Application of MDH2 gene and its inhibitor in resisting ZEA toxin

Abstract

The present invention discloses the application of the MDH2 gene and its inhibitors in resisting ZEA toxin, which relates to the field of biotechnology. In the present invention, a cell line lacking the MDH2 gene was obtained through CRISPR gene editing. Compared with the cells expressing the wild-type MDH2 gene, under the influence of ZEA, the cell viability was extremely significantly improved, and the apoptosis rate of the cells was extremely significantly reduced. In addition, inhibiting the MDH2 activity of wild-type IPEC-J2 cells with the LW6 inhibitor can also improve the tolerance of the cells to ZEA. Thus, knocking out, mutating or inhibiting the activity of the MDH2 gene can improve the ability of humans, animals and plants to resist ZEA. The present invention provides a potential solution to solve the adverse reactions caused by ZEA.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to application of MDH2 gene and its inhibitor in resisting ZEA toxin. Background Art

[0002] Mycotoxin contamination is an environmental problem that cannot be ignored, especially in some humid, temperate regions, which provide good conditions for the growth of fungi. It is estimated that about 25% of crops worldwide are contaminated with mycotoxins. Zearalenone (ZEA), with a chemical formula of C 18 H 22 O5 is a non-steroidal estrogenic mycotoxin produced mainly by Fusarium species such as Rose Fusarium, Fusarium graminearum and Fusarium tricyclicum through secondary metabolic pathways. It is widely found in cereals such as wheat, corn, sorghum, barley, soybeans and dairy products. ZEA contamination of crops is a serious problem worldwide. As one of the most polluting mycotoxins, ZEA has caused huge economic losses. In addition to the significant economic losses of crops, mycotoxins also frequently contaminate food and animal feed. In the list of carcinogens published by the World Health Organization's International Agency for Research on Cancer in 2017, toxins (zearalenone, deoxynivalenol, zearalenol and fusarone X) derived from Fusarium graminearum, Fusarium culmorum and Fusarium cruzi were listed.

[0003] Studies have shown that ZEA has strong mutagenicity, teratogenicity, neurotoxicity, reproductive toxicity and carcinogenicity in animals and humans, and can cause hepatotoxicity, immunotoxicity, hematotoxicity and genotoxicity. ZEA can induce oxidative stress, mitochondrial damage and apoptosis, leading to cell death. It is cytotoxic by inhibiting cell viability and apoptosis, and induces stress response in different cultured cell lines. Oxidative damage is the main cause of cell damage and cell death. It can also produce reactive oxygen species (ROS) in mammals, inhibit the activity and expression of antioxidant enzymes, and lead to apoptosis.

[0004] ZEA has estrogen effects, mainly acting on the reproductive system, competing with the 17-β estrogen receptor in humans and animals, causing hyperestrogenism in livestock and experimental mice, triggering a series of reproductive toxicity, genetic toxicity, carcinogenic toxicity and immunotoxicity, and can cause miscarriage, stillbirth and malformation in pregnant animals or humans who ingest ZEA. Studies have shown that among different livestock, pigs are highly sensitive to the effects of ZEA through contaminated feed. Corn is the main energy feed in pig diets and is very susceptible to contamination by Fusarium toxins. Therefore, the harm of ZEA has a significant impact on the health and economic benefits of livestock and poultry and human food safety. It is necessary to develop drugs to improve tolerance to ZEA. Summary of the invention

[0005] The object of the present invention is to provide the application of the MDH2 gene and its inhibitor in resisting ZEA toxin to solve the problems existing in the above-mentioned prior art. The present invention discovers through research that knocking out, mutating or down-regulating the expression of the MDH2 gene can improve the ability of humans, animals and plants to resist ZEA, and the present invention provides a potential solution to solve the adverse reactions caused by ZEA.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides the application of an MDH2 inhibitor in the preparation of a drug for improving the tolerance of an organism to the toxicity of zearalenone.

[0008] Further, the organism is a pig; the CDS sequence of the MDH2 gene is as shown in SEQ ID NO.1.

[0009] Further, the MDH2 inhibitor is LW6.

[0010] Further, the MDH2 inhibitor is a CRISPR / Cas9 gene editing system that knocks out the MDH2 gene.

[0011] The present invention also provides the application of an MDH2 inhibitor in cultivating a pig breed tolerant to the toxicity of zearalenone, and the MDH2 inhibitor is a CRISPR / Cas9 gene editing system that knocks out the MDH2 gene;

[0012] The CDS sequence of the MDH2 gene is as shown in SEQ ID NO.1.

[0013] The present invention also provides the application of an MDH2 inhibitor in improving the tolerance of IPEC-J2 cells to the toxicity of zearalenone.

[0014] Further, the MDH2 inhibitor is LW6.

[0015] Further, the MDH2 inhibitor is a CRISPR / Cas9 gene editing system that knocks out the MDH2 gene.

[0016] The present invention also provides a method for improving the tolerance of IPEC-J2 cells to the toxicity of zearalenone, including the steps described in the following (1) or (2):

[0017] (1) Knock out the MDH2 gene of the IPEC-J2 cells; the CDS sequence of the MDH2 gene is as shown in SEQ ID NO.1;

[0018] (2) Cultivate the IPEC-J2 cells with a culture solution containing LW6.

[0019] Furthermore, the MDH2 gene was knocked out using the CRISPR / Cas9 gene editing system.

[0020] The present invention discloses the following technical effects:

[0021] The present invention obtained a cell line lacking the MDH2 gene through CRISPR gene editing. Compared with wild-type MDH2 gene-expressing cells, under the influence of ZEA, the cell viability was extremely significantly increased, and the apoptosis rate was extremely significantly decreased. In addition, inhibiting the MDH2 activity of wild-type IPEC-J2 cells with the LW6 inhibitor can also improve the tolerance of cells to ZEA. Thus, knocking out, mutating or inhibiting the activity of the MDH2 gene can improve the anti-ZEA ability of humans, animals and plants. The present invention provides a potential solution to solve the adverse reactions caused by ZEA. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0023] Figure 1 It is the vector map of pSpCas9-2A-Puro (PX459) V2.0;

[0024] Figure 2 It is the plasmid sequencing map of PX459 (MDH2-sgRNA);

[0025] Figure 3 It is the CRISPR target site sequencing peak map of wild-type IPEC-J2 cell line of MDH2;

[0026] Figure 4 It is the CRISPR target site sequencing peak map of MDH2 mutant IPEC-J2 cell line (MDH2-KO);

[0027] Figure 5 It is the sequence alignment map of wild-type and mutant monoclonal cell lines (MDH2-KO) of MDH2 in IPEC-J2 cells;

[0028] Figure 6 It is the statistical chart of cell viability detection results of different experimental groups;

[0029] Figure 7 It is the statistical chart of cell apoptosis rate of different experimental groups. DETAILED DESCRIPTION OF THE INVENTION

[0030] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and implementation schemes of the present invention.

[0031] It should be understood that the terms described in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0032] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0033] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0034] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0035] Term Explanation:

[0036] The MDH2 gene refers to the gene of malate dehydrogenase 2;

[0037] LW6 is an inhibitor of MDH2, with the CAS number 934593-90-5, and the structural formula is as follows:

[0038]

[0039] Example 1

[0040] 1. Experimental Method

[0041] 1.1 Construction of Knockout Vector

[0042] Design and synthesize the DNA sequences of sgRNA shown in Table 1 for the exons (within the open reading frame ORF) of the MDH2 gene (NCBI Gene ID: 397039). The sgRNA target site is located in the exon region (9126..9203) of the porcine MDH2 gene. Add CACCG to the 5' end of the DNA sequence of sgRNA to form the forward Oligo DNA (MDH2-F), and add C to the 5' end and CAAA to the 3' end of the reverse Oligo DNA (MDH2-R). After annealing the forward and reverse DNA strands, the double-stranded DNA fragment with reverse complementarity is cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector shown in Figure 1 to construct a plasmid that co-expresses sgRNA and Cas9 protein. The constructed vector is sent to Tsingke for sequencing using the U6 promoter.

[0043] The specific steps are as follows:

[0044] Table 1 Forward and reverse DNA strands of sgRNA

[0045] Name DNA sequence (5'-3') Sequence number MDH2-F CACCGCCCGTCATTGGCGGCCACGC SEQ ID NO.3 MDH2-R CGGGCAGTAACCGCCGGTGCGCAAA SEQ ID NO.4

[0046] (1) Anneal the above forward Oligo DNA (MDH2-F) and reverse Oligo DNA (MDH2-R) to form dsDNA. The reaction system is shown in Table 2.

[0047] Table 2 Annealing reaction system

[0048] Reagent Dosage Reverse Oligo (100 μM) 1 μL Forward Oligo (100 μM) 1 μL 10×T4 Ligation Buffer 1 μL <![CDATA[H2O]]> 6.5 μL T4PNK (10 U / μL) 0.5 μL Total amount 10 μL

[0049] Mix the reaction system in Table 2, centrifuge, and place it in a PCR reaction instrument. React according to the following reaction program: 37°C for 30 min; 95°C for 5 min, gradually cool to 25°C at a rate of 5°C / min.

[0050] (2) Take the annealed dsDNA and ligate it to the pSpCas9-2A-Puro (PX459) V2.0 vector. The ligation system is shown in Table 3.

[0051] Table 3 Ligation system

[0052]

[0053]

[0054] Place the ligation system in Table 3 in a PCR reaction instrument and react according to the following reaction program: 37°C for 5 min; 23°C for 5 min, for 25 cycles.

[0055] (3) Transformation and screening and identification of PX459(MDH2-sgRNA) positive clones

[0056] Take 2 μL of the ligation product from the above step (2), add it to the competent cells, and place it on ice for 30 min; heat shock in a 42 °C water bath for 90 s; place it on ice to cool for 5 min, add 500 μL of LB liquid medium without Amp to the tube, mix well, and culture it with shaking at 37 °C for 1 h to allow the bacteria to return to the normal growth state and express the Amp resistance gene encoded by the plasmid; take 100 μL of the above bacterial liquid and spread it evenly on the LB solid culture plate containing Amp, place it face up until the bacterial liquid is completely absorbed by the medium, invert the culture dish and culture it at 37 °C for 16 h.

[0057] Use a sterilized pipette tip to pick several single colonies and inoculate them into 1 mL of LB liquid medium containing Amp, culture at 37 °C and 200 rpm for 2 h; design primers, identify positive clones by PCR, and send them to Tsingke for sequencing using the U6 promoter. The sequencing map of the PX459(MDH2-sgRNA) plasmid is shown in Figure 2 . The PCR primers are shown in Table 4 below.

[0058] Table 4 PCR identification primer sequences

[0059] Name DNA sequence (5'-3') Sequence number ZT-MDH2-F GATACAAGGCTGTTAGAGAGATAATT SEQ ID NO.5 ZT-MDH2-R AAACGGGCAGTAACCGCCGGTGCGC SEQ ID NO.6

[0060] 1.2 Construction of MDH2 gene knockout cell line

[0061] Use an electroporator for transient transfection to transfer the above constructed knockout vector PX459(MDH2-sgRNA) into IPEC-J2 cells. Continuously screen with complete medium containing 4 μg / mL puromycin for 7 d, and replace the fresh complete medium containing puromycin every two days. Subsequently, perform monoclonal dilution, transfer the obtained monoclonal cells from the 96-well plate to the 24-well plate for further expansion culture, extract the genomic DNA of different monoclonal cells, design primers for the region containing sgRNA, and perform high-fidelity PCR. Send the PCR product to Sangon for sequencing. The MDH2 gene mutant IPEC-J2 cells are named MDH2-KO.

[0062] The CRISPR target site sequencing peak maps of the MDH2 wild-type IPEC-J2 cell line and the MDH2 mutant IPEC-J2 cell line (MDH2-KO) are shown in Figure 3 and Figure 4 respectively, and the sequence alignment map of the two cells is shown in Figure 5 .

[0063] 1.3 Cell viability identification

[0064] The experiment was divided into a control group (IPEC-J2), an MDH2 inhibition group (IPEC-J2+LW6), and an MDH2 gene mutant group (MDH2-KO). Normal IPEC-J2 cells and MDH2 gene mutant (MDH2-KO) cell lines were seeded into a 96-well culture plate at a density of 2×10 4 per well and cultured overnight. On the next day, the cells in the IPEC-J2 group and the MDH2-KO group were each replaced with cell growth medium containing 40 μg / mL ZEA. A part of the normal IPEC-J2 cells served as the control group, and another part of the normal IPEC-J2 cells were pretreated with cell growth medium containing 30 μM LW6 inhibitor for 2 h and then ZEA (final concentration 40 μg / mL) was added, serving as the MDH2 inhibition group (IPEC-J2+LW6). The liquids in the above-mentioned wells of the plate were thoroughly mixed and cultured in a cell culture incubator at 37 °C and 5% CO2 for 48 h.

[0065] Cell viability was measured using a CCK8 reagent. Five cell-free wells were selected in the 96-well plate, and 100 μL of DMEM / F12 complete medium was added to each well to obtain the background luminescence value. 10 μL of CCK8 solution was added to each well with liquid in the 96-well plate, and the culture plate was incubated in a 37 °C cell culture incubator for 1 h. The absorbance at 450 nm was measured using a microplate reader.

[0066] Cell viability (%) = (luminescence value of the treatment group - background luminescence value) / (luminescence value of the control group - background luminescence value) × 100%.

[0067] 1.4 Identification of apoptosis rate

[0068] The experiment was divided into a control group (IPEC-J2), an MDH2 inhibition group (IPEC-J2+LW6), and an MDH2 gene mutant group (MDH2-KO). Normal IPEC-J2 cells and MDH2 gene mutant (MDH2-KO) cell lines were seeded into a 6-well culture plate at a density of 6.25×10 5 per well and cultured overnight. On the next day, the cells in the IPEC-J2 group and the MDH2-KO group were each replaced with cell growth medium containing 40 μg / mL ZEA. A part of the normal IPEC-J2 cells served as the control group, and another part of the normal IPEC-J2 cells were pretreated with cell growth medium containing 30 μM LW6 inhibitor for 2 h and then ZEA (final concentration 40 μg / mL) was added, serving as the MDH2 inhibition group (IPEC-J2+LW6). The liquids in the above-mentioned wells of the plate were thoroughly mixed and cultured in a cell culture incubator at 37 °C and 5% CO2 for 48 h.

[0069] The cells were digested and separated with 0.25% trypsin without EDTA and washed twice with phosphate buffered saline (PBS). The cell clumps were resuspended in binding buffer containing Annexin V-FITC and PI staining solution. The cells were incubated in the dark at room temperature for 20 min and then analyzed on a flow cytometer using the fluorescence (FITC) green channel and (PI) red fluorescence channel.

[0070] 2. Results

[0071] In this invention, the CRISPR / Cas9 gene editing system was used to establish an IPEC-J2 cell line with the knockout of the target gene. The DNA sequence of sgRNA was designed for the target gene MDH2, and the annealed double-stranded DNA fragment was ligated to the linearized pX459 vector using the plasmid pSpCas9(BB)-2A-Puro (pX459) as the vector to obtain the knockout vector. The constructed vector was transfected into IPEC-J2 cells by transient transfection, and an IPEC-J2 monoclonal cell line with MDH2 gene mutation was obtained through puromycin pressure screening, and its tolerance to ZEA was studied. As Figure 6 and Figure 7 shown, compared with the control group, the cell viability in the MDH2-KO group was extremely significantly increased by 26.99% ( *** P<0.001) at the concentration of 40 μg / mL ZEA, and the apoptosis rate was extremely significantly decreased by 22.53% ( *** P<0.001), indicating obvious tolerance to ZEA. In addition, compared with the control group, the cell viability in the MDH2 inhibition group treated with 30 μM concentration of LW6 inhibitor was extremely significantly increased by 8.17% ( ** P<0.01) at the condition of 40 μg / mL ZEA, and the apoptosis rate was significantly decreased by 7.90% ( * P<0.05), and the tolerance to ZEA was significantly improved.

[0072] CDS sequence (SEQ ID NO.1) of the MDH2 gene in IPEC-J2 cells:

[0073]

[0074] Amino acid sequence of MDH2 protein in IPEC-J2 cells (SEQ ID NO.2):

[0075] MLSALARPAGAALRRSFSTSAQNNAKVAVLGASGGIGQPLSLLLKNSPLVSRLTLYDIAHTPGVAADLSHIETRATVKGYLGPEQLPDCLKGCDVVVIPAGVPRKPGMTRDDLFNTNATIVATLTAACAQHCPDAMICIISNPVNSTIPITAEVFKKHGVYNPNKIFGVTTLDIVRANAFVAELKGLDPARVSVPVIGGHAGKTIIPLISQCTPKVDFPQDQLSTHTGRIQEAGTEVVKAKAGAGSATLSMAYAGARFVFSLVDAMNGKEGVVECSFVKSQETDCPYFSTPLLLGKKGIEKNLGIGKISPFEEKMIAEAIPELKASIKKGEEFVKNMK。

[0076] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Knockout MDH2 Use of a CRISPR / Cas9 gene editing system for knocking out a gene or an MDH2 inhibitor in the preparation of a preparation for improving the tolerance of porcine epithelial cells to the toxicity of zearalenone, characterized in that, The MDH2 inhibitor is LW6; The nucleotide sequence of the forward Oligo DNA of the sgRNA of the CRISPR / Cas9 gene editing system is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse Oligo DNA is shown in SEQ ID NO.

4.

2. The application according to claim 1, wherein The CDS sequence of the gene of MDH2 is shown in SEQ ID NO.

1.

3. Knockout MDH2 Application of the CRISPR / Cas9 gene editing system or MDH2 inhibitor for knocking out genes in improving the tolerance of IPEC-J2 cells to the toxicity of zearalenone, characterized in that The MDH2 inhibitor is LW6; The said MDH2 The CDS sequence of the gene is shown in SEQ ID NO.1; The nucleotide sequence of the forward Oligo DNA of the sgRNA of the CRISPR / Cas9 gene editing system is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse Oligo DNA is shown in SEQ ID NO.

4.

4. A method for improving the tolerance of IPEC-J2 cells to the toxicity of zearalenone, characterized in that, Comprising the steps described in (1) or (2) below: (1) Knock out the MDH2 gene of the IPEC-J2 cells; the MDH2 CDS sequence of the gene is shown in SEQ ID NO.1; (2) Culturing the IPEC-J2 cells with a culture solution containing LW6.

5. The method according to claim 4, wherein Use the CRISPR / Cas9 gene editing system to knockout the said MDH2 gene.

Images