Application of NFIB and downstream target gene thereof as target spot for treating or inhibiting hepatic fibrosis

Abstract

The invention discloses an application of NFIB and a downstream target gene thereof in preparation of a hepatic fibrosis detection reagent and / or kit. The downstream target gene provided by the invention is a TEKT1 gene. Researches find that the expression of NFIB in hepatic fibrosis is reduced; after the NFIB is over-expressed, the expression level of the TEKT1 gene is obviously reduced, and the progress of hepatic fibrosis is further blocked. Therefore, the NFIB and the downstream target gene TEKT1 thereof are taken as detection targets and can be used for preparing a hepatic fibrosis detection reagent and / or kit, and hepatic fibrosis can be screened and the severity of fibrosis can be evaluated by detecting the expression levels of the NFIB and the TEKT1 in a sample to be detected.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an application of NFIB and its downstream target gene as a target for treating or inhibiting liver fibrosis. Background Art

[0002] Chronic liver disease (CLD) is a major global health burden, affecting more than 800 million people and causing approximately 2 million deaths each year. Liver fibrosis caused by viral or metabolic liver diseases is a major challenge to global health. Liver fibrosis is associated with the progression of CLD and is a key factor in the prognosis of CLD and the risk of developing hepatocellular carcinoma. Therefore, early diagnosis and treatment of liver fibrosis are key to reducing CLD-related complications and mortality. However, there are currently no direct and effective anti-liver fibrosis drugs and methods in clinical practice. Therefore, revealing the pathogenesis of liver fibrosis and finding therapeutic targets for anti-liver fibrosis are the key to preventing and treating liver fibrosis in chronic liver disease.

[0003] The activation of hepatic stellate cells (HSCs) is the most important link in the development of liver fibrosis. When liver tissue is stimulated by viruses, toxins, etc., HSCs are activated and transformed into myofibroblasts with proliferation and contraction. At the same time, they express alpha-smooth-muscle actin (α-SMA) and secrete a large amount of extracellular matrix (ECM) (such as collagen I and III), which are deposited in the liver, leading to the occurrence and development of fibrosis. Inhibiting HSC activation and inducing cell apoptosis and senescence are potential treatments for the prevention and treatment of liver fibrosis. Therefore, it is crucial to explore new regulatory targets for liver fibrosis by regulating the activation mechanism of HSCs. However, further exploration is needed to clarify the new mechanism of HSC activation, find key genes based on this, and develop personalized precision targeted therapy.

[0004] Nuclear factor IB (NFIB) was first identified as a protein purified from human Hela cells. In humans, it belongs to the NFI family of transcription factors with high affinity for DNA, stability, and specificity. Members of the NFI family have been shown to regulate cell proliferation and differentiation during the development of multiple organ systems. Tektin 1 (TEKT1), a member of the tektin protein family, contains a family of filament-forming proteins that assemble with tubulin to form cilia and flagellar microtubules.

[0005] At present, there are no reports on the mechanism by which NFIB can regulate liver fibrosis through its downstream target gene TEKT1. Summary of the invention

[0006] Purpose of the invention: The purpose of the present invention is to provide an application of NFIB and its downstream target genes as targets for treating or inhibiting liver fibrosis. The present invention found that TEKT1 is an important target gene in NFIB regulating liver fibrosis, which is of great significance for revealing the potential pathogenesis of TEKT1 in liver fibrosis, and helps to provide a new perspective for subsequent research and solve the problem of liver fibrosis treatment.

[0007] Technical solution: The purpose of the present invention is achieved through the following technical solution:

[0008] The present invention provides an application of NFIB and its downstream target genes in preparing a liver fibrosis detection reagent and / or a kit. The liver fibrosis detection reagent and / or the kit uses NFIB and its downstream target genes as detection targets.

[0009] Wherein, the downstream target gene is TEKT1 gene.

[0010] The liver fibrosis detection reagent and / or kit contains the sequences shown in SEQ ID NO.1 to SEQ ID NO.4.

[0011] NFIB nucleotide sequence (SEQ ID NO.1):

[0012] 1gattaggtgt cttatcttcc attgagctgc atctgatgaa ggttgctgac agcataatgg

[0013] 61ctgggaaaac gtcggacagc tccataaaat ggcagctatg ttatgacatg tcagccagga

[0014] 121cctggtggat ggtaagtttg gcgtaataac atttttttca cccaccccca aaacttccct

[0015] 181cccttcttcc tttcgagctc ctcctctatt gttccatgca cgtgttataa agttcgctgc

[0016] 241ctgtggaaag ttcaagctca agttttggga ccctggggtg cctctgcaca ccagtgtgct

[0017] 301agataggatt tccctgctat tgtggccggg ggcataggcc ttctttttaa aaaggcagca

[0018] 361tgagttttg ttcccttttt tttttttttt aaagaaaaat gcaaatggta cagtcggtcc

[0019] 421Caggccggct gctgtgaaat agatggaggt ggggcagtca gtaggggatt ggagccttct

[0020] 481tggctaattg ttcttgcatt ggtcttaaaa cagagtaatg tacttctttc tgcagctcct

[0021] 541ctgaataatg atttagatag tgtattgtat catgttgtgt gcggctccct catcagtatg

[0022] 601cgactgtccc ccacgctttg cttaatttg gaatccacct ccctttcaat gaatactgta

[0023] 661actggagcaa ccactgatta ctatgccact cagcgtaatt aaatttagtt aatgaggata

[0024] 721tgcatattca gttcattatt tttctttgct caggcaaatg tgtgtgggtt tgttgttgct

[0025] 781gtttttcccc tcttatattt gtccagctgc aaatgtgggg aagaaggaaa ggagcataga

[0026] 841aattcaggga gggatattgg tgaatcctgt gactcaactt ttaacataat attgggaaga

[0027] 901gagaagttgt aactttctgt aatcagagtg ctgggatgag aggtagtagt ttggggaag

[0028] 961aaaacctttc acatccaaaa agtgctacat gataaatttc aacatctga tttctgttgt

[0029] 1021gtggacaatg gtctcttgta tgcaatagtc gtgacaaga tggggaaccc tttccacagg

[0030] 1081caagcatttc attachment taaattcgtc attgggttca ttcatctgaa catttacttt

[0031] 1141 cttttctcat tttctttttc ttcttttttt ttcttcttt tgccccttttccttttctgtc

[0032] 1201 ttgattgctt ttactcgttt gcttcgataa ttattgtgct tactacaagggccgttttc

[0033] 1261 tcacaattag tacagtgga gacaatgggc actttattct aggtggggaggggtatggcc

[0034] 1321 agccctggtg gtcagctcat ccactgtgcc cggacagaag gaagcctggtctgattagtc

[0035] 1381 ctggcttctg gcattgccag gcaagagggt ttcttatgaa tgtgtttgaatttcctgaaa

[0036] 1441 ggtggatgtt atgctgttga tcctaggcgt ctcgtgaaag ctcaacgttcagggaagctt

[0037] 1501 ccctggaagc tgagtccttc tctgcaccct ttctcgttaa tgtgagatgtgtaaacctgc

[0038] 1561 aggagaactt ttctgccgct gctacttgtt gctgttttga gtactctcagaaagaaaggc

[0039] 1621 cagttcctca aggagagaca gaaacctctc tctctctctc tctccctctctctttcccct

[0040] 1681 cacccctatt ttattcctga tgaaatagat tttacaagtg atataaactctaaagtggca

[0041] 1741 aactgttatt tatggttgta tctcttacta tactttagta ctgtgcgtgtacatggtgaa

[0042] 1801 atcaactggc agatgcttgg ggaaaaatgc tgtgaaatgt ttgtgtaaaagatttgcttt

[0043] 1861 ctgtgacaat accaaggctt ggaagtgatg ttttaatagt taccctgcctcttaactgtc

[0044] 1921 attttacgtt gttctaagaa gtgagtttta aaatcaatat tcttactaaatgaaacattt

[0045] 1981 tctgttgggg aaaagtaaaa aggtttactc tctacaattt tactgaaaaactgggattaa

[0046] 2041 gatgggtata gtaagccaat cactattaat attttgacat taaatttcaccattctactt

[0047] 2101 ctgtacagtc agattgcagc ttctcaagag aagtaggctg tgaatattattactaaagat

[0048] 2161 ttgcataagc tgattgttcg ttttagaaa ttgtggtctt ttattgctgagaagatgccg

[0049] 2221 agtgtgtaca gggacaagtt cagaggtaaa atattaggct aaaaatttattgcgtaattta

[0050] 2281 ttttggtatt taatcttcat taggttacat gaagagtacg taagtttcttattgggacca

[0051] 2341 ttctgtttta ataaactttg ttattttggc accaaagtgt ttaagggattattatttaat

[0052] 2401 gtgtcattga aaacttggaa tgacagatgc tttgtggaaa acctaattaatcaaactaaa

[0053] 2461 tgattgctta tctttagtaa tacattggaa gagagaat ttagaagagagacagaatac

[0054] 2521 atggcggtta cttttacatg gttcccctgt tgtggatgta aggaagattttttaaatgtg

[0055] 2581 ttttaaggtt cttacaaact cgtttattgt gattcttctc tcaccgtgacactgattctt

[0056] 2641 ttatttttat aataactctg ggctctttgt gtaagaaagg atattgtgtgtccttctttggc

[0057] 2701 ttaatcaaat aaaattttag taaccagatc ctgaattcca aagctgcagtgttaaagtac

[0058] 2821 ccaggcaatt gcttcctgac ttattgtctg tttcagttag attctcttattgtgtgacaa

[0059] 2941 tgatcataaa ttctacttga cagggaaaaa gcccaaacaa gacgtagttgtccaattcta

[0060] 3001 catctgtttt ccttcctaga caggcatgtt ttagtaaaac agagggaggaaaaacatttt

[0061] 3061 attgagacag ctaaaaataa acaagtacac gaagagtaaa ctcctgtgtgtgtgttaaat

[0062] 3121 atcatctacc tacattcagt ttttaaaatg acgcatcctt atatattttacttctttaga

[0063] 3181 tgattttgta tgtgacttct ttcaaggaga aaaatcgcgt aagcagtttaaattaccgtt

[0064] 3241 gcttggctat atttagagtt ctgttgatga cctttcacat tatttaaaaataccacttgg

[0065] 3301 aatgtattaa agacatatct cctaaacagc actatttcat taatggttattgatgatgct

[0066] 3361 atatgtttcc ttttaaagca ctcataaata aaactaccaa aaacaatttttggactttcc

[0067] 3421 attctatttt gtacttcaca tttaaagctc tctgtgagac ttagtagaacttctttgtca

[0068] 3481 gctatttgga acttcagagt agcaggtatg caccagacat tatttttctccaactttc

[0069] 3541 ataaatctaa tcatttgatc ccatcagaac caggccagaa catttgtaagtttactttaa

[0070] 3601 tcatgaaggg taattattg aatattaatc tgtaaaatta atttgaaaattaatttgcca

[0071] 3661 gtctatgcaa cttgaaattc tcgtagtctt gtaaatagta accacagtgaatgggcatat

[0072] 3721 aagcacaaac actaggctag atcctctgtt atccaaggtt attctttgttgaacaccaat

[0073] 3781 cagtctgctc agttgtaatg tgcttttat ttgtcttgaa agaaaatcatttttacttttt

[0074] 3841 tgagaagtta gtgtgttaaa acagtgaacc aagtaccctc acataatcttattttgttta

[0075] 3901 agacaatgtt aataaaagtg ttaaatccat caattgtttg ctaggctgttttaataatca

[0076] 3961 aatttgttc tcaatgttaa ttttaattaa acaacttggc aataatatcagtatatgtag

[0077] 4021 gccacattga aaagattgtt ttcacagcaa acatttctct gaagccttttgagaagttgaa

[0078] 4081 gtgaaagata tataattgac tattttaac tgaaaatcct aaattaatagatccctga

[0079] 4141 taaatgctga aactagtata tgttacggtc tgtatttcat tttctttaactaaaaactaa

[0080] 4201 agaatttcta aagagtctga taaatatgct aaatatatat attagaaacttctctgcctaa

[0081] 4261 cctaatacc gcagctagac tcctatgta atctaccagc catgcaagatatatctctgaa

[0082] 4321 atcaaatt caatttat ttaatttca attgtattta atttctgaatgtattga

[0083] 4381 atatggaat gtagaatgt ggtagaact atagatacc ataccatacatataatacc

[0084] 4441 atacaacta gttgtctaaa gatttatgt ctaaatattg gatctatttgtagaatttga

[0085] 4501 aacttaaaa tttatgttc agttgacaa tacctgtaaa gaacatactatatgccaggc

[0086] 4561 tcttctaag gtgcagagga gaccaatcct atcgcccat tctggaatcaacccatgtc

[0087] 4621 acagtgttat ggaggggggt gatcgacatc atattaatga aagcttctgaataatttctg

[0088] 4681 tttctctaa aatgttgcta actatatagc tattataata cctttgcagatttatcactc

[0089] 4741 agtgtcatgg taattagtac atcttttcag tatcctttct tagacccataggtgaatgtt

[0090] 4801 aatttacta ttacttctaa gctatctcct gtacaattaa tgacatagataaagaataat

[0091] 4861 ggtttatcga atactagttt ctgagtaaaa caacaacaac gatgatgatatctgagtaaa

[0092] 4921 aagaaaattt taacatctgt aaataatagt aattcgtttt tatatatcaaatttgtca

[0093] 4981 cagagaaatt atactttttt ctttcatgtc ttccttacct atgttctttagtgttgcatt

[0094] 5041 ttcatttgtg gtaccatttt agcatattta aatacaagtg aactatatgaagatgtggta

[0095] 5101 aaatacatta atcttcttcc aagatacttt cttatgtggg aatgacttttatttcatttt

[0096] 5161 ccatgattta tttcatgta tgtgcctgca taatgtaaca tgtaaactttggataaagaa

[0097] 5221 aagtacctt agatcctac ttaaaca gtgattagat ggttaatttaatcagag

[0098] 5281 agtaggaaa cacaagtgcc tgcctatcct cttttccagt tctttttggaagcaaaggg

[0099] 5341 tcgtgttctc aaggagtt atctctcta tctatgggaa agctggtgttgatttccag

[0100] 5401 tttagagact agtcacaa gagagatatc tgatgctcac gatcattgaactacagc

[0101] 5461 atatttctgt aacatggctg atgatgtca atcactattt ttaggcattttaaaattccc

[0102] 5521 cgagattgtt atttctatg ctgtgatttg taatacatat tgttctgaggggtgagaaa

[0103] 5581 gtctgctcag aaataggaaa atttagcagg gcaggaaag agattacattcccctgttg

[0104] 5641 cgtctcaatg tgcaaaaag tcaggatatt gatttcagt gcaaagttctttttcacaag

[0105] 5701 aagttctgct aagggatata tgtagctatg ctacatgttt tattaacttttaagaattct

[0106] 5761 aaatttatt gcattttaaa tgcttagcaa agagccagga gaaagaagtactcaggaa

[0107] 5821 atgttcgtta tgatcattat tattattca acttacacta agcatgctttattaatggaa

[0108] 5881 cagatttaac atacatgta ataacagct ttaataca ttcccattctcaatgttct

[0109] 5941 aacattaatt ttaccccagc acctccctaa aaatatgact ttattcagagagcttttttt

[0110] 6001 ttctacttc tcacatacta tgtcattt ctgaggttag aacataatgatatgtttat

[0111] 6061 gagcacagggg ctgaatcctg ggaatgtag atttggtgac ctctggcaatgaatttgct

[0112] 6121 cctctcacgg ctggtagagg cagctgtaa gtgcagataa tcatactcattacatgtcgc

[0113] 6181 tccaacctgt cgtgaggatg atgagatgg agtcggcg gcacctggtgaatgctttgt

[0114] 6241 aattacagg tccacgacac atatccaagg gggctatac aattgtggctatttaca

[0115] 6301 gtctcaggtc tgagcactta gtaggtgccc caaatacac acaaatacacggtgtgtta

[0116] 6361 tttgaatgga accatacat ttcctaggg gtttcataa tcatgttgagttttaaaa

[0117] 6421 ttcacatgaa catttttgtg ggaactgcat acattaaatg aatcataaaaattcaggatt

[0118] 6481 ttccatttca aattgtagca gatttcttaa aaacagagac tcctgaaatattttctcatg

[0119] 6541 gttagcaaga tccaatggct aatgttacac attagcttaa ttttcatcattaaataccat

[0120] 6601 gattttaagg gtaaaagaaa ccaatgacta cggagggcct cctctttgccaggtgtttgc

[0121] 6661 ctggtacttt ggaaggcaat ttatataaat catctccttc agtcttcagcacagagcaat

[0122] 6721 aacatagaca ttaccagaac cactttacag gggaggccac tcgacttcaaggttaagcaa

[0123] 6781 cttgctgaaa tgcactccac tgataagggg agaagaggag agaacacgaaaaccctcaaa

[0124] 6841 gtttaaataa agtttctctg ctctttccca agaacccaac cattgactatttcacccata

[0125] 6901 tgatctgggt tataactaat tattggtgac catggtaagg tgtttgaccattgcctgctt

[0126] 6961 tacatcagtc tgcccctcca gcgccatttc atgcctcttt ctggggctcagctctccctc

[0127] 7021 tgtgttaaat gggccaggac actcgctcca gagctgtgtc tgagaactgtagagctctgg

[0128] 7081 gattggaggt agttgaattc tttggaaatg cgattccatt catctttcctcgagacaatt

[0129] 7141 agactcgcta tagtcataag ccatctgggg gaaatttttt ggaaagaaattggcaagcaa

[0130] 7201 aatgtttcca ttttcaggtt ttgatgatat ctgtttacct cctggagctcttgtgaggct

[0131] 7261 ccaatgagat aatacacagt caacgacttg aaaactgtaa aatgcaaaacaaatctaagg

[0132] 7321 tatacatatt attatctggt gatattaaac atgggtggat gaaaaaagctttccagaat

[0133] 7381 tttgccggtg ttctggagtg tgatataatg gtaaattctc accagccaacagaggaaatg

[0134] 7441 ccagctgcta aaacgttgta tgatgctatc tgcaaattct gctgctaaactcaaaagtat

[0135] 7501

[0136] 7561 atatctacca cctctttttg tacatttaat gagaaggcat gaaattcttaaaaaatttcac

[0137] 7621 ctgtgccatt ttgcggttca accacattt ttcattgatc caagttgcacctagcttg

[0138] 7681 taccacaaa gactcttaat cattcttaa tgaaattatt atttttactcacacttagct

[0139] 7741 tatatta tgggaagat ttagctggtc acatgatgaa cagtacattatgttgtaaat

[0140] 7801 gggatttt tttgttatt ttcaggttg tgagagaa tattaccaccactgtttga

[0141] 7861 gagaaaacac cctagcacat ttgatacgtt tctatgctat aggtatgaatgtttatatata

[0142] 7921 aatgggtcta ctgtattata tggcacttat tatgtgtga tataagatttaccttctatt

[0143] 7981 atttagttgc tcaagtgtgc aaccaaaatt ataagcccca agaggatggggaccacatct

[0144] 8041 tattactag ccctaacag cattttgtac ctaaaaggcc cttaatgaataattgctaaa

[0145] 8101 ttgcatcaag actgctgcta tcccatttta ctaatagaga ggggaatccaatgagcactc

[0146] 8161 aagttctggg ttgatcaatg gtaatgaact caatctgtg ggcccaagttatgaattgtt

[0147] 8221 atgccgtctt tttccagata aaacttaaat gtactagagg catgttggaattatgatgaa

[0148] 8281 attaacagcc aagttttaaa actgaaggta agagtaagaa gaaggcccatagcaaaagca

[0149] 8341 ataagtttgt atttctctgc aagcacacaa gctcagtcag tatgaagtggtagggcagca

[0150] 8401 gacggacctg tcacccttgt cagcaaacgt catctctaac tgtcgcaattcttttatcgg

[0151] 8461 actgactgag atcgttcagg ggtctaataa gttagagagt ttggaaaaggttaatgtatt

[0152] 8521 tgggggataa atgatcaagg caaagtgact ttggaataaa tgagctttttgtatattttg

[0153] 8581 ttatttttga cgaaataagt ttcatttaag aggattgatt atttttccagtgtaaggctt

[0154] 8641 cagtcatttc cccataattc ttacatttat ggcgatgtcg ggaaggtctctggcatgggc

[0155] 8701 tggcatttta acattcagtg tttgggtgag agttcagagg cacacgcaggaataacagaa

[0156] 8761 acctcaagta gaatgggtag actgtggaga ggtgtgggtt tgtgggaaagtgagtaggaa

[0157] 8821 agtatccaat cacttgtgaa gaagtacgtg cttataaata attttgagaaagagatattt

[0158] 8881 aaagtttaaa aagcactcca tttggattca gccctgcttt gaccactgtaagttggtgtc

[0159] 8941 tgcatgaaag ctgagccaac accaagtgtg ctcaggtatt ataaactctgcagcccaatc

[0160] 9001 tccagagccc gaaaagtcac ctgccctact cttatgaccc acttttcctcagggctctca

[0161] 9061 tgaagtaaat ttgagagagt actctggagg cccctgaaaa aaatcaggtccctctcagcc

[0162] 9121 agacactacc cttctatacc agcagaaact tttctttccc tcaactctctcatgcttatt

[0163] 9181 ttcagatatt ttaaagtgaa atgatggtag agacacaagg gagaaaaatttgattgtgga

[0164] 9241 ttattatttt tgctcccaaa cactccagtc actgttagaa ccaggagcaccattctccct

[0165] 9301 tctagagcag agcctctggt ttgaaggagg agggaaagag ctgtgtctacaagataagca

[0166] 9361 gtcttcacct tcaacagttc ttactatttc aaggttcaat gctgatgctgacagctaatc

[0167] 9421 tgatgaaaat tatgcggaag gaaataaact ttcatttctc cagtttggactttgaacaat

[0168] 9481 aaaggtggaagaatatgaga ctcaaagtaa catcatatat gctctagcatgcactgcagg

[0169] 9541 ggataatagt tattgtgatt ttccagaatt ccaggtagtt tgctattatcgatagtccta

[0170] 9600 aatgacctca cgcaaacttc gttcaccttc tctagtattt cctctggtttcctgttaggt

[0171] 9660 ggaatcgtgg aatcctatgt gatacaataa taacaaagac tttaaaagagacaacaatgc

[0172] 9720 ttttttttat ccacatatag aagaaataac actaaattgt tattttatttttccaataag

[0173] 9780 atgttaatta tcgtatgtga ggctattcat tttattggca ccaaagatgtttataaatgg

[0174] 9840 taccccacat aatacaaacc acatgtttac gtagcatgaa tgttcaatcaattagtttac

[0175] 9900 acacataaac gctggaatat tgatgacaca tgttagtttt tagtgggaaaaaagccaaca

[0176] 9960 gagctaattt gatgcattga tccttgggac cttcgcacag atgtaaacctttgacttcat

[0177] 10020 cgcaagtgat ttggctgaca aacagtagct tgtaattatt gttgtgccatcataaattaa

[0178] 10080 ttaaaaaatc aatcaatcag cttagaccag gcaggccagc catatttgtcagtttgggct

[0179] 10140 gtttcccttc actttacttc cctcacatgt tctcttctta tcagacactttgaaaacatt

[0180] 10200 tgcttgtgcc agattggctt tctcctaaac tttcataggg aattccaaacaatagcatgg

[0181] 10260 atatggggag atactgctga ggaattgatg aatattctct aaactcctggccataggact

[0182] 10320 accaatgggt agagtgaata attattgagc attcaaagcc ttttggccaaagccatctcc

[0183] 10380 ccacgcaagg gatagcacct caatctctgg gcaaacaggc atcatttagggactgagtga

[0184] 10440 ttgctaatgt aacagttttc aacattgtcc caaaaggtgc ttctttgattatctttccac

[0185] 10500 ccaagcctat attttgaaag attccattaa ctgaacaaat tgcatgtattaaactgtgag

[0186] 10560 ctgtttttgc atttttcaga tatcaccatc cacaaagaac tccgatgtaccaggttctct

[0187] 10620 gctaggtact ttgcatatat tatcttatta ttaataca atttgcaacaaccttgaaaa

[0188] 10680 gtatatgtaa ttcccatttc acagcagaaa aatactgagg cccagggagtttaatagtt

[0189] 10740 tgtccaagct tactcggctg ataatgggca gtgccaggat taaaagtcaggttattggca

[0190] 10800 cttcccataa caccatgatt aaccaaagac atcaaaggac ttctgaacagaacattaca

[0191] 10860 gccgtgtttt cacatggagt tgatgtactt ctagcccaaa tcaaagagatttgacctttt

[0192] 10920 agttagagga cagaacctta ttctggataa acctaccatt ttcgaatggtatttgtgaaa

[0193] 10980 tattaaaaaa tagttcctgc father tcaatctcct ttcaagaaatttgaaagggt

[0194] 11040 ggagaacttc tgaatctttc tttgtcctgc tcactaaagc cactcttcctgtcaatgcag

[0195] 11100 aagcatcatc caccactttg tgaatagggt gtcattgctg cttttgttcagcctcatttt

[0196] 11160 cttgtcctga atcaatgggg cagtagaaaa acagctgagc atccaaagaaccagatggat

[0197] 11220 gtccctaaac tggtctgtag gcataagcga gccatttaac ctctgagtcctgactacttt

[0198] 11280 tttgaaccac tgtaaatgaa gcaaaggaaa gtcagtggtt tctcactttttgggccttcc

[0199] 11340 atcatttata catagaactg aaataatcta ttcatgaagc agccttacccttagtacctg

[0200] 11400 aaatgcacat ttactagttt tctactttat tctatttcat ctttttaaatgaaggtgctg

[0201] 11460 tctcactaaa ttgatatctt gacctgctaa tgggtcatga cacatggtttggaaaatact

[0202] 11520 gagtgaatgc aaaagttctc tgtagaagct aaatttaata tctgcacagaagtgcttcag

[0203] 11580 attcctgtgt tttagaggtct ttcattattt cagcccctcc ttttaaaggaatttcatact

[0204] 11640 cattggaaga gagtgactgt tttgcagaat gtgatcttgg tctgtggcaccgctgcagaa

[0205] 11700 cattccactg aggtgtttct cctctgagct gctctaagta caagtcagtcagcccttgga

[0206] 11760 agaaggacag gttgggtgca gagtaagtaa tgcctgccgg gctgggtctgtgttcataat

[0207] 11820 gcatgttgaa ttcttatctt agatcattag ggaaatagca cctattaagacagaccctta

[0208] 11880 ttttgtaaat aaggtcatgg aatgaaattg gaaagtttca gggaaaaaatgtgtgtagtt

[0209] 11940 cataattact atttaattgg tcattgaaaa catgaagaaa tggcctttgataaaattac

[0210] 12000 aattagatag atagaatggg tatttcctaa agagttattt ttttccctgaaatttttagt

[0211] 12060 agaaggaaat cttaggtgca gtgtaagata atatctattg tgcctcacatatcctcatgt

[0212] 12120 gaatgaagga aagttaaaca ttataaatag tttctttaga atatggacttcatattttca

[0213] 12180 ccaatctgaa tttatcatg tttataacgt agagaactaa ggggaagctaaaattaaaat

[0214] 12240 gggagagat atgggatgta aaaatacttt ttggagagtg tttcaggttatgtagagagg

[0215] 12300 aagaatagca ttatggttaa gggcctaggc atctaaggct agactatctgggctcaactc

[0216] 12360 ccaaatatgc cattgcccag ctaggtaaac ttgagcaaat gagttaacatttctgtgact

[0217] 12420 cagtttcctc agctgttttg tggggtagt agcaggatct gcttagtaagattgttgtga

[0218] 12480 ggattagatg agttttattc ataaaccatt ttgccaggca tatattgggtcctcatgcta

[0219] 12540 atagtaatta actctaagta gggcataagc acaacgcacc gcagtaaaatgcctgacagt

[0220] 12600 ataaagtata caaataagaa aagacacaaa taagggttaca aaacaaaaacaacccctgcc

[0221] 12660 tcccaacccc ccgccaagaa aacacacaac agaaactact actaggagaagtgattctta

[0222] 12720 gcagttaagt cagtggcttt aggctcaacc aatttccaca aagactttgcttacctttct

[0223] 12780 gagaaaatga tttcttccag actctgagct cctgtttagt gtatttactccttatgtcat

[0224] 12840 taatttcatt tttcccctaa actcaatgat aaacttctgg aaagcagagatccaatctta

[0225] 12900 cttagcatta tatttcctct ctcaacttct cttcctggca ctcaatatccttatacaagc

[0226] 12960 accgatacca tcagacttgt tgaacgaggt tgagcttgcc ttaagttctagtctcttagc

[0227] 13020 cattgttag tgcttggaga gcccaggaca cagaatttat aaataaagccagtcccgctt

[0228] 13080 ttcacagagg caccccacca tcaccaccat acacacaact taaaaatgagctgttcatta

[0229] 13140 gcaatttgtgt gataagtgca atgggtccaa aaggacccat caaagatgatttcacccaca

[0230] 13200 gtgtaccagg cgcaataatg gctccaggca actggggcct ggactttccccttcctt

[0231] 13260 ccatagcccc ccttcttagc agatgagtgg gaatccccca tctcccagtggctgagcata

[0232] 13320 gactccactg ctccgatcca gagagggaag ttgggaattg gaaatatggcctgaggttcc

[0233] 13380 tggagagtgc aaagagggtg aaggagagat ctctacttct catgctctctaccccatttg

[0234] 13440 tctttcattt tcccattgct ggcaaggaaa ggagggagta gttcttcagcttcccttcct

[0235] 13500 ctacaacttg gtttctcttc tctcttttt ttttcttgag ttctttccgtagtcttgag

[0236] 13560 cccagaaact gcaggacaaa agtagtggtg ttaggagtag ggatggaagg

[0237] 13620 tggacctaac agataacttc tttctactcc tctttctcat atccactctgttttttgttt

[0238] 13680 cccactaggc tatccacaat ctcaccactg gatactagat tatgatgacagctggggatc

[0239] 13740 ctgggctgtt agttcaataa tgggtggcat tcatcaggaa gactcttaccagcaatgggc

[0240] 13800 ctataagttt gtgaggaatt gtgacagaga tgggtacaga aggcaggaaaagaagctcag

[0241] 13860 ttctcaaggt aaccttgctc agccagctgg agcaagtcat gagttgcctgtatccataaa

[0242] 13920 cacttagcct ctattgccta ctttgcccca aaacacaggg ccatggccatagattgagaa

[0243] 13980 gtcgctagcc tctatagaaa aatatcttta tgatgacctt gttgcgaatgtcttatcatt

[0244] 14040 taggccatcc atatttccaa tggcatatag acccaaacgt ttcttatcaacactgcattt

[0245] 14100 gtaactgcat aaatatattt attccattca aaatttttta tagtgtatttataacaaatg ctgtatgaac

[0246] 14160 aaggcaggct tagtgctctt ccttgtggag tttacatcta gttagaagacaatgcaataa

[0247] 14220 gtcttttgtt gctgcagtat tgcctgactt ggagctacat aacagaggcacctaactcat

[0248] 14280 cttgaagctg gtgcagtttc tttagatgca aataagagag agcagaagattaattcctgc

[0249] 14340 agagggatga ccatatgcaa aggtccagtg gcaagagaga gcatgactctgaactgggaa

[0250] 14400 acagcccatg gaaaaaggca tcatgctgta agtgagggca cttaaattaggcagaaaaaa

[0251] 14460 atccacacca agagccctgc tattttgctg actgatgtaa agaaagaaggtccaagaaca

[0252] 14520 gggccatggg ctattaaatc accctatcta cacacacata tacacatacaccaccacgac

[0253] 14580 caccgctacc acacaccaca catccactgc aggacaagga tttcattatagtgaaacttc

[0254] 14640 acagacgtag atcaagtaac ataggacaag ggtctaagct cagatggctgctgtttctgc

[0255] 14700 aagtttctgg tttatccagc ctattagact gtggccagat gtactgtgttacctacataa

[0256] 14760 tccttatcag cagcattcca tctgtgtcat ccaagtagca ggaataagcaggcacccttt

[0257] 14820 tggaagtgg cccaaagggt acagaaagca ggtacgcctt ggaggcatgtaacccacatc

[0258] 14880 cctgcaagtc aggagagaag acaaacacat tgagtttctg ccccagatactcacttgaat

[0259] 14940 tgctcctgca ttccagagag aggttggtgg ggggaattt ggaggttagctgtgggcctt

[0260] 15000 ttactttgta atggaacaaa ttaattatg tgaattttagtgctttcc

[0261] 15060 tcctgcccta gtggctccca atctatttag gggtagtcag aaaaaggggaccttcacaac

[0262] 15120 agctgcttag ctgcttgagc tcagagagga aacccataat ttgtctgtaatccctaatgc

[0263] 15180 caacagttgt tcattaagaa acaaaacta tgtaatcttg attatttgctcagatttcta

[0264] 15240 ctctatcatg ttttgtgcat ctggcaggct aatgtaattt tcctcagaaacccaaagcaa

[0265] 15300 tctggtgctc to be the first to be held

[0266] 15360 acts of the cacgate atttgcattc attagagtgt tggggaaaattgtttctaa

[0267] 15420 atggcagaaa attgaaagaa ggattaaggg caagagcttg aaaatcctgtttggcttgat

[0268] 15480 acgactatat tacagatgat ttttctctta caaggcctaa tatttaatgtggaagtatta

[0269] 15540

[0270] 15600 gggcatatgg acttgctttt gcttgattca agtgtggaac agataatttcccatgcaatg

[0271] 15660 ccaaggagct taaatgtgta aaagataggg tgattaattt ttcaagaaagaaccaagcctt

[0272] 15720 ttttttgaga taacagagaa acacaatttc gttccttatg gagtaacaagttatcggtca

[0273] 15780 gtgcctttgt ttttgtgatc aaggaagaa ggtaacagaa ttaaactcctgaatctgaaa

[0274] 15840 tactcccaaa taaaggggaa atcccataa gcccacacac tgggcaaaccttaaatcact

[0275] 15900 ggtaatagat cccaaatgtt gtactgattt aaataataat aataaaaaagattcaaccccc

[0276] 15960 acctcctggt ggctagctat tttctttgca atttccaggg ccagtcatttggcatttgtg

[0277] 16020 gaattggtta caggccgtgt gctggggcct gcgcctgact gtggttcgaggcaattgtct

[0278] 16080 gcaaatcctg tctctgggca gctcggctgc tgtggggcta aattcagcgctggcttcctg

[0279] 16140 agggctcgga gcaggtgctc gccaatggct ttggcttctc cctctgacagatgagcaagc

[0280] 16200 ggagccgctc ccctggaggg aagccagctg agcagccatt agcagtcacagcctttgaat

[0281] 16260 gtccaggcta gtctagctgc tcgcagaatc ctgactgttt gggattcaggctttggcctt

[0282] 16320 agcctgaatg aggtcgggca gcatggtaga ggaacttgtt acttaaaatgtgttctgggt

[0283] 16380 ggccaaagct ttggcatcgt ctagaggctt gtgggaaatg cagaaactcaggccccaccc

[0284] 16440 ccaacccact gagtcagcct ctgcattttc gcatggcccc gaggatatgcataggctcat

[0285] 16500 tcaagtttga caaaagctgg gttctaggac attgggcctc agacgttcagaggcataatg

[0286] 16560 aatgatcaca ccaagaactt gtcacaaact cacattcctg ggcccacgattcagtttcag

[0287] 16620 gaggtctggg gaaggtgagg tgaggcccca ggtgactctg atgcaaagggttcctggcac

[0288] 16680 cacactagag aaacacctgg ctagaggaac actcatggat tgaaatccaccttgcctacc

[0289] 16740 gagttagtgg aaaagttgat taatggctct aaaccccaat ttccccactttaacatggag

[0290] 16800 ctcctatttt acaggtttgt tgtgagaact cggagagctc aggtctgcagaaggttttag

[0291] 16860 cacagcatcc tgtgcatttt aggccctggc taagacatta cttccctttttcttccttct

[0292] 16920 ccactttgca acccacttcc tccatctgat tccctgccca cggggtcttccctatgcccc

[0293] 16980 aatgtcccta ccttagcgat agcttcccaa tgccccttat gcttgtacctgtccagttct

[0294] 17040 atccttctgg ctaggtctcc aatctccaag ttttttctaa caaccgccatcccagccccc

[0295] 17100 aattctagct gcagtgcaat aaagtgtatc tgtcccagag cctagccttttagtctcaat

[0296] 17160 tctctgctaa actggcagat gactcaaagc taatagctaa gattctgtgcaatggtttaa

[0297] 17220 gtatgccgtt tctgttggtt actttaagga gattatatat cttagcccagtggttca

[0298] 17280 ctatggctac atacgagt catctggagg tcattttata agatgcccaagtctttcaa

[0299] 17340 tccactgtga ttctggttca ttggttgag agaagaccca cgcattggtatattttaaa

[0300] 17400 aattcccagc cagctttgg gctgctcact gagcaaccca aactgagaattcgtgtccta

[0301] 17460 aaaaagta tcaggaggc taaaaag atattttag ctgaaaagaccttcagca

[0302] 17520 cacaccagat tagatcatt cagccatctc tcaccagat tggtgttaaatattgaccc

[0303] 17580 acatctcctt cagttctcta acataccatt atttaggtttt ttcatgataaatgctctcctg

[0304] 17640 gattagctt tagaggtag attccttct ttgttaagtc attaaaaatactgtgagaaa

[0305] 17700 gcaacttctt cttccaatac caatctatg atactagga atatctttttagtacctagg

[0306] 17760 taattccata acatcttgct cttgttttca gtaaactact tttggaaagagccaagcg

[0307] 17820 ggtgtgcatg cccagaaagg tggtggatgc gtgtgtgtgt gtgtgtgtgtatgtatgtat

[0308] 17880 gtatgtgtat gtgtgtgttc caaagataaa atacgcgtta ggaaatttcagtagtatc

[0309] 17940 acagtaaaa aattgcaggg ttggagaaca gatcaacata tatcagatccttgcattcct

[0310] 18000 ataatagagc tctgaaaaca aacagaaatg tgtaatacaa tgtcaaacaatgctcaataa

[0311] 18060 atgtaatttc cttcctcatt cattcattta cctcaaagct acattgccacaaatttttatt

[0312] 18120 tgctgaattc tctagctgcc atgtaataaa gctagcaatt gataaaattattaaggcc

[0313] 18180 tataactga ggtaagcgac attcagacta aaattataga ctgttaagaaaataaaagt

[0314] 18240 agcatcatag gcattgttca gtatttagta tctgtcactc actattaaaattagttgca

[0315] 18300 tatattacct catgtaatcc tcattaaaac tctgaagtgg acattaattatttttcttata

[0316] 18360 ggttaaacaa actgaggcac agagaggtga agtaacttgc ttaaggtcaaagagagta

[0317] 18420

[0318] 18480 aaaccataac taaagaaaa aaactatagc ttttcatttt gtttctttttttttcttttt

[0319] 18540 ctttttcttt tctttttctt tttttttttt gagatggagt ctcgctctgtcacccaggct

[0320] 18600 ggagtgcaat ggcacaattt cggctcactg caccctccgg ctcccgagttcaagcaattc

[0321] 18660 tctggcctca gcctcttgag tagctaggat tacaggcatg cgctaccacaccccggctaat

[0322] 18720 ttttgtattt ttagtagaga cgaggtttca ccatgttggt taggctgatctcaaactcct

[0323] 18780 gacctagtga tctgcccgcc tcagcctccc aaagtgctgg gattacaggcgtgagccacc

[0324] 18840 acacccggcc ttcatttctg tttcatttaa aatgaaaata agtgaattaaaacctttacac

[0325] 18900 aggaagatgg ggaaaacaaa tctaggagag tagaacaag ttttcttttttataaaaag

[0326] 18960

[0327] 19020 aagaaaaaag agaaaaaaa cgaatacata aatatatgct gaataagaggtatttttaat

[0328] 19080 aaaagaatac tttctgcatc tctgtgtggg tatatttaaa aatttagatggaataaacat

[0329] 19140 tttgtaagta atagataagc tacaaaaact tgggtctaga aatacaaaacctaagcagtt

[0330] 19200 acattgtctt gaaaattctt ttaaaagtta acagaattttt cctaatcttttttttttt

[0331] 19260 ttttcaaaag ctttggaaca tttgattcta tggaaaaatt cttcgaagttttcaaataat

[0332] 19320 ttccatgtct ggaaagaaaa actatagaaa gctattcaat tcattttgtaaaggtagctt

[0333] 19380 aactctgatt caaaaacgtg acagagaaaa gaaagacggg aggtaggaaaaaggaatgg

[0334] 19440 aggaagagag aaaagggagg tggaagggaa gaaacacaag aggaagaaaggagaaaatt

[0335] 19500 tactttataa ataagagtac aagacgctaa gtgaaatatt gataaattgaactcagcact

[0336] 19560 acattaaaag catgataata aattggcgga cttattacgt tttttatttctgtatgcata

[0337] 19620 ttgggttaat gttaagactt ctattattta atccattata tcaataattcaaaacagaaa

[0338] 19680 aaaacccata taatcatcta gttatatgcc aacaaagata tgcctagaa。

[0339] NFIB amino acid sequence (SEQ ID NO.2):

[0340] 1 mmyspicltq defhpfieal lphvraiayt wfnlqarkrk yfkkhekrms kdeeravkde

[0341] 61 llsekpeikq kwasrllakl rkdirqeyre dfvltvtgkk hpccvlsnpd qkgkirridc

[0342] 121 lrqadkvwrl dlvmvilfkg iplestdger lmksphctnp alcvqphhit vsvkeldlfl

[0343] 181 ayyvqeqdsg qsgspshndp aknppgyled sfvksgvfnv selvrvsrtp itqgtgvnfp

[0344] 241 igeipsqpyy hdmnsgvnlq rslssppssk rpktisiden mepsptgdfy pspsspaags

[0345] 301 rtwherdqdm sspttmkkpe kplfssaspq dssprlstfp qhhhpgipgv ahsvistrtp

[0346] 361 pppsplpfpt qailppapss yfshptiryp phlnpqdtlk nyvpsydpsspqtsqswylg。

[0347] TEKT1 nucleotide sequence (SEQ ID NO.3):

[0348] 1 gttcgttgca acaaattgat gagcaatgct ttttaat gccaactttg tacaaaaag

[0349] 61 ttggcatggc taaactatta siacctccac ccaagttct gccctcagag tggcacattg

[0350] 121 ctaacaagaa ccagtaccac agagcagacg ctcaaggtc ccgatcagaa cgcctggtcg

[0351] 181 cagaaagcca gaggctgtg gatgaattg aaagaccac aagaaatct caagcgatg

[0352] 241 tgaacagaa actagaacag agactcgagg aagtccagtt ctggaagaag gagttagatg

[0353] 301 aaacttga gcagcttgtg aatgtaactg atgatctact catatataag atcagattgg

[0354] 361 aaaaagccct gagaccttg aagagccct tgcacatcac tgagacatgc ctggcataca

[0355] 421 gggagaagcg cattggcatt gacctggtgc acgacacagt ggagcatgag ctgataagg

[0356] 481 aggctgagat catccaggggc attatggctc tgctgacccg taccttggag gaggcttccg

[0357] 541 agcagattcg gatgaccgc tctgccaagt acatcttga gaaggatttg aaggacaagt

[0358] 601 ttgtggccct gaccatagt gatatctgct tctcgctcaa caacaactca ccaaacatca

[0359] 661 gatattctga gaacgccgtg aggattgagc caaactccgt gagtctgga gactggttgg

[0360] 721 acttctccag caccaatgtg gagaaggctg acaagcagcg gaacaactcc ctgatgctgt

[0361] 781 ctgccctggt ggatcgaatc ctgtcccaga cagccaatga tctgcgcaag cagtgtgatg

[0362] 841 tggtggacac ggcattcaag aatgggctga aggatacaaa ggatgccagg gacaagctgg

[0363] 901 ctgatcatct ggccaaggtc atggaagaga ttgcttccca ggagaaaat attacagctc

[0364] 961 ttgaaaaggc catccttgac caagaagggc cagccaaggt ggctcatacg cgcttggaga

[0365] 1021 ccaggacaca ccggccgaac gtggagctgt gtcgtgatgt cgcacaatatagctaatga

[0366] 1081 aggaggttca agagatcacc cacaatgtcg caagattga ggaaactttagcccaagctc

[0367] 1141 aggcagagct gaaagggctg catcgcagac agcttgccct gcaggaggagatccaggtca

[0368] 1201 aagagaacac catttatatc gacgaagtgc tgtgtatgca gatgaggaaatccatcccac

[0369] 1261 ttcgggatgg ggaagaccat ggggtctggg ctgggggcct ccgccctgatgctgtctgct

[0370] 1321 acccaacttt cttgtacaaa gttggcatta taagaaagca ttgcttatcaatttgttgca

[0371] 1381 acgaac

[0372] TEKT1 amino acid sequence (SEQ ID NO.4):

[0373] 1 marllqappk fhpsewdtan kmqcastesq ksrsermiae srrlldetek ttqktrsdvn

[0374] 61 kkieqrreei kfwkqelenk leqivhetev lltfktrlek slesckeplv iaqrcllnrq

[0375] 121 rragidlvhd eveqelvkea evlqgviall grtleqtneq irlnrsakys lemdlkdkft

[0376] 181 almiddycas ltnntpdiry adnavkiegn fvspedwidf sniniekadk qrnnslalga

[0377] 241 lidgilsqtr ndmrkqcemv nvafrnkvke vkdakhklet llamvmdeta sqekniaalk

[0378] 301 kaiadkegpv kvaqnrlear nhrpnvelcy dtvqyrlise vqeitknmqr qstlaqaetv

[0379] 361 lkglsrrqls leeeiqvken tlyidevlcm qmresvysf。

[0380] Wherein, the liver fibrosis detection reagents include reagents for enzyme-linked immunosorbent assay, reagents for immunoblotting, reagents for immunoprecipitation analysis, reagents for mass analysis or reagents for protein microarray.

[0381] Wherein, the liver fibrosis detection reagent is used to detect NFIB and its downstream target genes in hepatic stellate cells.

[0382] The present invention also provides a liver fibrosis detection reagent and / or kit, which comprises a reagent for detecting the expression level of TEKT1 gene.

[0383] The present invention also provides the use of NFIB and its downstream target genes in the preparation of a drug for treating liver fibrosis. The drug blocks the process of liver fibrosis by increasing the expression of NFIB in hepatic stellate cells.

[0384] Furthermore, the drug downregulates the expression level of TEKT1 gene.

[0385] The present invention also provides the use of TEKT1 gene as a diagnosis and prognosis marker for liver fibrosis.

[0386] Beneficial effects:

[0387] The present invention has found that NFIB is abnormally downregulated in liver fibrosis, and after NFIB is overexpressed, the expression level of the TEKT1 gene decreases and the level of liver fibrosis improves. Therefore, liver fibrosis can be screened and the severity of fibrosis can be assessed by detecting the expression levels of NFIB and TEKT1 in the sample to be tested. The key to the present invention is to provide that NFIB is a key factor in regulating liver fibrosis, which can be used to diagnose liver fibrosis and the severity of fibrosis. Therefore, any method and reagent that can detect the expression level of NFIB can be used for screening liver fibrosis and the severity of fibrosis. Therefore, using NFIB and its downstream target gene TEKT1 as detection targets can be used to prepare liver fibrosis detection reagents and / or kits. BRIEF DESCRIPTION OF THE DRAWINGS

[0388] Figure 1 Schematic diagram of mouse liver fibrosis model;

[0389] Figure 2 This is a schematic diagram of the appearance of the liver of mice in different groups after being fed with CDAA feed for 8 weeks;

[0390] Figure 3 The results of Masson and Sirius red staining experiments are shown in Figure 2;

[0391] Figure 4 This is the experimental result diagram of PCR;

[0392] Figure 5The graph shows the results of the measurement of total cholesterol (TC), triglyceride (TG), aspartate aminotransferase (AST) and alanine aminotransferase (ALT) in mouse serum;

[0393] Figure 6 This is the PCA diagram of RNA-seq sequencing samples;

[0394] Figure 7 Heat map of RNA-seq sequencing samples. DETAILED DESCRIPTION

[0395] The technical solution of the present invention is described in detail below through specific embodiments, but the protection scope of the present invention is not limited to the embodiments.

[0396] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0397] Example 1 Establishment of experimental mouse model

[0398] 1. In order to clarify whether NFIB has the effect of blocking the process of liver fibrosis, this experiment constructed mice with hepatic stellate cell-specific overexpression of NFIB.

[0399] Experimental animals: 8-week-old C57BL / 6WT male mice were purchased from the laboratory of Nanjing Medical University. The experimental subjects were divided into 2 groups: control group and experimental group, with 6 mice in each group and each mouse weighing 20±1.5g.

[0400] Animal model: A mouse model of liver fibrosis was established using carbon tetrachloride (CCl4) (3 weeks) and choline-deficient amino acids (CDAA) (8 weeks).

[0401] Modeling scheme:

[0402] (1) CCl4 model: CCl4 and corn oil were mixed in a ratio of 1:9 to form a 10% mixed solvent, and 10 mL / kg was intraperitoneally injected once every 2 days for a total of 3 weeks.

[0403] (2) CDAA model: The mice were fed with CDAA diet (purchased from Deci Biotechnology (Wuxi) Co., Ltd.) for 8 weeks.

[0404] The mice in the experimental group were injected with 1×10 HSC-targeted virus carrying the Postn promoter (AAV6-postn-LVNFIB, purchased from Nanjing Zebrafish Biotechnology Co., Ltd.) through the tail vein.11 vg / ml, to achieve the purpose of specifically overexpressing NFIB in hepatic stellate cells. The NFIB overexpression sequence is (SEQ ID NO.5):

[0405] gtcagatcgc ctggagacgc catccacgct gttttgacct ccatagaga caccgactctactagaggat cgctagcgctaccggactca gatctcgagg ccaccATGAT GTATTCTCCC ATCTGTCTCACTCAGGATTTCACCCA TTCGTCCTTAGAT CACTTCGAG GCAATTGCCTATACTTGGTTCAACCTGCAG GCTCGAAAAC GCAAGTACTT TAAAAAGCATGAGAAGCGAA TGTCAAAGGA TGAAGAAAGAGCAGTCAAAG ATGAGCTTCTCAGTGAAAAG CCTGAAATCA AACAGAAGTG GGCATCCAGGCTCCTT CAGGAAACTGCTCGCAA TGTGCTCACCGTGACTGGCAAGAAAGCACCC GTGCTGTGTC TTATCCAATC CCGACCAGAAGGGTAAGATT AGGAGAATCG ACTGCCTGCGACAGGCAGAC AAAGTCTGGCGTCTGGATCT AGTCATGGTG ATCCTGTTCA AAGGCATCCGATCAATTGGCGAATGCACCCAC ACCCAGCACTTTGTGTCCAGCCACATCATA TCACAGTATC AGTTAAGGAG CTTGATTTGTTTTTGGCATA CTACGTGCAG GAGCAAGATTCTGGACAATC AGGAAGTCAAGCCACAATG ATCCTGCCAA GAATCCTCCAGTTACCTTGAGGACTCTGTTGATTGAATGATCAAA GTATCCAGAACGCCCATAACCCAGGGAACT GGAGTCAACT TCCCAATTGG AGAAATCCCAAGCCAACCAT ACTATCATGA CATGAACTCGGGGGTCAATC TTCAGAGGTCTCTGTCTTCT CCACCAAGCA GCAAAAGACCCAAAACTATATCCATAGATGAAAATATGGA ACCAAGTCCT ACAGGAGACT TTTACCCCTC TCCAAGTTCACCAGCTGCTGGAAGTCGAAC ATGGCACGAA AGAGATCAAG ATATGTCTTCTCCGACTACT ATGAAGAAGC CTGAAAAGCCATTGTTCAGC TCTGCATCTCCACAGGATTC TTCCCCAAGA CTGAGCACTT TCCCCCAGCACCACCATCCCGGAATACCTG GAGTTGCACA CAGTGTCATC TCAACTCGAA CTCCACCTCCACCTTCACCGTTGCCATTTC CAACACAAGC TATCCTTCCT CCAGCCCCATCGAGCTACTT TTCTCATCCA ACAATCAGATATCCTCCCCA CCTGAATCCTCAGGATACTC TGAAGAACTA TGTACCTTCT TATGACCCATCCAGTCCACAAACCAGCCAG TCCTGGTACC TGGGCcgcgg ccgcgactac aaagaccatg acggtgatta taaagatcat gacatcgact acaaggatga cgatgacaag taggaattct gcagtcgaca cgcgtgcgggcccgggatcc actagtctag aaaggatctg cgatcgctcc g

[0406] The lowercase bases are the vector sequences, the uppercase bases are the inserted NFIB target sequences; the underlined part is 3FLAG.

[0407] 2. Mouse model of liver fibrosis

[0408] Inject 1 × 10 viruses via tail vein 11 vg / ml. One week later, CCl4 and corn oil were mixed into a 10% mixed solvent at a ratio of 1:9 and injected intraperitoneally at 10 mL / kg for 3 weeks or fed with CDAA feed for 8 weeks to construct two mouse liver fibrosis models.

[0409] Schematic diagram of mouse liver fibrosis model Figure 1One week before mice were fed with CDAA feed, the experimental group mice were injected with AAV6 virus carrying Postn promoter (Nanjing Zebrafish Biotechnology Co., Ltd.) through the tail vein to achieve heterosexual overexpression of NFIB in hepatic stellate cells. The control group mice were injected with the same dose of empty virus (Nanjing Zebrafish Biotechnology Co., Ltd.) and fed with CDAA feed for 8 weeks or intraperitoneally injected with CCl4 for 3 weeks to construct a mouse liver fibrosis model.

[0410] Schematic diagram of the appearance of the livers of mice in the control and experimental groups after 8 weeks of CDAA feeding. Figure 2 , the control group mice had more obvious liver damage.

[0411] Example 2 Masson and Sirius Red Staining Experiment

[0412] 1. Masson staining

[0413] Reagents and equipment: Masson staining kit (Cat#G1340), slides (REF.188105), coverslips (REF.10212450C), neutral resin (REF.CS703), microscope (Leica DM300).

[0414] Steps:

[0415] (1) Dewaxing of paraffin sections to water: The paraffin sections of mouse liver were dewaxed in xylene solution for 10 minutes, fresh xylene solution for 10 minutes, anhydrous ethanol for 5 minutes, 95% ethanol for 5 minutes, 85% ethanol for 5 minutes, 75% ethanol for 5 minutes, and distilled water for 5 minutes.

[0416] (2) Dye with Ponceau red and acid fuchsin for 4 minutes, then pour off the dye and rinse with running water (the tissue will now be bright red).

[0417] (3) Shake dry slightly, differentiate in phosphomolybdic acid differentiation solution for 3 min, pour off the phosphomolybdic acid differentiation solution, and do not wash with water.

[0418] (4) Dye with aniline blue solution for 5 min, then pour off the solution without washing. Then differentiate with 1% glacial acetic acid in 2 cylinders, each cylinder for 5 s.

[0419] (5) After rapid water washing, dehydrate with 95% alcohol and anhydrous ethanol, make the slides transparent with xylene, and seal them with neutral gum after air drying.

[0420] (6) Observation under a microscope.

[0421] 2. Sirius red staining

[0422] Reagents and instruments: Sirius red staining kit (Cat.NO.RS1220), slides (REF.188105), coverslips (REF.10212450C), neutral resin (REF.CS703), microscope (Leica DM300).

[0423] Steps:

[0424] (1) Dewaxing of paraffin sections: Dewaxing sections were sequentially placed in xylene solution for 10 min, fresh xylene solution for 10 min, anhydrous ethanol for 5 min, 95% ethanol for 5 min, 85% ethanol for 5 min, 75% ethanol for 5 min, and distilled water for 5 min.

[0425] (2) Sirius red staining: Add Sirius red staining solution to the slices and stain for 1 hour. Then, rinse the slices gently with running water to remove the staining solution on the slice surface.

[0426] (3) Dehydration and transparency: Dehydrate the stained sections in 95% ethanol I for 2 min, then dehydrate in 95% ethanol II (2 min), anhydrous ethanol I (3 min), and anhydrous ethanol II (3 min). Transparent the sections with xylene I (5 min) and xylene II (5 min), then seal the sections with neutral gum.

[0427] (4) Observation under a microscope.

[0428] Masson and Sirius red staining results are shown in Figure 3 As can be seen from the figure: compared with the control group, the collagen deposition in the experimental group of mice was reduced, suggesting that overexpression of NFIB can improve the level of liver fibrosis in mice.

[0429] Example 3 Verification of the expression levels of Acta2, Col1a1, Col3a1 and Postn

[0430] 1. RNA extraction and PCR experiment of liver tissues of mice in the control group and experimental group

[0431] Total RNA was isolated using TRIzol reagent (Thermo Fisher, Lot: 7F742D3). The concentration and quality of RNA were measured using a Thermo nanodrop one, and the RNA samples of the control and experimental groups were adjusted to similar concentrations (5 ng / ml) for use. Reverse transcription was performed using a Veriti 96-Well Thermal Cycler PCR instrument and HiScript IIQ RT SuperMix for QPCR (Vazyme # R222-01).

[0432] Specific primers were further designed for circRNA, and q-RT-PCR analysis was performed using the Thermofisher QuantStudio 5 real-time fluorescence quantitative PCR system (PCR reaction program settings: Stage 1 pre-denaturation 95°C 20 seconds; Stage 2 cycle reaction 95°C 10 seconds, 60°C 30 seconds; Stage 3 melting curve; PCR reaction system: substrate (DNA) 2.5μl, ChamQ SYBR Color QPCR Master Mix (Vazyme#Q411-02) 5μl, DEPC 2μl, primer 0.5μl). Table 1 lists the primer sequence information used.

[0433] Table 1 Primer sequence information

[0434]

[0435] The above primers were purchased from Anhui General Biology.

[0436] The experimental results are shown in Figure 4 As can be seen from the figure, the RNA results showed that the levels of profibrosis-related genes were significantly reduced in the experimental group (overexpressing NFIB) mice.

[0437] Example 4 Determination of TC, TG, ALT and AST levels in mouse serum

[0438] 1. Serum TC

[0439] Reagents and instruments: TC assay kit (Nanjing Jiancheng A111-1-1TC assay kit 96T), microplate reader, 96-well microplate.

[0440] Steps:

[0441] (1) Sample preparation: Take out serum (blood from the ocular vein) and liver tissue from the sample library. For liver tissue samples, the tissue weight must be accurately weighed, and 9 times the volume of anhydrous ethanol is added at a ratio of weight (g): volume (mL) = 1:9. Mechanical homogenization is performed in an ice water bath, centrifuged at 2500 rpm for 10 minutes, and the supernatant is collected for testing.

[0442] (2) The sample addition process is shown in Table 2:

[0443] Table 2 Sample addition process

[0444]

[0445] The assay was performed according to the kit instructions.

[0446] 2. Serum TG

[0447] Reagents and instruments: serum TG (Nanjing Jiancheng. A110-1-1TG assay kit 96T), microplate reader, 96-well microplate.

[0448] The operation steps are the same as those for serum TC.

[0449] 3. Serum AST

[0450] Reagents and instruments: serum AST detection kit (Cat# BC1565), microplate reader, 96-well microplate.

[0451] The serum AST detection kit contains: reagent 1, reagent 2, reagent 3, and standard.

[0452] Steps:

[0453] (1) Sample preparation: Centrifuge the serum at 600 g for 10 min at 4°C and transfer the supernatant to a new centrifuge tube for later use.

[0454] (2) Dilution of standard curve: First, dilute the standard with distilled water to 2 μmol / ml. Mix the standard and reagent 1 according to Table 3 to obtain a concentration gradient standard tube:

[0455] Table 3 Mixture of standard and reagent 1

[0456] Standard (μL) Reagent 1 (μL) Standard tube concentration (μmol / mL) 15 15 1 12 18 0.8 6 24 0.4 3 27 0.2 1.5 28.5 0.1 0.75 29.25 0.05 0 30 0

[0457] (4) The AST activity determination process is shown in Table 4:

[0458] Table 4 AST activity determination

[0459]

[0460] 4. Serum ALT

[0461] Reagents and instruments: serum ALT (Cat# BC1555), microplate reader, 96-well microplate.

[0462] The operation steps are the same as AST.

[0463] Serum TC, TG, ALT, and AST test results are shown in Figure 5 .in, Figure 5 A. 5E is ALT, Figure 5 B is TC, Figure 5 Figure C is TG, and Figure D is AST.

[0464] As can be seen from the figure, the levels of TC, TG, AST and ALT in the experimental group mice decreased to a certain extent compared with the control group. The above results suggest that in the process of liver fibrosis induced by CDAA diet or CCl4, the process of liver fibrosis can be blocked by increasing the expression of NFIB in hepatic stellate cells.

[0465] Example 5

[0466] To further elucidate the specific molecular mechanism by which NFIB in hepatic stellate cells blocks the fibrosis process, we used lentivirus expressing Flag-tagged NFIB protein to transfect primary human hepatic stellate cells (Lonza, CAT#HUCLS) to upregulate the expression level of NFIB in cells, and performed RNA-seq sequencing on the experimental group (NFIB overexpression group) and the control group (NFIB non-overexpression group).

[0467] The NFIB overexpression sequence is (SEQ ID NO.6):

[0468] gtcagatcgc ctggagacgc catccacgct gttttgacct ccatagaaga caccgactctactagaggat cgctagcgct

[0469] accggactca gatctcgagg ccaccATGAT GTATTCTCCC ATCTGTCTCA CTCAGGATGA

[0470] ATTTCACCCATTCATCGAGG CACTTCTTCC ACATGTCCGT GCAATTGCCT

[0471] ATACTTGGTT CAACCTGCAG GCTCGAAAAC GCAAGTACTT TAAAAAGCAT

[0472] GAGAAGCGAA TGTCAAAGGA TGAAGAAAGA GCAGTCAAAG ATGAGCTTCT

[0473] CAGTGAAAAG CCTGAAATCA AACAGAAGTG GGCATCCAGG CTCCTTGCCA

[0474] AACTGCGCAA AGATATTCGC CAGGAGTATC GAGAGGACTTTGTGCTCACC

[0475] GTGACTGGCA AGAAGCACCC GTGCTGTGTC TTATCCAATC CCGACCAGAA

[0476] GGGTAAGATT AGGAGAATCG ACTGCCTGCG ACAGGCAGAC AAAGTCTGGC

[0477] GTCTGGATCT AGTCATGGTG ATCCTGTTCA AAGGCATCCC CTTGGAAAGT

[0478] ACCGATGGAG AGCGGCTCAT GAAATCCCCA CATTGCACAA ACCCAGCACT

[0479] TTGTGTCCAG CCACATCATA TCACAGTATC STAY CTTGATTTGT

[0480] TTTTGGCATA CTACGTGCAG TOUCH CTGGACAATC TOUCHTCCA

[0481] AGCCACAATG ATCCTGCCAA GAATCCTCCA GGTTACCTTG BUYGTTT

[0482] TGTAAAATCT GGAGTCTTCA ATGTATCAGA ACTTGTAAGA GTATCCAGAA

[0483] CGCCCATAAC CCAGGGAACT GGAGTCAACT TCCCAATTGG AGAAATCCCA

[0484] ACTACCAT ACTATCATGA CATGAACTCG GGGGTCAATC TTCAGAGGTC

[0485] TCTGTCTTCT CCACCAAGCA GCAAAAGACC CAAAACTATA TCCATAGATG

[0486] AAAATATGGA ACCAAGTCCT ACAGGAGACT TTTACCCCTC TCCAAGTTCA

[0487] CCAGCTGCTG GAAGTCGAAC ATGGCACGAA GAAGTCGAAG ATATGTCTTC

[0488] TCCGACTACT ATGAAGAAGC CTGAAAAGCC ATTGTTCAGC TCTGCATCTC

[0489] CACAGGATTC TTCCCCAAGA CTGAGCACTT TCCCCCAGCA CCACCATCCC

[0490] GGAATACCTG GAGTTGCACA CAGTGTCATC TCAACTCGAA CTCCACCTCC

[0491] ACCTTCACCG TTGCCATTC CAACACAAGC TATCCTTCCT CCAGCCCCAT

[0492] CGAGCTACTTTTCTCATCCA ACAATCAGAT ATCCTCCCCA CCTGAATCCT

[0493] CAGGATACTC TGAAGAACTA TGTACCTTCT TATGACCCAT CCAGTCCACAAACCAGCCAGTCCTGGTACC TGGGCcgcgg ccgcgactac aaagaccatgacggtgatta taaagatcatgacatcgact acaaggatga cgatgacaag taggaattct gcagtcgaca cgcgtgcggg cccgggatcc actagtctagaaaggatctg cgatcgctcc g

[0494] The lowercase bases are the vector sequences, the uppercase bases are the inserted NFIB target sequences; the underlined part is 3FLAG.

[0495] The PCA diagram of RNA-seq sequencing samples is shown in Figure 6 .

[0496] The PCA results suggested that the clustering effect between the two groups [NFIB overexpression group (ad_NFIB) and NFIB non-overexpression group (Con)] was good, and subsequent analysis was possible.

[0497] Heat map of RNA-seq sequencing samples is shown in Figure 7 The heat map shows the significantly differentially up-regulated and down-regulated genes in three control samples (Con1, Con2, Con3) and three overexpression samples (ad_NFIB1, ad_NFIB2, ad_NFIB3). It can be seen from the figure that the TEKT1 gene is significantly down-regulated in the NFIB overexpression group.

[0498] NFIB is abnormally downregulated in liver fibrosis, and after NFIB is overexpressed, the expression level of TEKT1 gene decreases and the fibrosis level improves. Therefore, liver fibrosis can be screened and the severity of fibrosis can be assessed by detecting the expression levels of NFIB and TEKT1 in the sample to be tested.

[0499] As described above, although the present invention has been shown and described with reference to specific preferred embodiments, it should not be construed as limiting the present invention itself. Various changes in form and details may be made without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. Use of NFIB and its downstream target genes in the preparation of liver fibrosis detection reagents and / or kits, characterized in that: The liver fibrosis detection reagent and / or kit uses NFIB and its downstream target genes as detection targets.

2. The use according to claim 1, characterized in that: The downstream target gene is the TEKT1 gene.

3. The use according to claim 1, characterized in that: The liver fibrosis detection reagent and / or kit contains the sequences shown in SEQ ID NO.1 to SEQ ID NO.

4.

4. The use according to any one of claims 1 to 3, characterized in that: The liver fibrosis detection reagents include reagents for enzyme-linked immunosorbent assay, reagents for immunoblotting, reagents for immunoprecipitation analysis, reagents for mass analysis or reagents for protein microarray.

5. The use according to any one of claims 1 to 3, characterized in that: The liver fibrosis detection reagent is used to detect NFIB and its downstream target genes in hepatic stellate cells.

6. A liver fibrosis detection reagent and / or kit, characterized in that: It includes a reagent for detecting the expression level of the TEKT1 gene.

7. Use of NFIB and its downstream target genes in the preparation of drugs for the treatment of liver fibrosis, characterized in that: The drug blocks the process of liver fibrosis by increasing the expression of NFIB in hepatic stellate cells.

8. The use according to claim 7, characterized in that: The drug reduces the expression level of the TEKT1 gene.

9. Application of TEKT1 gene as a diagnostic and prognostic marker for liver fibrosis.

Images