SNP (Single Nucleotide Polymorphism) molecular marker related to pork quality character and application of SNP molecular marker

Abstract

The invention relates to an SNP molecular marker related to pork quality traits and application of the SNP molecular marker, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO: 1, the SNP molecular marker is located at the 54801192-54801193 bp position of the 12th chromosome of a pig reference genome Sscrofa11.1 version, the SNP molecular marker is located at the 61-62 bp position corresponding to the SEQ ID NO: 1, and a basic group mutates from GT to AC; an individual of which the genotype is AC / AC of the SNP molecular marker has a high pork quality character; an individual with the genotype of GT / GT or GT / AC of the SNP molecular marker has the low pork quality character; during breeding, individuals with genotypes of AC / AC of the SNP molecular markers are reserved, and individuals with genotypes of GT / GT or GT / AC are eliminated, so that the pork quality of offspring pigs is improved.

Description

Technical Field

[0001] The present invention relates to the fields of molecular biology and genetic breeding, and in particular to a SNP molecular marker associated with pork quality traits and an application thereof. Background Art

[0002] With the improvement of people's living standards and the intensive development of breeding enterprises, the market demand for high-quality pig breeds is growing, which has prompted the breeding industry to face new challenges. Meat quality is a complex trait that is affected by multiple indicators, including meat color, tenderness, pH value, water loss rate, marbling, intramuscular fat content, muscle fiber traits, etc. Among them, intramuscular fat content and muscle fiber composition are the two main factors affecting pork quality. Intramuscular fat is fat deposited between muscle fibers in muscle bundles. Its main components are phospholipids and triglycerides. A large amount of intramuscular fat is deposited to form marble. Marbling and intramuscular fat are important indicators of pork quality. They will directly affect the flavor and juiciness of pork. Therefore, appropriate intramuscular fat content is an important standard for high-quality pork. The regulation of pig meat quality and lean meat rate is a complex process involving the interaction of genes, feeding management and environmental factors. Effectively controlling the meat quality of pork and optimizing the lean meat rate can not only improve the meat quality and meet market demand, but also enhance breeding efficiency and bring greater economic benefits to the breeding industry.

[0003] In recent years, the rapid development of molecular genetic technology has made DNA molecular marker technology play an important role in the study of pig genetic diversity. In order to better develop and utilize the excellent economic characteristics of excellent breeds and protect and reasonably utilize breed resources, it is necessary to develop molecular markers specific to pork quality traits and apply them to the selection of pigs with high meat quality traits to provide a theoretical basis for molecular breeding of pigs. According to the query in the FarmGTEx database, the GAS7 gene (Growth arrest-specific gene 7, GAS7) is a gene with tissue spectrum expression, which is expressed in nerve, fat, muscle, and bone tissues. Compared with wild-type mice, knocking out GAS7 in mice increases fat content, changes the ratio of fat to muscle, and changes the corresponding meat quality traits. According to RNA-seq data analysis, the gene is significantly differentially expressed in the longissimus dorsi muscle tissue of Large White and Horse-body pigs, highly expressed in Large White pigs (low meat quality group), and lowly expressed in Horse-body pigs (high meat quality group). However, SNP molecular markers related to pork quality traits based on the GAS7 gene have not been fully studied. Summary of the invention

[0004] In order to solve the above problems, the present invention proposes a SNP molecular marker related to pork quality traits and application thereof.

[0005] The invention provides a SNP molecular marker associated with a pork quality trait. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1. The SNP molecular marker is located at 54801192-54801193bp of chromosome 12 of the pig reference genome Sscrofa11.1 version. The SNP molecular marker is located at 61-62bp of the corresponding SEQ ID NO:1, and the base mutates from GT to AC. An individual whose genotype of the SNP molecular marker is AC / AC has a high pork quality trait. An individual whose genotype of the SNP molecular marker is GT / GT or GT / AC has a low pork quality trait. During breeding, the pork quality of offspring pigs is improved by retaining an individual whose genotype of the SNP molecular marker is AC / AC and eliminating an individual whose genotype is GT / GT or GT / AC.

[0006] Furthermore, the primer combination for detecting the SNP molecular marker includes a forward primer as shown in SEQ ID NO:2 and a reverse primer as shown in SEQ ID NO:3.

[0007] The present invention also provides the application of the SNP molecular marker associated with pork quality traits in pig breeding, which includes the selection and breeding of pork quality traits, breeding of pig strains with high pork quality traits, genetic improvement of pigs, and screening of piglets with high pork quality traits.

[0008] Furthermore, when applied to the breeding of pork quality traits, the SNP molecular markers of reserve breeding pigs are first detected, and then individuals with the SNP molecular marker genotype of AC / AC are retained, and individuals with the genotype of GT / GT or GT / AC are eliminated.

[0009] Furthermore, when applied to breeding high growth trait pig strains, the SNP molecular markers of reserve breeding pigs are first detected, and then individuals with the SNP molecular marker genotype of AC / AC are retained as breeding pigs, and individuals with the genotype of GT / GT or GT / AC are eliminated, and the male and female pigs used as breeding pigs are bred, and then the SNP molecular markers are detected for the pigs born from the breeding, and individuals with the genotype of AC / AC are retained, and individuals with the genotype of GT / GT or GT / AC are eliminated, and then breeding is carried out to obtain pig strains with pork quality traits.

[0010] Furthermore, when applied to the genetic improvement of pigs, the SNP molecular markers of reserve breeding pigs are first detected, and then individuals with the SNP molecular marker genotype of AC / AC are retained as breeding pigs, and individuals with the genotype of GT / GT or GT / AC are eliminated, and the male and female pigs used as breeding pigs are mated, and breeding pig individuals with the genotype of AC / AC continue to be selected in the offspring, and individuals with the genotype of GT / GT or GT / AC are eliminated, so as to increase the frequency of the allele AC in the offspring pig population generation by generation, thereby improving the pork quality of the offspring breeding pigs.

[0011] Furthermore, when applied to screening piglets with high pork quality traits, the SNP molecular markers of the piglets to be screened are first detected. When the genotype of the detected SNP molecular markers is AC / AC, the piglets to be screened have high pork quality traits and are retained; when the genotype of the detected SNP molecular markers is GT / GT or GT / AC, the piglets to be screened have low pork quality traits and are eliminated.

[0012] The beneficial effects of the present invention are as follows:

[0013] 1. The present invention conducted GWAS analysis based on the whole genome resequencing data of 675 individuals (19 F0 generation, 55 F1 generation, and 601 F2 generation) from a hybrid resource group of Large White and Min pigs for three generations, and found that GAS7 was a gene significantly associated with pork quality traits. Combined with functional annotation, it was found that intron 2 of GAS7 (chr12-54801192-3:GT>AC) was a SNP significantly associated with pork quality traits. The mutation at this site changed the binding ability of the transcription factor ZBTB14, thereby regulating the expression level of the GAS7 gene, affecting the meat quality traits of pigs. chr12-54801192-3:GT>AC can be used as a SNP molecular marker related to pork quality traits. The intramuscular fat content of pigs with different genotypes of this marker has extremely significant differences; the average fat rate of molecular marker genotype CC is 7.43%, and the average fat rate of molecular marker genotype GT / GT is 2.36%. The A allele significantly improves meat quality, and the AC / AC genotype is the dominant genotype. Therefore, by applying this molecular marker, the quality of pork can be greatly improved, the production performance of pigs can be improved, and the genetic improvement progress and breeding process of breeding pigs can be accelerated.

[0014] 2. By detecting the genotype of the SNP molecular marker to assist in the breeding of sows, the AC / AC genotype sows can be selected to effectively improve the quality of pork and facilitate the subsequent comprehensive breeding of sows.

[0015] 3. The SNP molecular marker is applied to the breeding of high meat quality traits in pigs. The bred pigs can effectively improve the meat quality and the production performance of pigs.

[0016] 4. The SNP molecular marker is applied to the breeding of pig strains with high meat quality traits, so that pig strains with high meat quality traits during the fattening period can be obtained, thereby improving the production performance of the pig strains and accelerating the genetic improvement and breeding process of breeding pigs.

[0017] 5. Applying the SNP molecular marker to the genetic improvement of pigs can greatly shorten the genetic breeding period, improve the quality of pork, and accelerate the genetic improvement and breeding process of breeding pigs.

[0018] 6. The SNP molecular marker is applied to screen piglets with high meat quality genetic traits, so that breeding pigs with high meat quality traits can be screened out at the piglet stage and selected. In this way, the meat quality traits of breeding pigs are selected at the piglet stage, which can greatly improve breeding efficiency and save feeding costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Phenotype of intramuscular fat content in F2 generation of Dabai and Min pig hybrid resource group;

[0020] Figure 2 The marbling phenotype of F2 individuals in the hybrid resource group of Large White and Min pigs;

[0021] Figure 3 Manhattan plot of GWAS analysis of intramuscular fat content in F2 generation individuals of the hybrid resource group of Large White and Min pigs;

[0022] Figure 4 Manhattan plot of GWAS analysis of marbling traits in F2 generation individuals of the hybrid resource group of Large White and Min pigs;

[0023] Figure 5 Manhattan plot (top) and LD block analysis (bottom) of the candidate regions of chromosome 12 for intramuscular fat content and marbling;

[0024] Figure 6 Analysis of intramuscular fat content in individuals with different genotypes at the mutation site (chr12-54801192-3:GT>AC);

[0025] Figure 7 Annotation of the binding site of transcription factor ZBTB14 at the mutation site (chr12-54801192-3:GT>AC);

[0026] Figure 8 Sequencing results of the mutation site (chr12-54801192-3:GT>AC). DETAILED DESCRIPTION

[0027] The present invention will be further described below with reference to the embodiments.

[0028] Example 1: Process steps for obtaining SNP molecular markers:

[0029] 1. Based on the three generations of the Dabai and Min pig hybrid resource group, a total of 675 individuals (19 F0 generation, 55 F1 generation, and 601 F2 generation), tissue samples of 675 individuals in the group and meat quality phenotypes of F2 generation individuals (intramuscular fat content and marbling traits, see Figure 1 and Figure 2 ), total DNA was extracted from tissue samples, and the DNA was quality controlled and sent to a sequencing company for whole genome resequencing (Novogene, Illumina platform). The sequencing depth of F0 generation individuals was about 42.06×, and the coverage reached 99.16%, the sequencing depth of F1 generation individuals was about 7.18×, and the coverage reached 98.07%, and the sequencing depth of F2 generation individuals was about 6.10×, and the coverage reached 96.71%.

[0030] 2. Arrange the fastq files downloaded from the sequencing company and the fastq data of other pig breeds downloaded from NCBI. Quality control: According to the results of whole genome resequencing, first use FastQC (version v0.11.9) software to perform quality control analysis on the original sequencing data to remove the adapter sequence and low-quality sequencing data.

[0031] 3. Sequence alignment: The domestic pig Sscrofa11.1 version was used as the reference genome and the BWA (version0.7.17) alignment software was used for data alignment. Then, the Picard (version 1.119) software was used to add headers to the Sam files and add sample names. The Sam format files were converted to Bam files and sorted and output. Then, the sorted Bam files were indexed using the Samtools (version 1.0) software.

[0032] 4. Remove duplicate reads: Use Picard (version 1.119) software to remove duplicates and create an index. Variant detection: After the whole genome data of F0, F1, and F2 generations are aligned and deduplicated, Sscrofa11.1 is used as the reference genome to perform variant detection at the whole genome level using the HaplotypeCaller module in GATK (version 3.6) software to generate VCF format files.

[0033] 5. Data filtering: Filter SNPs and indels data with the filtering criteria of FS>60, QD<2.0, QUAL<40, and MQ<25.

[0034] 6. Genotype filling: Then, the F0 generation high-quality VCF file was used as a reference to fill the genotypes of the F1 generation individual data through beGT / ACle (version 4.0) software. Then, the F2 generation individual data was further filled with genotypes using the F1 generation data as a reference to obtain the F2 generation individual genome variation data as accurately as possible.

[0035] In this example, GWAS analysis was performed on the whole genome resequencing data of 675 individuals (19 in the F0 generation, 55 in the F1 generation, and 601 in the F2 generation) from the hybrid resource group of Large White and Min pigs for three generations. It was found that GAS7 is a gene significantly associated with pork quality traits ( Figure 3 , Figure 4 , Figure 5 ), combined with functional annotation, it was found that intron 2 of GAS7 (chr12-54801192-3:GT>AC) was a SNP significantly associated with pork quality traits ( Figure 5 ), the mutation of this site changes the binding ability of the transcription factor ZBTB14, thereby regulating the expression of the GAS7 gene and affecting the meat quality traits of pigs ( Figure 6 , Figure 7 ).

[0036] Example 2: Process steps for screening and validating the above molecular markers

[0037] The population used in the present invention is an artificially constructed hybrid population of Large White and Min pigs of the third generation, which has a certain population structure. The pork quality trait is a quantitative trait. The compressed mixed linear model (CMLM) is selected as the calculation model. The model is developed from the mixed linear model (MLM). Compared with the mixed linear model, the model divides the research population into groups according to kinship, compresses the research population into more small groups to replace individuals, thereby speeding up the calculation speed and improving the accuracy of the calculation. The calculation formula of the model is:

[0038] y=Wα+xβ+Zu+ε

[0039] Where y is the phenotypic value of the trait to be studied, Wα is the fixed effect, xβ is the genetic marker effect, Zu is the random effect, usually refers to the kinship of individuals, and ε is the random error. In this model, we use the first 10 principal components of the principal component analysis results as covariates to correct the data, so as to better reduce the false positive results. The analysis process is as follows:

[0040] 1. Data filtering: We further filtered the VCF files after genotype filling of 601 F2 individuals. In order to detect rare variants that affect traits and variants with small effects, we filtered variant sites with minor allele frequency (MAF) less than 0.01.

[0041] 2. Constructing the population structure file: Our research population is an artificially constructed hybrid population. After two hybridizations, gene separation will occur in the F2 generation population, resulting in a certain population structure. Therefore, we further use the plink software (version 1.9) to perform principal component analysis (PCA) based on SNP data. Then, we use admixture (version 1.3.0) software to perform population structure analysis, generate a population structure matrix, and add the first ten principal components of the principal component analysis results to the population structure matrix to generate the final population structure file, which is used as a fixed effect to correct the calculation results during the calculation process.

[0042] 3. Construct a kinship matrix: Use EMMAX software to calculate the kinship matrix of the population and use the results as covariates to reduce the possibility of false positives and false associations.

[0043] 4. Construct trait data file: Construct trait file based on previously statistical trait data and sample number for subsequent association analysis ( Figure 1 and Figure 2 ).

[0044] 5. Construct genotype file: First convert the VCF file into plink format using vcftools (version 0.1.13) software, then use plink software to convert the plink format file into a binary format file, and finally continue to use plink software to convert the binary format file into a genotype input file that can be recognized by EMMAX software.

[0045] 6. Association analysis: Based on the constructed population structure file, kinship matrix, trait data file and genotype file, whole genome association analysis was performed using EMMAX software ( Figure 3 and Figure 4 ).

[0046] 7. SnpEff software was used to annotate candidate SNPs. Combined with functional annotation, it was found that a SNP in the intron 2 region of GAS7 (chr12-54801192-3:GT>AC) was a SNP significantly associated with pork quality traits ( Figure 5 ), the mutation of this site changes the binding ability of the transcription factor ZBTB14, thereby regulating the expression of the GAS7 gene and affecting the meat quality traits of pigs ( Figure 7 The average intramuscular fat content of the molecular marker genotype GT / GT was 2.36%, and the average intramuscular fat content of AC / AC was 7.43%. The AC / AC genotype was the dominant genotype ( Figure 6 ).

[0047] Example 3, process steps for the above molecular marker function annotation

[0048] In order to explore the distribution of variant sites in the genome, we used the filtered high-quality variant site data as the input file, the Sscrofa11.1 version genome and the Sscrofa11.1.106.gtf version annotation file as references, and used snpEeff (version 5.0) software to functionally annotate the variant sites.

[0049] According to previous studies, most functional variations in the genome often occur in non-coding regions of the genome, which play a role in regulating gene expression by destroying or enhancing the binding ability of certain specific transcription factors to motif sequences (specific binding sequences of transcription factors). Therefore, in order to verify whether the variant sites screened by GWAS will destroy the motif sequences of related transcription factors, we selected sequences located 15bp upstream and downstream of the variant sites and annotated motifs in the JASPAR database (https: / / jaspar.genereg.net / ) with humans and mice, two species that are closely related to domestic pigs, as references (JASPAR database is a free and open transcription factor collection database, which collects data from six major categories of different organisms, including fungi, insects, nematodes, plants, urochordates and vertebrates, among which vertebrates include humans and mice. The JASPAR CORE database is a collection of experimentally verified transcription factor binding site data sets with high reliability).

[0050] In this example, the following primers were used to amplify the (chr12-54801192-3:GT>AC) molecular marker, the forward primer sequence is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3:

[0051] Forward primer: 5′CCTTCCTTGTGGGCTCCATT 3′

[0052] Reverse primer: 5′ACTGCGAGTCGGCCTAAAAA 3′

[0053] PCR amplification methods include:

[0054] (1) Extracting genomic DNA from the pig to be tested;

[0055] (2) using genomic DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO. 2-3;

[0056] (3) Analyze the PCR amplification products.

[0057] The amplification system used in the PCR reaction was as follows in 50 μl: 1 μl of 100 ng / μl template DNA, 1 μl of 10 pmol / μl forward primer and reverse primer, 1 μl of 10 mmol / L dNTP Mixture, 1 μl of 1.25 U / 25 μl TaKaRa Ex Taq DNA polymerase, 25 μl of 2× PCR reaction buffer, and the remainder was double distilled water.

[0058] The PCR reaction program was as follows: PCR reaction conditions were: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 64°C annealing for 30 s, 72°C extension for 30 s, for a total of 32 cycles; 72°C incubation for 5 min; 4°C hold. Figure 8 Label.

[0059] In summary, the present invention provides a SNP molecular marker (chr12-54801192-3: GT>AC) associated with pork quality traits, wherein the intramuscular fat content of pigs with different genotypes of the marker is extremely significantly different, and individuals with the genotype of the SNP molecular marker being AC / AC have high pork quality traits; individuals with the genotype of the SNP molecular marker being GT / GT or GT / AC have low pork quality traits; during breeding, the pork quality of offspring pigs is improved by retaining individuals with the genotype of the SNP molecular marker being AC / AC and eliminating individuals with the genotype of GT / GT or GT / AC. By applying the molecular marker, the pork quality can be greatly improved, and the genetic improvement progress and breeding process of breeding pigs can be accelerated.

[0060] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

[0061] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. Application of a SNP molecular marker related to pork quality traits in pig breeding, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, and the SNP molecular marker is located at 54801192-54801193bp of chromosome 12 of the pig reference genome Sscrofa11.1 version. The SNP molecular marker is located at 61-62bp of the corresponding SEQID NO:1, and the base mutates from GT to AC; individuals whose genotype of the SNP molecular marker is AC / AC have high pork quality traits; individuals whose genotype of the SNP molecular marker is GT / GT or GT / AC have low pork quality traits; during breeding, the pork quality of offspring pigs is improved by retaining individuals whose genotype of the SNP molecular marker is AC / AC and eliminating individuals whose genotype is GT / GT or GT / AC.

2. The use of the SNP molecular marker associated with pork quality traits in pig breeding according to claim 1, characterized in that: The primer combination for detecting the SNP molecular marker includes a forward primer as shown in SEQ ID NO: 2 and a reverse primer as shown in SEQ ID NO:

3.

3. The use of the SNP molecular marker associated with pork quality traits in pig breeding according to claim 1, characterized in that: The applications include breeding of pork quality traits, cultivating pig strains with high pork quality traits, genetic improvement of pigs, and screening of piglets with high pork quality traits.

4. The use of the SNP molecular marker associated with pork quality traits in pig breeding according to claim 3, characterized in that: When applied to the breeding of pork quality traits, the SNP molecular markers of reserve breeding pigs are first detected, and then individuals with the SNP molecular marker genotype of AC / AC are retained, and individuals with the genotype of GT / GT or GT / AC are eliminated.

5. The use of the SNP molecular marker associated with pork quality traits in pig breeding according to claim 3, characterized in that: When used in breeding high growth trait pig strains, the SNP molecular markers of reserve breeding pigs are first detected, and then individuals with the SNP molecular marker genotype of AC / AC are retained as breeding pigs, and individuals with the genotype of GT / GT or GT / AC are eliminated, and the male and female pigs used as breeding pigs are mated, and then the SNP molecular markers are detected for the pigs born from the mating, and individuals with the genotype of AC / AC are retained, and individuals with the genotype of GT / GT or GT / AC are eliminated, and then breeding is carried out to obtain pig strains with pork quality traits.

6. The use of the SNP molecular marker associated with pork quality traits in pig breeding according to claim 3, characterized in that: When applied to the genetic improvement of pigs, the SNP molecular markers of reserve breeding pigs are first detected, and then individuals with the SNP molecular marker genotype of AC / AC are retained as breeding pigs, and individuals with the genotype of GT / GT or GT / AC are eliminated, and the male and female pigs used as breeding pigs are mated, and breeding pig individuals with the genotype of AC / AC continue to be selected in the offspring, and individuals with the genotype of GT / GT or GT / AC are eliminated, so as to increase the frequency of the allele AC in the offspring pig population generation by generation, thereby improving the pork quality of the offspring breeding pigs.

7. The use of the SNP molecular marker associated with pork quality traits in pig breeding according to claim 3, characterized in that: When used for screening piglets with high pork quality traits, the SNP molecular markers of the piglets to be screened are first detected. When the genotype of the detected SNP molecular markers is AC / AC, the piglets to be screened have high pork quality traits and are retained; when the genotype of the detected SNP molecular markers is GT / GT or GT / AC, the piglets to be screened have low pork quality traits and are eliminated.

Images