Application of SAAL1 as a prognostic assessment marker and drug target for neuroblastoma

Abstract

The present invention belongs to the field of biomedicine technology, and specifically relates to the application of SAAL1 as a prognosis assessment marker and drug target for neuroblastoma. The present invention provides a series of applications of SAAL1 as a drug target for neuroblastoma, including aspects of prognosis and treatment of neuroblastoma. The present invention confirms that NB tumors with high expression of the SAAL1 gene have high staging and risk classification, and short survival of children, indicating that the SAAL1 gene can be used as a prognostic molecule for neuroblastoma. In human neuroblastoma cell lines, knocking down SAAL1 can inhibit cell proliferation, indicating that SAAL1 can be used as a therapeutic target for neuroblastoma. The present invention can achieve NB risk classification at the molecular level, and targeting the SAAL1 gene can achieve treatment of NB, assisting clinicians in prognosis judgment and targeted treatment of NB.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to the application of SAAL1 as a prognosis assessment marker and drug target for neuroblastoma. Background Art

[0002] Neuroblastoma (NB) is a common extracranial malignant solid tumor in children. According to the age at diagnosis of NB, histological type, tumor differentiation, MYCN gene status, 11q aberration and DNA ploidy, the International Neuroblastoma Staging Collaborative Group divides the risk of NB into low-risk group, intermediate-risk group and high-risk group. These grading principles help guide the selection of treatment strategies and predict the prognosis of patients. The prognosis of NB is affected by factors such as the age of the child, disease stage and molecular genetics. The 5-year survival rate of children in the high-risk group is only 30%-50%. Traditional treatment methods (such as chemotherapy, surgery and radiotherapy) can control the progression of some NB, but cannot achieve the purpose of cure. In recent years, with the in-depth understanding of the molecular mechanism of NB, the research on treatment methods targeting specific molecular targets has made significant progress. Finding new effective therapeutic targets is of great significance for the cure and improvement of the quality of life of children with NB. Summary of the invention

[0003] The purpose of the present invention is to provide the application of SAAL1 gene as a neuroblastoma drug target, which can be used as a neuroblastoma prognostic molecule and potential therapeutic target, and provide a new approach for the development of neuroblastoma drugs.

[0004] The application according to a specific embodiment of the present invention includes the use of the SAAL1 gene as a biomarker in the preparation of a neuroblastoma prognosis detection kit.

[0005] The purpose of the prognosis detection kit includes: detecting the expression of SAAL1 gene in the test cells of the subject; comparing the test value with the reference value, when SAAL1 is significantly higher than the reference value, it indicates that the prognosis of the subject is poor. The reference value level is the expression level of SAAL1 in normal cells, that is, normal human neural tissue cells, the normal cells are of the same strain as the test cells and are not cancerous; the test cells are known or suspected to contain tumor cells. Alternatively, the reference value level is selected based on the expression amount of the internal reference gene.

[0006] In the present invention, the term "expression level" generally refers to the amount of a biomarker in a biological sample. "Expression" generally refers to the process by which information (e.g., genetic coding and / or epigenetic) is converted into structures that exist and operate in a cell. Therefore, as used in the present invention, "expression" may refer to transcription into polynucleotides, translation into polypeptides, or even polynucleotide and / or polypeptide modifications (e.g., post-translational modifications of polypeptides). Fragments of transcribed polynucleotides, translated polypeptides, or polynucleotide and / or polypeptide modifications (e.g., post-translational modifications of polypeptides) should also be considered expressed, whether they are derived from transcripts generated by alternative splicing or degraded transcripts, or from post-translational processing of polypeptides (e.g., by proteolysis).

[0007] According to a neuroblastoma prognosis detection kit according to a specific embodiment of the present invention, the kit comprises a reagent for detecting the expression level of SAAL1 gene.

[0008] Preferably, the kit includes primers for the SAAL1 gene, the nucleotide sequence of which is as follows:

[0009] SEQ ID NO.1:ATGAGGACGTGGCTTTATTTCTC;

[0010] SEQ ID NO. 2: AGGCAAGTAAGCAACAACCTG.

[0011] Preferably, the kit includes primers for the GAPDH gene, the nucleotide sequence of which is as follows:

[0012] SEQ ID NO.3:GAGTCAACGGATTTGGTCGT;

[0013] SEQ ID NO. 4: TTGATTTTGGAGGGATCTCG.

[0014] The present invention also provides the use of SAAL1 gene as a target in developing or screening drugs for preventing and / or treating neuroblastoma.

[0015] Wherein, the drug can reduce the expression of SAAL1 gene.

[0016] According to a specific embodiment of the present invention, the drug composition for preventing and / or treating neuroblastoma can reduce the expression of SAAL1 gene.

[0017] Preferably, the drug comprises small interfering RNA that targets and inhibits the SAAL1 gene.

[0018] Preferably, the nucleotide sequence of the small interfering RNA is shown as SEQ ID NO.5, or the nucleotide sequence of the small interfering RNA is shown as SEQ ID NO.6.

[0019] SEQ ID NO.5: GCCAGTTGAGCAAACAGAA;

[0020] SEQ ID NO. 6: GTCCAAGTGTCCTCGATTA.

[0021] According to a specific embodiment of the present invention, a small interfering RNA targeting and inhibiting SAAL1 gene, the nucleotide sequence of the small interfering RNA is shown as SEQ ID NO.5; or, the nucleotide sequence of the small interfering RNA is shown as SEQ ID NO.6.

[0022] Beneficial effects of the present invention:

[0023] The present invention confirms that NB tumors with high expression of SAAL1 gene have high tumor stage, high risk grade, and short survival period of children, indicating that SAAL1 gene can be used as a prognostic marker for neuroblastoma. In human neuroblastoma cell lines, knocking down SAAL1 can inhibit the proliferation of neuroblastoma cells, indicating that SAAL1 can be used as a therapeutic target for neuroblastoma. The present invention can achieve NB risk grade at the molecular level, and targeting SAAL1 gene can achieve treatment of NB, assisting clinicians in prognosis judgment and targeted treatment of NB. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0025] Figure 1 It is a schematic diagram of the process of screening differentially expressed genes in NB tumors of different clinical stages;

[0026] Figure 2 The expression of SAAL1 gene in NB tumors in the NB dataset of GSE62564 is shown;

[0027] A is the correlation between SAAL1 expression level and tumor stage;

[0028] B is the correlation between SAAL1 expression level and tumor risk grading;

[0029] C is the Kaplan-Meier survival curve showing the correlation between SAAL1 and the overall survival rate of children;

[0030] D is the Kaplan-Meier survival curve showing the correlation between SAAL1 and progression-free survival rate of children.

[0031] Figure 3 Quantitative PCR was used to detect the knockdown effect of SAAL1 gene in neuroblastoma cells.

[0032] Figure 4 Western blotting was used to detect the knockdown effect of SAAL1 gene in neuroblastoma cells.

[0033] Figure 5 The results show that the proliferation of neuroblastoma cells was observed and compared after knocking down the SAAL1 gene.

[0034] Figure 6 The results show that the clone formation of neuroblastoma cells was observed and compared after knocking down the SAAL1 gene. DETAILED DESCRIPTION

[0035] To make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described in detail below. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other implementation methods obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0036] In the present invention, differentially expressed genes are genes whose gene expression values ​​between two groups of samples vary greatly and are statistically significant (adj.p<0.05).

[0037] High-risk neuroblastoma refers to neuroblastoma with a higher risk of recurrence or treatment failure. It usually includes older children, advanced disease (such as stage IV), and the presence of poor prognostic gene features (such as MYCN amplification, 1p or 11q deletion), requiring more aggressive treatment strategies, including high-dose chemotherapy, radiotherapy, surgery, stem cell transplantation, and immunotherapy.

[0038] Low-risk neuroblastoma refers to neuroblastoma with a low risk of recurrence or treatment failure. It is usually an early-stage disease in younger children (such as stage I or II) and does not have poor prognostic genetic characteristics. A more conservative treatment strategy can be used, and sometimes even chemotherapy or radiotherapy is not required, and surgical resection alone is sufficient.

[0039] International Neuroblastoma Staging System (INSS): The INSS is a staging system based on surgical and pathological findings that is often used in postoperative evaluation and includes the following stages:

[0040] Stage I: Localized tumor that can be completely removed; cancer has not spread to lymph nodes. Stage IIA: Localized tumor that cannot be completely removed; cancer has not spread to lymph nodes. Stage IIB: Localized tumor that may not be completely removed; cancer has spread to nearby lymph nodes. Stage III: Regional tumor that crosses the midline, or localized tumor with bilateral lymph node involvement, or midline tumor with unilateral or bilateral lymph node involvement. Stage IV: Distant metastatic disease, tumor has spread to distant organs or tissues. Stage IVs (special circumstances): For children under 1 year old with a localized primary tumor with distant spread to the skin, liver, and / or bone marrow, but the spread is less severe.

[0041] Example 1 Selection of SAAL1 gene as a prognostic marker for neuroblastoma

[0042] 1. Screening for differentially expressed genes in NB tumors of different clinical stages

[0043] (1) Data selection and grouping

[0044] Using data from the Gene Expression Omnibus (GEO) public database, there are 321 samples in five datasets in the GEO database (including GSE12460-64 cases, GSE13136-30 cases, GSE16476-88 cases, GSE73537-34 cases, and GSE73517-105 cases). According to the different progression of NB, Stage III.IV vs Stage I.II.IVs (Stage is the international tumor staging standard), the Stage III.IV group has a higher risk and the Stage I.II.IVs group has a lower risk, which has clinical significance.

[0045] (2) Data processing

[0046] a. Gene differential analysis was performed on the five data sets to obtain five differential gene sets;

[0047] b. By taking the intersection method, 31 genes that are differentially expressed in NB tumors of different stages were obtained. The screening process is as follows Figure 1 shown.

[0048] c. Functional search and analysis of the above 31 genes were performed respectively, and it was found that the serum amyloid A-like 1 SAAL1 (Serum Amyloid A-Like 1) protein is a soluble protein containing 474 amino acids, no transmembrane region, no signal peptide, and average hydrophobicity. The gene ID of SAAL1 is 83987, and its biological function is still unclear. Its function in neuroblastoma has not been reported, and the mechanism of SAAL1 in the progression of NB is unclear. The present invention speculates that SAAL1 may play an important role in the occurrence and development of NB, so SAAL1 is selected as the research object.

[0049] 2. Confirm the expression of SAAL1 gene in NB tumors

[0050] In order to confirm the expression of SAAL1 gene in NB tumors, the GSE62564 dataset (498 samples) with a large number of samples was selected, and statistical analysis was performed using tumor stage, tumor malignancy, and survival rate of children as indicators.

[0051] The results are as follows Figure 2 As shown in Figure 2, SAAL1 expression increases with the increasing stage of NB tumors (stage I-IV), while it is lower in NB tumors with lower malignancy (stage IVs). Figure 2 A).

[0052] The expression level of SAAL1 in high-risk NB tumors was significantly higher than that in the low-risk group ( Figure 2 B); Kaplan-Meier survival curve shows the overall survival rate of children with high SAAL1 expression ( Figure 2 C) and progression-free survival ( Figure 2 D) were lower than those in children with low SAAL1 expression.

[0053] It can be seen that high expression of SAAL1 is associated with high-risk NB tumors and can be used as a marker for high-risk NB tumors; and children with neuroblastoma who highly express SAAL1 have a poor prognosis, making it a potential prognostic marker.

[0054] Example 2 Investigating the effect of knocking down the SAAL1 gene on NB tumors

[0055] (1) Cell culture:

[0056] Human neuroblastoma cells SH-SY5Y and SK-N-BE2 were cultured in DMEM complete medium containing 10% fetal bovine serum, placed in a constant temperature incubator with a CO2 content of 5% and a temperature of 37°C, and the experiment was carried out when the cells reached the logarithmic growth phase.

[0057] (2) Cell transfection with siRNA:

[0058] Neuroblastoma cells were trypsinized into single cells and counted at 1 × 10 per well. 5 The cells were inoculated at a density of 100 cells / mL in a 6-well culture plate and cultured for 24 hours. When the cell density reached about 30-40%, siRNA (100 nM) was transfected using RNAi MAX reagent. The culture medium was replaced after 24 hours, and the gene knockdown effect was detected after 72 hours.

[0059] (3) Detection of SAAL1 gene mRNA expression level:

[0060] siRNA (si-SAAL1#1 and si-SAAL1#2) were transfected into neuroblastoma cells to knock down the SAAL1 gene. After 72 hours, the total RNA of the cells after siRNA transfection was extracted and synthesized into cDNA using a reverse transcription kit. Real-time fluorescence quantitative PCR amplification detection was performed under the reaction conditions of 95℃15s, 60℃1min, and 40 cycles. The Ct (Cycle threshold) value was recorded, and the relative expression level of SAAL1 was calculated using GAPDH as the internal reference.

[0061] SAAL1 amplification primers are as follows:

[0062] Forward primer: ATGAGGACGTGGCTTTATTTCTC, SEQ ID NO. 1;

[0063] Reverse primer: AGGCAAGTAAGCAACAACCTG, SEQ ID NO.2.

[0064] The amplification primers for GAPDH (internal reference) are as follows:

[0065] Forward primer: GAGTCAACGGATTTGGTCGT, SEQ ID NO. 3;

[0066] Reverse primer: TTGATTTTGGAGGGATCTCG, SEQ ID NO.4.

[0067] si-SAAL1#1:GCCAGTTGAGCAAACAGAA, SEQ ID NO.5;

[0068] si-SAAL1#2: GTCCAAGTGTCCTCGATTA, SEQ ID NO. 6.

[0069] (4) Analysis of SAAL1 gene mRNA expression level:

[0070] After the PCR reaction is completed, the obtained Ct value is analyzed for relative expression. The specific calculation process is as follows:

[0071] ΔCt (转染siRNA实验组) =Ct (转染siRNA实验组SAAL1) -Ct (转染siRNA实验组内参基因GAPDH) ;

[0072] ΔCt (对照组) =Ct (对照组SAAL1) -Ct (对照组内参基因GAPDH) ;

[0073] ΔΔCt=ΔCt (转染siRNA实验组) -ΔCt (对照组) ;

[0074] Fold change of SAAL1 expression = 2 -ΔΔCt .

[0075] like Figure 3 As shown, compared with the control group (si-NC), the mRNA expression level of SAAL1 gene in the experimental group transfected with siRNA (si-SAAL1#1, si-SAAL1#2) was significantly decreased, indicating that the synthetic si-RNA can effectively knock down the mRNA expression of SAAL1.

[0076] (5) Detection of SAAL1 protein expression level:

[0077] siRNA (si-SAAL1#1 and si-SAAL1#2) were transfected into neuroblastoma cells to knock down the SAAL1 gene. After 72 hours, the cells were lysed and then subjected to protein immunoblotting. SAAL1 antibody and internal reference protein GAPDH antibody were used to detect the expression level of SAAL1 protein, and a chemiluminescence kit was used for exposure and development in a dark room.

[0078] like Figure 4 As shown, the expression level of SAAL1 gene protein in the experimental group transfected with si-RNA (si-SAAL1#1, si-SAAL1#2) was significantly decreased compared with the control group (si-NC), indicating that the synthetic si-RNA can effectively reduce the protein expression of SAAL1.

[0079] (6) Cell proliferation level detection

[0080] Neuroblastoma cells were transfected with siRNA (si-SAAL1#1 and si-SAAL1#2) to knock down the SAAL1 gene. After 24 h, the cells were seeded in 96-well plates with 4×10 4 The cells were cultured continuously for 5 days, and the cell growth curve was drawn. The effect of knocking down SAAL1 on the proliferation ability of NB cells was statistically analyzed.

[0081] like Figure 5As shown, compared with the control group (si-NC), the proliferation ability of NB cells in the knockdown group was significantly decreased, thus, knockdown of SAAL1 can inhibit NB cell proliferation.

[0082] (7) Clone formation assay

[0083] Neuroblastoma cells were transfected with siRNA (si-SAAL1#1 and si-SAAL1#2) to knock down the SAAL1 gene. After 24 hours, the cells were seeded in 6-well plates with 600 cells per well and cultured continuously for 10-14 days. The cells were fixed with 4% paraformaldehyde for 15 minutes, stained with crystal violet for 15 minutes, washed with PBS several times, and observed under an optical microscope and images were collected.

[0084] like Figure 6 As shown, the cloning ability of NB cells in the knockdown group was significantly reduced compared with that in the control group (si-NC). Therefore, knockdown of SAAL1 can inhibit NB cell cloning.

[0085] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A small interfering RNA targeting and inhibiting the SAAL1 gene, characterized in that: The nucleotide sequence of the small interfering RNA is shown as SEQ ID NO.5; or, the nucleotide sequence of the small interfering RNA is shown as SEQ ID NO.

6.

2. Use of small interfering RNA targeting and inhibiting SAAL1 gene in the preparation of a drug for preventing and / or treating neuroblastoma, characterized in that: The nucleotide sequence of the small interfering RNA is shown as SEQ ID NO.5; or, the nucleotide sequence of the small interfering RNA is shown as SEQ ID NO.

6.

3. A drug for preventing and / or treating neuroblastoma, characterized in that: The drug comprises a small interfering RNA that targets and inhibits the SAAL1 gene, and the nucleotide sequence of the small interfering RNA is shown in SEQ ID NO.5; or, the nucleotide sequence of the small interfering RNA is shown in SEQ ID NO.6.

Images