). This mixture was then injected into the pronucleus of mouse zygotes using a microinjection system. The sgRNA guided the Cas9 protein to cleave the DNA double strand at the target site, creating a DNA double-strand break. In the presence of homologous recombinant template DNA, the body utilizes its own HDR repair mechanism to repair the broken DNA double strand, thereby allowing the exogenous DNA sequence to be inserted at the target site. The surviving zygotes were then transplanted into the oviducts of pseudopregnant mice, and Founder mice were obtained 20 days later.
[0024] 4. C1qc-CreChy gene knock-in mouse sequencing verification After the Founder mice are separated into different cages, the genomic DNA of the Founder mice from step 3 is obtained, and the target sequence is amplified by PCR using primers.
[0025] The primer sequences used for PCR are as follows: F: ATGGATGTTTCTAGACTAAGGCCC (shown in SEQ ID NO.3); R: GAAAGCACCCACACTCATAAAGG (shown in SEQ ID NO. 4).
[0026] The PCR system is as follows: 0.2 μL each of F and R primers, 5 μL of 2×Phusion Flash II DNA polymerase (ThermoFisher Scientific: F548S), 1 μL of genomic DNA, and H2O added to a total volume of 10 μL.
[0027] The PCR reaction procedure was as follows: pre-denaturation at 98℃ for 10 seconds; denaturation at 98℃ for 10 seconds, annealing at 60℃ for 30 seconds, extension at 72℃ for 60 seconds, for 35 cycles; termination reaction at 72℃ for 10 minutes.
[0028] The target amplified band size was 3545 bp. PCR products containing the target amplified band were sent for sequencing (Wuhan Jinkairui Biotechnology Co., Ltd.). Individuals with the correct insertion of the target sequence were selected, which became the C1qc-CreChy gene knock-in model mice. Sequencing results showed that the target insertion sequence was completely correct, and the insertion site perfectly matched the designed site (e.g., ...). Figure 2 As shown in the figure, this indicates that the above method successfully constructed the C1qc-CreChy gene knock-in mouse model.
[0029] Example 2: Detection of mCherry expression in the spleen of C1qc-CreChy gene knock-in mice This embodiment uses the C1qc-CreChy gene knock-in mouse constructed in Example 1 as the research object. Spleen tissue was obtained by dissection, and single-cell suspension was obtained. Immune cells were labeled with specific antibodies, and then the expression level of mCherry in different cells was detected by flow cytometry. The specific steps are as follows: The C1qc-CreChy gene knock-in mouse constructed in Example 1 was dissected to obtain spleen tissue. The spleen tissue was thoroughly ground, and then the cells were filtered through a 70 μm pore size filter to obtain a single-cell suspension of spleen cells.
[0030] Cells were counted, and 1 million spleen cells were collected. 100 μL of an antibody mixture (antibodies included: anti-CD45 APC-eFluor780, anti-CD5 eFlour450, anti-CD19PerCP-Cy5.5, anti-Ly6G Alexa700, anti-CD115 Super Bright 600, anti-F4 / 80 PE-Cy7, and anti-CD11b FITC) was added, mixed thoroughly, and incubated on ice in the dark for 30 min. Cells were then washed once with 1000 μL of FACS buffer (containing 2 mM EDTA). Finally, cells were resuspended in FACS buffer containing Sytox Blue. Data were acquired using a flow cytometer (ThermoFisher Scientific, USA) and further analyzed using Flowjo 10.0 software.
[0031] Specific test results are as follows: Figure 3 As shown, CD19 + For B cells, Ly6G + Neutrophils, CD11b + CD115 + Monocyte, CD11b - F4 / 80 + For macrophages ( Figure 3 A). The results showed that mCherry expression was not detected in B cells, neutrophils, monocytes, and macrophages in the spleen of wild-type mice; mCherry expression was also not detected in B cells, neutrophils, and monocytes in the spleen of C1qc-CreChy knock-in mice, but a high level of mCherry expression was detected in macrophages. Figure 3 B).
[0032] Example 3: Detection of mCherry expression in the brains of C1qc-CreChy gene knock-in mice This embodiment uses the C1qc-CreChy gene knock-in mouse constructed in Example 1 as the research object. Brain tissue was obtained from the mouse through dissection, and single-cell suspensions of immune cells were obtained. The immune cells were labeled with specific antibodies, and then the expression level of mCherry in different cell populations was detected by flow cytometry. The specific steps include the following: The C1qc-CreChy gene knock-in mouse constructed in Example 1 was dissected to obtain brain tissue, which was placed in a digestion solution containing collagenase IV and DNase-I. The tissue was then thoroughly ground using gentleMACS. The sample was placed on a shaker at 37°C for 200 RPM for 15 minutes. After digestion, the cells were centrifuged using Percoll at a gradient density, and the cells in the middle white membrane layer were retained. The cells were then filtered through a 70 μm pore size filter to obtain a single-cell suspension of brain immune cells.
[0033] Cells were counted, and 200,000 cells were collected. 100 μL of an antibody mixture (antibodies included: anti-CD45 APC-eFluor780, anti-Ly6C eFlour450, anti-F4 / 80 PE-Cy7, and anti-CD11b APC) was added, mixed thoroughly, and incubated on ice in the dark for 30 min. Then, 1000 μL of FACS buffer (containing 2 mM EDTA) was added to wash the cells once. Finally, the cells were resuspended in FACS buffer containing sytox blue. Data were acquired using an Attune flow cytometer (Thermo Fisher Scientific, USA) and further analyzed using Flowjo 10.0 software.
[0034] Specific test results are as follows: Figure 4 As shown, CD11b is expressed in CD45. - F4 / 80 + Ly6C - The cells in the study were microglia. The results showed that mCherry expression was undetectable in microglia of wild-type mice; however, high levels of mCherry expression were detected in microglia of C1qc-CreChy knock-in mice.
[0035] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A method for constructing a macrophage-specific fluorescent reporter mouse model, characterized in that: Includes the following steps: Using CRISPR / Cas9 genome editing technology, Cre-P2A-mCherry elements were specifically inserted into the mouse C1qc gene locus to obtain a fluorescent reporter mouse model of spleen macrophages and brain microglia. The target sequence of the mouse C1qc gene locus is as follows: C1qc-sgRNA: 5'-TGGGTCCAACGACCATCCTGAGG-3', as shown in SEQ ID NO.
1.
2. The method for constructing a macrophage-specific fluorescent reporter mouse model according to claim 1, characterized in that: The Cre-P2A-mCherry element also includes a 5' homologous arm sequence and a 3' homologous arm sequence.
3. The method for constructing a macrophage-specific fluorescent reporter mouse model according to claim 2, characterized in that: The nucleotide sequence of the Cre-P2A-mCherry element is shown in SEQ ID NO.
2.
4. The method for constructing a macrophage-specific fluorescent reporter mouse model according to claim 3, characterized in that: During targeted insertion, Cas9 mRNA, sgRNA, and Cre-P2A-mCherry element DNA were mixed and injected into mouse zygotes. The surviving zygote cells were then transplanted into the fallopian tubes of pseudopregnant mice to obtain Founder mice.
5. The method for constructing a macrophage-specific fluorescent reporter mouse model according to claim 4, characterized in that: The construction method includes genotyping Founder mice, screening out mouse individuals with Cre-P2A-mCherry element sequence insertion in their genome and correct insertion site, and obtaining a macrophage-specific fluorescent reporter mouse model.