A molecular marker related to immune traits for marker-assisted selection in yaks and its application

Abstract

The present invention provides a molecular marker related to immune traits for marker-assisted selection of yaks and its application, belonging to the field of molecular biological detection technology. The present invention provides a SNP site related to yak immune traits, and the SNP site is located at the 163688148th base of chromosome 1 of the yak genome LU_Bosgru_v3.0 version. According to the scheme of the present invention, the method for detecting yak immune traits using the SNP site and the molecular marker based on the site has the advantages of high accuracy, fast detection speed, low cost, and easy result judgment compared with the traditional detection method. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological detection, and in particular relates to a molecular marker related to immune traits used as marker-assisted selection for yaks and an application thereof. Background Art

[0002] Yaks are one of the important livestock breeds in the high-cold pastoral areas of the Qinghai-Tibet Plateau and an important part of the plateau animal husbandry. Yaks have adapted to extreme natural environments, such as high altitude, low air pressure, strong ultraviolet rays, lack of oxygen and malnutrition, and have strong survival abilities. They also provide meat, milk, wool, leather and other production and living materials for the pastoral areas. Yaks are not only a guarantee of life for plateau herders, but also an important symbol of their wealth. At the same time, yaks are a precious gene bank in terms of genetics, with unique biological characteristics, strong physique and high adaptability to harsh environments.

[0003] At present, the yak industry still has problems with insufficient selection and breeding in terms of production traits such as disease resistance and fertility. The population size is small and it is difficult to meet market demand. At the same time, the construction of the breeding technology system is relatively backward, which restricts the sustainable development of the yak industry. These problems have become one of the key factors restricting the development of the yak industry.

[0004] Therefore, it is urgent to develop a modern breeding method for yaks, especially a breeding strategy for their disease resistance. By screening genes related to disease resistance and using molecular genetics to perform marker-assisted selection, the genetic improvement of yaks will be accelerated, promoting the cultivation of new varieties and the healthy development of the yak industry.

[0005] Genetic research on disease resistance, combined with molecular biology and genetic engineering technology, can effectively enhance the resistance and immunity of yaks to pathogens, thereby reducing the threat of diseases to yaks' health, reducing economic losses, and promoting the development of the yak industry in an efficient and sustainable direction. Summary of the invention

[0006] The purpose of the present invention is to provide a molecular marker related to immune traits and its application as marker-assisted selection of yaks.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a SNP molecular marker associated with yak immune traits, wherein the SNP molecular marker is located at the 163688148th base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T.

[0009] Preferably, when the base of the SNP site is C, the genotype is CC or CT; when the base of the SNP site is T, the genotype is TT; when the genotype is TT, the IgA and IgG of individual yaks are significantly higher than those of genotype CC, and when the genotype is TT, the IgG of individual yaks is significantly higher than that of genotype CT.

[0010] The present invention also provides the use of the SNP molecular marker in preparing products for detecting yak immunity or yak assisted breeding products.

[0011] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0012] The present invention also provides the use of the primer pair in preparing a product for detecting yak immunity or a product for yak auxiliary breeding.

[0013] The present invention also provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0014] The present invention also provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0015] The present invention also provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0016] (1) Extracting yak genomic DNA;

[0017] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0018] (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; and the immunoglobulin is immunoglobulin A or immunoglobulin G.

[0019] Preferably, the amplification system in step (2) is 25 μL in total, including: 12.5 μL of 2×L-Exp Taq Master Mix, 8.5 μL of RNase free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

[0020] Preferably, the amplification program in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The present invention provides a molecular marker related to immune traits for marker-assisted selection of yaks and its application. According to the scheme of the present invention, the method for detecting immune traits of yaks using SNP sites and molecular markers based on the sites has the advantages of high accuracy, fast detection speed, low cost, easy result judgment, etc. compared with traditional detection methods, and provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0024] Figure 1 It is the PCR amplification product: M represents Marker; 1, 2, and 3 represent 3 groups of repetitions.

[0025] Figure 2 The peak diagram and sequence obtained after sequencing the PCR product. DETAILED DESCRIPTION

[0026] The present invention provides a SNP molecular marker associated with yak immune traits, wherein the SNP molecular marker is located at the 163688148th base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T.

[0027] In the present invention, when the base of the SNP site is C, the genotype is CC or CT; when the base of the SNP site is T, the genotype is TT; when the genotype is TT, the IgA and IgG of individual yaks are significantly higher than those of the genotype CC, and when the genotype is TT, the IgG of individual yaks is significantly higher than that of the genotype CT.

[0028] The present invention also provides the use of the SNP molecular marker in preparing products for detecting yak immunity or yak assisted breeding products.

[0029] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0030] The present invention also provides the use of the primer pair in preparing a product for detecting yak immunity or a product for yak auxiliary breeding.

[0031] The present invention also provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0032] The present invention also provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0033] The present invention also provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0034] (1) Extracting yak genomic DNA;

[0035] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0036] (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; and the immunoglobulin is immunoglobulin A or immunoglobulin G.

[0037] In the present invention, the amplification system described in step (2) is 25 μL in total, including: 2×L-Exp TaqMasterMix 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, and template 2 μL.

[0038] In the present invention, the amplification program described in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0039] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0040] Example 1

[0041] 1. Sample collection

[0042] The invention uses the Niangya yak breed as the detection object, collects 5 mL of blood samples from 192 fasting yaks from the Jiali County ranch in Nagqu City, Tibet Autonomous Region, and puts them in a clean pro-coagulant vacuum blood collection tube, lets them stand for 30 minutes, and then centrifuges them at 3500r / min for 10 minutes, aspirates the supernatant into a PE tube, seals it and stores it in a -20°C low-temperature refrigerator; another 5 mL of blood sample is collected in a blood collection tube with EDTA-K2 anticoagulant added, and after the blood sample is collected, it is quickly mixed, temporarily stored in a sampling box containing an ice pack, and transported back to the laboratory and frozen in a -20°C refrigerator for extraction of genomic DNA.

[0043] 2 Main reagents and instruments

[0044] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genomic DNA extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop 2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebold Technology Co., Ltd.; 2×L-Exp Taq MasterMix (dye plus) was purchased from Hunan Aikerui Bioengineering Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. IgA (MB-4907A), IgG (MB-4616A), and IgM (MB-4908A) detection kits were purchased from Jiangsu Enzyme Biotechnology Co., Ltd.

[0045] 3 Methods

[0046] 3.1 Immunoglobulin IgA, IgG, and IgM detection

[0047] According to the IgA, IgG, and IgM detection kits of Jiangsu Enzyme Biotechnology Co., Ltd., the double antibody one-step sandwich method was used for determination. First, the required strips were taken out from the aluminum foil bag after equilibration at room temperature for 20 minutes, and the remaining strips were sealed with a self-sealing bag and returned to 4°C. Set up standard wells and sample wells, and add 50μL of different concentrations of standard wells to each standard well; first add 10μL of the sample to be tested to the sample well, and then add 40μL of sample diluent; blank wells are not added. In addition to the blank wells, 100μL of horseradish peroxidase (HRP)-labeled detection antibody is added to each well of the standard well and sample well, and the reaction wells are sealed with a sealing film, and incubated at 37°C water bath or constant temperature box for 60min. Discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let stand for 1min, shake off the washing solution, pat dry on absorbent paper, and repeat the washing 5 times (you can also use a plate washer to wash the plate). Add 50μL of substrate A and B to each well and incubate at 37°C in the dark for 15min. Add 50 μL of stop solution to each well, and measure the OD value of each well at a wavelength of 450 nm within 15 minutes. Finally, draw a standard curve: in an Excel worksheet, use the concentration of the standard as the horizontal axis and the corresponding OD value as the vertical axis to draw a linear regression curve of the standard, and calculate the IgA, IgG, and IgM concentration values ​​of each sample according to the curve equation.

[0048] 3.2 Extraction of genomic DNA from blood

[0049] The blood genomic DNA extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was >20ng / μL and OD 260 / OD 280A value between 1.7 and 1.9 meets the experimental requirements and can be stored at -20°C for future use.

[0050] 3.3 Primer design

[0051] Using genomic DNA as template, a pair of specific primers were designed using primerpremier5.0 software.

[0052] Specific primer sequences:

[0053] 5'-ACTAAGATCCCATGAGCCA-3'(SEQ ID NO:2)

[0054] 5'-ATTGAATGAGACACCACCAG-3'(SEQ ID NO:3)

[0055] The length of the amplified fragment was 519 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0056] 3.4 PCR amplification and sequencing

[0057] PCR amplification system 25uL: 2×L-Exp Taq MasterMix (dye plus) 12.5μL, RNase freewater 8.5μL, upstream primer 1μL, downstream primer 1μL, template 2μL.

[0058] PCR amplification program: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 2 min.

[0059] The PCR products were detected by 1% agarose gel electrophoresis. After the PCR products were qualified by agarose gel electrophoresis, they were sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd.

[0060] The biological analysis software MEGA 11.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.

[0061] 4 Statistical analysis

[0062] According to the genotyping results, the number of individuals with different genotypes at each site was counted. Popgen32 software was used to calculate the g163688148C>T gene frequency, genotype frequency, effective allele number (Ne), site heterozygosity (He), and Hardy-Weinberg equilibrium test, and PIC (polymorphism information content, referred to as PIC) calculation software was used to calculate the polymorphic information content. The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and immunoglobulins IgA, IgG, and IgM, and the results were expressed as "mean ± standard error".

[0063] 5 Results

[0064] 5.1 PCR amplification and sequencing results

[0065] The amplified product of the g163688148C>T site on chromosome 1 of yak was detected by 1% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 519 bp, which was in line with the expected size, so the next step of the experiment could be carried out.

[0066] The sequence of SEQ ID NO: 1 is:

[0067] ACTAAGATCCCATGAGCCACAGAGGAACAACTAAGCCCGTGCACTGCAGCTAGAGAGTCTGAGGGCAGCGAGGAAGGTCCCGCATGCTGAAA CTAAGACCCGACGCAGCCCAATAAATAAGCAAAATGCTGTGGTGATGCTACACGGTGACCTCGTCCCCCCACCTAGCTTTCTGTAAAGCCCCACACTCAGGCGGAACCACTGCTGCGGACAGGCAACAGGCGGGCAGGTGATCTTGTCTTGTGAAAATCAATTCAGGGCTCCTAGAGCTCCTGCCGTGTGTGGCCCATTGGAGTGGCCCTGCAGCGCCTCGGCCAGCCAGCTCCTAGGTCCTCACGGCCATCAGGAGGGTGGCCTGGGGCTTCGATGTCCTCTGTCCACACCCTCTCCCGGACGGTCTCACTCACTCATGTGGTTCCACGTGCTGTGGGCTTTCACACCTCCAGCTGGCCCTCCAGCTGATCTGACCCAGGCATTCACCTGCCCACTGGGCATCTTCCTGGTGGTGTCTCATTCAAT

[0068] The peak map and sequence obtained after purification and sequencing of the PCR product are shown in Figure 2 . It can be seen from Figure 2 that there is a C-T mutation at the g163688148C>T locus, and there are three genotypes: CC, CT, and TT.

[0069] 5.2 Statistical analysis results

[0070] The genotypes and allele frequencies of the g163688148C>T SNP locus on chromosome 1 of yak were analyzed from the perspective of population genetics. As shown in Table 1, at the g163688148C>T SNP locus, the CC genotype frequency is the highest, which is the dominant genotype, and the C allele frequency is 65.9%, showing the dominant allele. By χ 2 adaptive test showed that the SNP locus conformed to the Hardy-Weinberg equilibrium state (P>0.05) (Table 1). The expected heterozygosity of this locus was 0.449, and the PIC was 0.348. 0.25<PIC<0.50, belonging to moderate polymorphism.

[0071] Table 1 Polymorphism of the g163688148C>T SNP locus on chromosome 1 of yak

[0072]

[0073] 5.3 Analysis of association between different genotypes and immunoglobulin IgA, IgG, and IgM The general linear model in IBM SPSSStatistics26 software was used to analyze the association between different genotypes of yaks and the content of immunoglobulins IgA, IgG, and IgM. The results showed that when the genotype was TT, the IgA and IgG of yaks were significantly higher than those of genotype CC (p<0.05), and when the genotype was TT, the IgG of yaks was significantly higher than that of genotype CT (p<0.05), while the IgA and IgG between CC and CT genotype yaks did not show significant differences (p>0.05), and the IgM of yaks of the three genotypes did not differ significantly from each other (p>0.05), indicating that the base of the g163688148C>T site on chromosome 1 of yaks is significantly associated with yak IgA and IgG (p<0.05), and is a SNP marker related to yaks. The results are shown in Table 2.

[0074] Table 2 Correlation analysis between different genotypes and IgA, IgG, IgM

[0075]

[0076] Note: Different lowercase letters between data in the same row indicate significant differences (P<0.05).

[0077] The SNP molecular marker described in the present invention is located at the 163688148th base on chromosome 1 of the reference yak genome LU_Bosgru_v3.0 version; the variation type is C / T, named g163688148C>T, and there are three genotypes. When the 163688148th base on chromosome 1 is C, the genotype is CC or CT; when the 163688148th base on chromosome 1 is T, the genotype is TT; by not The correlation analysis between the same genotype and the content of IgA, IgG, and IgM found that when the genotype was TT, the IgA and IgG of the yak individual were significantly higher than the genotype CC (p<0.05), and when the genotype was TT, the IgG of the yak individual was significantly higher than the genotype CT (p<0.05), while the IgA and IgG between the CC and CT genotype yaks did not show significant differences (p>0.05), and the IgM of the three genotype yaks did not differ significantly from each other (p>0.05). By detecting the bases at the 163688148th nucleotide site on the yak chromosome 3, the immunoglobulin A and immunoglobulin G content of the yak individual can be determined. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes.

[0078] As can be seen from the above embodiments, the present invention provides a molecular marker related to immune traits and its application as marker-assisted selection of yaks. According to the scheme of the present invention, the method of detecting yak immune traits using SNP sites and molecular markers based on the sites has the advantages of high accuracy, fast detection speed, low cost, and easy result judgment compared with traditional detection methods, and provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes.

[0079] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting SNP molecular markers in the preparation of an in vitro detection reagent for immune traits of Niangya yak or a detection reagent for immune traits of Niangya yak in assisted breeding, characterized in that: The SNP molecular marker is located at the 163688148th base on chromosome 1 of the Niangya yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T; when the genotype is TT, the IgA and IgG of the yak individual are significantly higher than the genotype CC, and when the genotype is TT, the IgG of the yak individual is significantly higher than the genotype CT.

2. The use according to claim 1, characterized in that: The primer pair for detecting the SNP molecular marker is shown in SEQ ID NO.2~3.

3. A method for marker-assisted selection of immune traits of Niangya yaks for non-diagnostic purposes, characterized in that: The steps include: (1) Extraction of Niangya yak genomic DNA; (2) using the Niangya yak genomic DNA obtained in step (1) as a template, and using the primer pairs shown in SEQ ID NOs. 2-3 to perform amplification to obtain an amplified product; (3) performing genotyping analysis on the amplified product to obtain Niangya yaks with different genotypes; correlating the genotype of the Niangya yak with immune indicators; the immunoglobulin is immunoglobulin A or immunoglobulin G; The SNP molecular marker is located at the 163688148th base on chromosome 1 of the Niangya yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T; when the genotype is TT, the IgA and IgG of the yak individual are significantly higher than the genotype CC, and when the genotype is TT, the IgG of the yak individual is significantly higher than the genotype CT.

4. The method according to claim 3, characterized in that The amplification system described in step (2) is 25 μL in total, including: 2× L-Exp Taq Master Mix 12.5μL, RNase free water 8.5μL, upstream primer 1μL, downstream primer 1μL, template 2μL.

5. The method according to claim 3, characterized in that: The amplification program in step (2) is: 94°C for 1 min; 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

Images