Promoter switch for tissue-specific expression

Abstract

Described herein are switchable core promoters that can selectively promote transcription initiation in the presence of an activated response element, such as an activated enhancer. These switchable core promoters may be paired with cell type-specific or cell state-specific response elements to produce engineered promoters that selectively promote transcription of a payload sequence in a target cell type or target cell state. Also described herein are methods of selectively expressing a payload in a target cell type or a target cell state using switchable core promoters and polynucleotides containing switchable core promoters.

Description

[0001] Cross-references

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 329,211, filed on April 8, 2022, entitled “Promoter Switch for Tissue-Specific Expression,” and U.S. Provisional Application No. 63 / 423,977, filed on November 9, 2022, entitled “Promoter Switch for Tissue-Specific Expression,” each of which is incorporated herein by reference in its entirety for all purposes. Background Art

[0003] Various diseases and conditions are caused by the expression of mutation, deletion or change of genes. Many of these genes are strictly regulated in healthy individuals, so that overexpression or insufficient expression of genes can lead to harmful side effects. In addition, some diseases and conditions are characterized by different cell genotypes of healthy cells and diseased cells in the subject. Therefore, the expression of genes (such as transgenics) may be therapeutic in one cell type, but harmful in another cell type. Although substantial progress has been made in delivering transgenics to individuals to treat genetic disorders, there is still a need for gene therapy that can regulate transgenic expression in a cell type or cell state dependent manner. Summary of the invention

[0004] In various aspects, the present disclosure provides an engineered core promoter, wherein the engineered core promoter comprises a sequence having at least 80% sequence identity to SEQ ID NO:4 and comprising nucleotide substitutions T15G and A40T relative to SEQ ID NO:5.

[0005] In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO:4 and comprising nucleotide substitutions T15G and A40T relative to SEQ ID NO:5. In some aspects, the engineered core promoter comprises the sequence of SEQ ID NO:4.

[0006] In some aspects, the engineered core promoter further comprises a transcriptional pause site. In some aspects, the transcriptional pause site comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 196-SEQ ID NO: 198, SEQ ID NO: 211, or SEQ ID NO: 212. In some aspects, the transcriptional pause site comprises a sequence of any one of SEQ ID NO: 196-SEQ ID NO: 198, SEQ ID NO: 211, or SEQ ID NO: 212. In some aspects, the engineered core promoter further comprises a YY1 motif. In some aspects, the YY1 motif comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 205-SEQ ID NO: 207. In some aspects, the YY1 motif comprises a sequence having a sequence of any one of SEQ ID NO: 205-SEQ ID NO: 207. In some aspects, the engineered core promoter comprises a spacer of 30 to 34 nucleotides.

[0007] In some aspects, the engineered core promoter paired with an activated response element produces a transcriptional activity that is higher than the transcriptional activity produced when the core promoter of SEQ ID NO: 6 is paired with an activated response element, the engineered core promoter paired with an activated response element produces a basal transcriptional activity that is lower than the basal transcriptional activity produced when the core promoter of SEQ ID NO: 6 is paired with an inactive response element, or both. In some aspects, the engineered core promoter paired with an activated response element produces a transcriptional activity that is higher than the transcriptional activity produced when the core promoter of SEQ ID NO: 9 is paired with an activated response element, the engineered core promoter paired with an activated response element produces a basal transcriptional activity that is lower than the basal transcriptional activity produced when the core promoter of SEQ ID NO: 9 is paired with an inactive response element, or both.

[0008] In various aspects, the present disclosure provides an engineered promoter comprising a response element and an engineered core promoter as described herein.

[0009] In some aspects, the response element confers bone marrow-specific transcription, liver-specific transcription, neuron-specific transcription, muscle-specific transcription, or kidney-specific transcription of the payload under the transcriptional control of the engineered promoter. In some aspects, the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194. In some aspects, the response element comprises a sequence of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194.

[0010] In various aspects, the present disclosure provides a recombinant polynucleotide comprising an engineered core promoter as described herein or an engineered promoter as described herein and a payload comprising a coding sequence under the transcriptional control of the engineered core promoter.

[0011] In some aspects, the payload encodes a protein. In some aspects, the protein is a neuronal protein, a kidney protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. In some aspects, the protein is associated with a genetic disorder, a neuronal disorder, a kidney disorder, an eye disorder, a muscle disorder, or a cancer. In some aspects, the protein is progranulin, MeCP2, polycystin-1, or polycystin-2.

[0012] In some aspects, the payload encodes therapeutic polynucleotide. In some aspects, the therapeutic polynucleotide is a guide RNA or an inhibitory tRNA. In some aspects, a therapeutic polynucleotide targets a gene. In some aspects, the gene is related to a genetic disorder, a neuron disorder, a kidney disorder, an eye disorder, a muscle disorder or a cancer. In some aspects, the gene is GRN, MECP2, PKD2 or PKD2.

[0013] In various aspects, the present disclosure provides an engineered viral vector comprising an engineered core promoter as described herein, an engineered promoter as described herein, or a recombinant polynucleotide as described herein in a viral vector.

[0014] In some aspects, the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. In some aspects, the adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10. AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, A AV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.V1, AAV.PHP.B, AAV. PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AA V.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68 and their combinations.

[0015] In various aspects, the present disclosure provides a pharmaceutical composition comprising an engineered core promoter as described herein, an engineered promoter as described herein, a recombinant polynucleotide as described herein, or a viral vector as described herein, and a pharmaceutically acceptable carrier.

[0016] In various aspects, the present disclosure provides a method of treating a condition in a subject in need thereof, the method comprising: administering to the subject a composition comprising a recombinant polynucleotide as described herein, a viral vector as described herein, or a pharmaceutical composition as described herein; and expressing a therapeutic sequence encoded by the payload of the recombinant polynucleotide in a target cell of the subject, thereby treating the condition.

[0017] In some aspects, target cell is the cell type or cell state relevant to the disease.In some aspects, disease is genetic disease, neuron disease, kidney disease, eye disease, muscle disease or cancer.In some aspects, disease is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuron ceroid lipofuscinosis, cancer, atherosclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, edge-based age-related TDP-43 encephalopathy or polycystic kidney disease.In some aspects, therapeutic sequence encoding therapeutic protein.In some aspects, therapeutic protein is neuron protein, kidney protein, retinal protein, muscle protein or apoptosis inducing protein.In some aspects, therapeutic protein is genetic disease, neuron disease, kidney disease, eye disease, muscle disease or cancer related.In some aspects, therapeutic protein is MECP2, progranulin, polycystin-1 or polycystin-2.In some aspects, payload encoding therapeutic polynucleotide.In some aspects, therapeutic polynucleotide is guide RNA or suppressor tRNA.

[0018] In various aspects, the present disclosure provides a method of identifying a switchable core promoter, the method comprising: introducing a core promoter library comprising a first sub-library and a second sub-library into a cell population; wherein the first sub-library comprises a plurality of core promoters, wherein a core promoter in the plurality of core promoters is linked to a first response element, and a unique barcode sequence; wherein the second sub-library comprises a plurality of core promoters, wherein a core promoter in the plurality of promoters is linked to a second response element, and a unique barcode sequence; and identifying a switchable core promoter as a core promoter that promotes higher transcription of the unique barcode when paired with the first response element than when paired with the second response element.

[0019] In some aspects, the method further comprises activating the first response element. In some aspects, the second response element is not activated. In some aspects, the first response element is an activated response element and the second enhancer sequence is an inactive response element or a non-activated response element.

[0020] In various aspects, the present disclosure provides an engineered core promoter comprising a TATA box, an initiator element, a spacer separating the TATA box and the initiator element, and one or more features selected from the following: a) the TATA box comprises a sequence having at least 85% sequence identity to any one of SEQ ID NO: 199–SEQ ID NO: 201 or SEQ ID NO: 213–SEQ ID NO: 215; b) the initiator element comprises a sequence having at least 75% sequence identity to any one of SEQ ID NO: 202–SEQ ID NO: 204, SEQ ID NO: 216, or SEQ ID NO: 217; c) the spacer is a short spacer comprising no less than 25 and no more than 29 nucleotide residues from the TATA box to the initiator element; d) the spacer is a long spacer comprising no less than 31 and no more than 48 nucleotide residues from the TATA box to the initiator element; e) a YY1 motif comprising a sequence having at least 85% sequence identity to any one of SEQ ID NO: 205–SEQ ID NO: 206; NO:207; f) a transcription pause site comprising a sequence having at least 80% sequence identity to any one of SEQ ID NO: 196-SEQ ID NO: 198, SEQ ID NO: 211 or SEQ ID NO: 212; g) at least 70% sequence identity and at least one nucleotide substitution relative to SEQ ID NO: 5, SEQ ID NO: 9 or SEQ ID NO: 210; and h) combinations thereof.

[0021] In some aspects, the engineered core promoter comprises at least 70% sequence identity to SEQ ID NO: 5 and nucleotide substitutions T15G and A40C. In some aspects, the engineered core promoter comprises at least 70% sequence identity to SEQ ID NO: 5 and nucleotide substitutions T15A and A40T.

[0022] In some aspects, the spacer comprises 29 to 31 nucleotides from the TATA box to the initiator element. In some aspects, the spacer comprises 30 nucleotides from the TATA box to the initiator element. In some aspects, the short spacer comprises 28 nucleotide residues from the TATA box to the initiator element. In some aspects, the long spacer comprises 32 nucleotide residues from the TATA box to the initiator element.

[0023] In some aspects, the TATA box comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 199 - SEQ ID NO: 201 or SEQ ID NO: 213 - SEQ ID NO: 215. In some aspects, the TATA box comprises a sequence to any one of SEQ ID NO: 199 - SEQ ID NO: 201 or SEQ ID NO: 213 - SEQ ID NO: 215.

[0024] In some aspects, the starter element comprises a sequence having at least 85% sequence identity to any one of SEQ ID NO: 202 - SEQ ID NO: 204, SEQ ID NO: 216, or SEQ ID NO: 217. In some aspects, the starter element comprises a sequence of any one of SEQ ID NO: 202 - SEQ ID NO: 204, SEQ ID NO: 216, or SEQ ID NO: 217.

[0025] In some aspects, the YY1 motif comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 205 - SEQ ID NO: 207. In some aspects, the YY1 motif comprises a sequence of any one of SEQ ID NO: 205 - SEQ ID NO: 207.

[0026] In some aspects, the transcription pause site comprises a sequence having at least 95% sequence identity to any one of SEQ ID NO: 196 - SEQ ID NO: 198, SEQ ID NO: 211, or SEQ ID NO: 212. In some aspects, the transcription pause site comprises a sequence of any one of SEQ ID NO: 196 - SEQ ID NO: 198, SEQ ID NO: 211, or SEQ ID NO: 212.

[0027] In some aspects, the engineered core promoter comprises two or more features. In some aspects, the engineered core promoter comprises features a) and b). In some aspects, the engineered core promoter comprises three or more features. In some aspects, the engineered core promoter comprises features a) and b) and at least one or more features. In some aspects, the engineered core promoter comprises features a), b) and c). In some aspects, the engineered core promoter comprises features a), b) and d). In some aspects, the engineered core promoter comprises features a), b) and e). In some aspects, the engineered core promoter comprises features a), b) and f).

[0028] In various aspects, the present disclosure provides an engineered core promoter comprising a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99% or 100% sequence identity to any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7 or SEQ ID NO:10-SEQ ID NO:144.

[0029] In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 1 - SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10 - SEQ ID NO: 144. In some aspects, the engineered core promoter comprises a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 1 - SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 10 - SEQ ID NO: 15, or SEQ ID NO: 110. In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 1 - SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 10 - SEQ ID NO: 15, or SEQ ID NO: 110.

[0030] In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO:7. In some aspects, the engineered core promoter comprises a sequence of SEQ ID NO:7. In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO:1. In some aspects, the engineered core promoter comprises a sequence of SEQ ID NO:1. In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO:2. In some aspects, the engineered core promoter comprises a sequence of SEQ ID NO:2. In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO:3. In some aspects, the engineered core promoter comprises a sequence of SEQ ID NO:3. In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO:4 and comprising nucleotide substitutions T15G and A40T relative to SEQ ID NO:5. In some aspects, the engineered core promoter comprises a sequence of SEQ ID NO:4. In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 10. In some aspects, the engineered core promoter comprises a sequence of SEQ ID NO: 10. In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 11. In some aspects, the engineered core promoter comprises a sequence of SEQ ID NO: 11. In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 12. In some aspects, the engineered core promoter comprises a sequence of SEQ ID NO: 12. In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 13. In some aspects, the engineered core promoter comprises a sequence of SEQ ID NO: 13. In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 14. In some aspects, the engineered core promoter comprises a sequence of SEQ ID NO: 14. In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 15 and comprising nucleotide substitutions T15G and A40C relative to SEQ ID NO: 5. In some aspects, the engineered core promoter comprises a sequence of SEQ ID NO: 15. In some aspects, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 110. In some aspects, the engineered core promoter comprises a sequence of SEQ ID NO: 110.

[0031] In some aspects, the engineered core promoter comprises a TATA box, an RNA polymerase binding sequence, a B recognition element, a CCAAT box or a Pribnow box. In some aspects, the engineered core promoter can recruit a polymerase. In some aspects, the polymerase is RNA polymerase II.

[0032] In some aspects, the dynamic range of the engineered core promoter is higher than the dynamic range of SEQ ID NO: 6. In some aspects, the dynamic range of the engineered core promoter is higher than the dynamic range of SEQ ID NO: 9. In some aspects, the activity of the engineered core promoter is higher than the activity of SEQ ID NO: 6. In some aspects, the activity of the engineered core promoter is higher than the activity of SEQ ID NO: 9. In some aspects, the engineered core promoter paired with an activated response element produces a transcriptional activity that is higher than the transcriptional activity produced by the core promoter of SEQ ID NO: 6 when paired with an activated response element, the engineered core promoter paired with an activated response element produces a basal transcriptional activity that is lower than the basal transcriptional activity produced by the core promoter of SEQ ID NO: 6 when paired with an inactive response element, or both. In some aspects, the engineered core promoter paired with an activated response element produces a transcriptional activity that is higher than the transcriptional activity produced when the core promoter of SEQ ID NO:9 is paired with an activated response element, the engineered core promoter paired with an activated response element produces a basal transcriptional activity that is lower than the basal transcriptional activity produced when the core promoter of SEQ ID NO:9 is paired with an inactive response element, or both.

[0033] In various aspects, the present disclosure provides an engineered response element comprising a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99% or 100% sequence identity to any one of SEQ ID NO: 145 or SEQ ID NO: 146.

[0034] In some aspects, the engineered response element comprises a sequence with at least 90% sequence identity to SEQ ID NO: 145 or SEQ ID NO: 146. In some aspects, the engineered response element comprises a sequence of SEQ ID NO: 145 or SEQ ID NO: 146. In some aspects, the engineered response element is capable of binding to a cognate ligand, a coactivator, or a corepressor. In some aspects, the engineered response element is an enhancer. In some aspects, the binding of a cognate ligand or coactivator to an engineered response element increases the transcription of a payload in a target cell type, a target cell state, or a target tissue under the transcriptional control of an engineered response element paired with a core promoter. In some aspects, the binding of a corepressor to an engineered response element reduces the transcription of a payload in a non-target cell type, a non-target cell state, or a non-target tissue under the transcriptional control of an engineered response element paired with a core promoter. In some aspects, the engineered response element confers bone marrow-specific transcription of a payload under the transcriptional control of an engineered response element paired with a core promoter. In some aspects, the engineered response element comprises the sequence of SEQ ID NO: 145. In some aspects, the engineered response element confers liver-specific transcription of the payload under the transcriptional control of the engineered response element paired with a core promoter. In some aspects, the engineered response element comprises the sequence of SEQ ID NO: 146.

[0035] In various aspects, the present disclosure provides an engineered promoter comprising a response element and a core promoter; wherein the response element comprises a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99% or 100% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193 or SEQ ID NO: 194, and wherein the core promoter comprises a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99% or 100% sequence identity to any one of SEQ ID NO: 1-SEQ ID NO: 144 or SEQ ID NO: 210.

[0036] In some aspects, the core promoter comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 1 - SEQ ID NO: 144 or SEQ ID NO: 210. In some aspects, the core promoter comprises a sequence of SEQ ID NO: 1 - SEQ ID NO: 144 or SEQ ID NO: 210. In some aspects, the engineered promoter comprises a sequence of any one of SEQ ID NO: 148 - SEQ ID NO: 177 or SEQ ID NO: 218 - SEQ ID NO: 255.

[0037] In various aspects, the present disclosure provides an engineered promoter comprising a response element and an engineered core promoter as described herein.

[0038] In some aspects, the response element is capable of binding to a cognate ligand, a coactivator or a corepressor. In some aspects, the response element is an enhancer. In some aspects, the binding of a cognate ligand or a coactivator to a response element increases the transcription of a payload in a target cell type, a target cell state or a target tissue under the transcriptional control of an engineered promoter. In some aspects, the binding of a corepressor to a response element reduces the transcription of a payload in a non-target cell type, a non-target cell state or a non-target tissue under the transcriptional control of an engineered promoter. In some aspects, the response element grants bone marrow-specific transcription of a payload under the transcriptional control of an engineered promoter. In some aspects, the response element comprises a sequence having at least 90% sequence identity with SEQ ID NO: 145 or SEQ ID NO: 193. In some aspects, the response element comprises a sequence of SEQ ID NO: 145 or SEQ ID NO: 193. In some aspects, the response element grants liver-specific transcription of a payload under the transcriptional control of an engineered promoter. In some aspects, the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 146 or SEQ ID NO: 194. In some aspects, the response element comprises a sequence of SEQ ID NO: 146 or SEQ ID NO: 194. In some aspects, the response element confers neuron-specific transcription of the payload under the transcriptional control of an engineered promoter. In some aspects, the response element confers muscle-specific transcription of the payload under the transcriptional control of an engineered promoter. In some aspects, the response element confers kidney-specific transcription of the payload under the transcriptional control of an engineered promoter.

[0039] In various aspects, the present disclosure provides a recombinant polynucleotide comprising an engineered core promoter as described herein and a payload comprising a coding sequence under the transcriptional control of the engineered core promoter.

[0040] In various aspects, the present disclosure provides a recombinant polynucleotide comprising: a response element comprising a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99% or 100% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193 or SEQ ID NO: 194; and a payload comprising a coding sequence under the transcriptional control of the response element.

[0041] In some aspects, the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194. In some aspects, the response element comprises a sequence of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194.

[0042] In various aspects, the present disclosure provides a recombinant polynucleotide comprising a promoter and a payload, wherein the promoter comprises: a response element capable of binding to a cognate ligand, a coactivator or a corepressor; and an engineered core promoter as described in any one of claims 1 to 60 capable of recruiting a polymerase; wherein the payload comprises a coding sequence under the transcriptional control of the promoter.

[0043] In some aspects, the response element is an enhancer. In some aspects, the binding of a cognate ligand or coactivator to a response element increases the transcription of a payload in a target cell type, a target cell state, or a target tissue. In some aspects, the binding of a corepressor to a response element reduces the transcription of a payload in a non-target cell type, a non-target cell state, or a non-target tissue. In some aspects, the response element confers neuron-specific transcription of a payload. In some aspects, the response element confers bone marrow-specific transcription of a payload. In some aspects, the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145 or SEQ ID NO: 193. In some aspects, the response element comprises a sequence of SEQ ID NO: 145 or SEQ ID NO: 193. In some aspects, the response element confers liver-specific transcription of a payload. In some aspects, the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 146 or SEQ ID NO: 194. In some aspects, the response element comprises a sequence of SEQ ID NO: 146 or SEQ ID NO: 194. In some aspects, the response element confers muscle-specific transcription of the payload. In some aspects, the response element confers kidney-specific transcription of the payload.

[0044] In various aspects, the present disclosure provides a recombinant polynucleotide comprising a promoter and a payload, wherein the promoter comprises: a response element capable of binding to a cognate ligand, a coactivator, or a corepressor, wherein the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194; and an engineered core promoter capable of recruiting a polymerase; wherein the payload comprises a coding sequence under the transcriptional control of the promoter.

[0045] In some aspects, the payload encodes a protein. In some aspects, the protein is a neuronal protein, a kidney protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. In some aspects, the protein is associated with a genetic disorder, a neuronal disorder, a kidney disorder, an eye disorder, a muscle disorder, or a cancer. In some aspects, the protein is progranulin, MeCP2, polycystin-1, or polycystin-2.

[0046] In some aspects, the payload encodes therapeutic polynucleotide. In some aspects, the therapeutic polynucleotide is a guide RNA or an inhibitory tRNA. In some aspects, a therapeutic polynucleotide targets a gene. In some aspects, the gene is related to a genetic disorder, a neuron disorder, a kidney disorder, an eye disorder, a muscle disorder or a cancer. In some aspects, the gene is GRN, MECP2, PKD2 or PKD2.

[0047] In various aspects, the present disclosure provides an engineered viral vector comprising the engineered core promoter of any one of claims 1 to 60 in the viral vector.

[0048] In various aspects, the present disclosure provides an engineered viral vector comprising an engineered response element as described herein in the viral vector.

[0049] In various aspects, the present disclosure provides an engineered viral vector comprising an engineered promoter as described herein in the viral vector.

[0050] In various aspects, the present disclosure provides an engineered viral vector comprising a recombinant polynucleotide as described herein in the viral vector.

[0051] In some aspects, the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. In some aspects, the adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10. AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, A AV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.V1, AAV.PHP.B, AAV. PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AA V.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68 and their combinations.

[0052] In various aspects, the present disclosure provides a cell comprising an engineered core promoter as described herein.

[0053] In various aspects, the present disclosure provides a cell comprising an engineered response element as described herein.

[0054] In various aspects, the present disclosure provides a cell comprising an engineered promoter as described herein.

[0055] In various aspects, the present disclosure provides a cell comprising a recombinant polynucleotide as described herein.

[0056] In various aspects, the present disclosure provides a cell comprising an engineered viral vector as described herein.

[0057] In some aspects, the cell is a target cell. In some aspects, the cell is a diseased cell. In some aspects, the cell is a central nervous system cell, a neuron, a kidney cell, a retinal cell, a liver cell, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, an interstitial cell, a fat cell, or a fibroblast.

[0058] In various aspects, the present disclosure provides a pharmaceutical composition comprising an engineered core promoter as described herein and a pharmaceutically acceptable carrier.

[0059] In various aspects, the present disclosure provides a pharmaceutical composition comprising an engineered response element as described herein and a pharmaceutically acceptable carrier.

[0060] In various aspects, the present disclosure provides a pharmaceutical composition comprising an engineered promoter as described herein and a pharmaceutically acceptable carrier.

[0061] In various aspects, the present disclosure provides a pharmaceutical composition comprising a recombinant polynucleotide as described herein and a pharmaceutically acceptable carrier.

[0062] In various aspects, the present disclosure provides a pharmaceutical composition comprising an engineered viral vector as described herein and a pharmaceutically acceptable carrier.

[0063] In various aspects, the present disclosure provides a method for expressing a payload in a target cell of a subject, the method comprising: administering to the subject a recombinant polynucleotide as described herein, a viral vector as described herein, or a pharmaceutical composition as described herein; binding a cognate ligand, a coactivator, or a corepressor to a response element of the recombinant polynucleotide, wherein the cognate ligand or the coactivator is specific for target cells, or wherein the corepressor is specific for non-target cells; initiating transcription of the payload by recruiting a polymerase to a core promoter; and transcribing the payload, thereby expressing the payload in the target cell.

[0064] In some aspects, the method includes expressing the payload at a higher level in the target cell than in the non-target cell. In some aspects, the method includes initiating transcription at a higher rate in the target cell than in the non-target cell. In some aspects, the cognate ligand or coactivator is present at a higher level in the target cell than in the non-target cell. In some aspects, the cognate ligand is a transcription factor. In some aspects, the co-repressor is present at a higher level in the non-target cell than in the target cell. In some aspects, the target cell is a target cell state, and wherein the non-target cell is a non-target cell state. In some aspects, the target cell state is a diseased cell. In some aspects, the non-target cell state is a healthy cell. In some aspects, the target cell is a target cell type, and wherein the non-target cell is a non-target cell type. In some aspects, the target cell type is a central nervous system cell, a neuron, a kidney cell, a retinal cell, a hepatocyte, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, an interstitial cell, an adipocyte or a fibroblast. In some aspects, the non-target cell type is a central nervous system cell, a neuron, a kidney cell, a retinal cell, a hepatocyte, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, a mesenchymal cell, an adipocyte, a fibroblast, or a combination thereof.

[0065] In various aspects, the present disclosure provides a method of treating a condition in a subject in need thereof, the method comprising: administering to the subject a composition comprising a recombinant polynucleotide as described herein, a viral vector as described herein, or a pharmaceutical composition as described herein; and expressing a therapeutic sequence encoded by the payload of the recombinant polynucleotide in a target cell of the subject, thereby treating the condition.

[0066] In some aspects, target cell is the cell type relevant to the disease. In some aspects, target cell is the cell state relevant to the disease. In some aspects, disease is genetic disease, neuron disease, kidney disease, eye disease, muscle disease or cancer. In some aspects, disease is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuron ceroid lipofuscinosis, cancer, atherosclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, edge-based age-related TDP-43 encephalopathy or polycystic kidney disease. In some aspects, disease is any one of the diseases provided in Table 5. In some aspects, therapeutic sequence encoding therapeutic protein. In some aspects, therapeutic protein is neuron protein, kidney protein, retinal protein, muscle protein or apoptosis-inducing protein. In some aspects, therapeutic protein is related to genetic disease, neuron disease, kidney disease, eye disease, muscle disease or cancer. In some aspects, therapeutic protein is MECP2, progranulin, polycystin-1 or polycystin-2. In some aspects, the therapeutic protein is encoded by the gene provided in Table 5. In some aspects, the payload encodes a therapeutic polynucleotide. In some aspects, the therapeutic polynucleotide is a guide RNA or an inhibitory tRNA. In some aspects, the therapeutic polynucleotide targets the gene provided in Table 5.

[0067] In various aspects, the present disclosure provides a method of identifying a switchable core promoter, the method comprising: introducing a core promoter library comprising a first sub-library and a second sub-library into a cell population; wherein the first sub-library comprises a plurality of core promoters, wherein a core promoter in the plurality of core promoters is linked to a first response element, and a unique barcode sequence; wherein the second sub-library comprises a plurality of core promoters, wherein a core promoter in the plurality of promoters is linked to a second response element, and a unique barcode sequence; and identifying a switchable core promoter as a core promoter that promotes higher transcription of the unique barcode when paired with the first response element than when paired with the second response element.

[0068] In some aspects, the method further comprises activating the first response element. In some aspects, the second response element is not activated. In some aspects, the first response element is an activated response element and the second enhancer sequence is an inactive response element or an unactivated response element. In some aspects, the first response element is specific to a cell population. In some aspects, the cell population is a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. In some aspects, the first response element is specific to a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. In some aspects, the second response element is specific to a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. In some aspects, the multiple core promoters comprise an engineered core promoter, a synthetic core promoter, a wild-type core promoter, a variant core promoter, or a combination thereof.

[0069] In various aspects, the present disclosure provides a recombinant polynucleotide as described herein, a viral vector as described herein, or a pharmaceutical composition as described herein; for use in a method of treating a disorder, the method comprising administering a composition comprising the recombinant polynucleotide, viral vector, or pharmaceutical composition to a subject, and expressing a therapeutic sequence encoded by the payload of the recombinant polynucleotide in a target cell of the subject.

[0070] In some respects, the disease treated is a genetic disorder, a neuron disease, a kidney disease, an eye disease, a muscle disease or a cancer. In some respects, the disease is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuronal ceroid lipofuscinosis, cancer, atherosclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, edge-based age-related TDP-43 encephalopathy or polycystic kidney disease. In some respects, the disease is any one of the diseases provided in Table 5.

[0071] Incorporated by Reference

[0072] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the invention will be obtained by reference to the following detailed description which sets forth illustrative embodiments in which the principles of the invention are utilized, and in the accompanying drawings:

[0074] Figure 1Scatter plots comparing the transcriptional activity of enhancers in a myeloid cell carcinoma cell model ("K562 activity") and in a hepatocellular carcinoma cell model ("HepG2 activity") determined using a massively parallel reporter gene assay (MPRA) are shown. An enhancer with SEQ ID NO: 194 was identified as an endogenous enhancer with hepatocyte-specific activity. An enhancer with SEQ ID NO: 193 was identified as an endogenous enhancer with myeloid-specific activity. An enhancer with SEQ ID NO: 147 was identified as a negative control enhancer with low transcriptional activation in hepatocytes and myeloid cells.

[0075] Figure 2 Schematically illustrates the engineered polynucleotides for screening cell type specific transcriptional activation. Each polynucleotide construct contains from 5' to 3': cell type specific enhancer ("HepG2 Syn" (SEQ ID NO: 146), "K562 Syn" (SEQ ID NO: 145), "HepG2 End" (SEQ ID NO: 194) or "K562 End" (SEQ ID NO: 193)), negative control enhancer ("negative", SEQ ID NO: 147) or random sequence without enhancer activity ("random"); core promoter; barcode sequence; and reporter gene open reading frame ("reporter gene ORF").

[0076] Figure 3 Violin plots of the transcriptional activity of 3,649 core promoters screened in hepatocytes when paired with a synthetic hepatocyte-specific enhancer (SEQ ID NO: 146), a synthetic bone marrow-specific enhancer (SEQ ID NO: 145), an endogenous hepatocyte-specific enhancer (SEQ ID NO: 194), an endogenous bone marrow-specific enhancer (SEQ ID NO: 193), a random sequence with no enhancer activity ("Random"), or a negative control enhancer (SEQ ID NO: 147) are shown.

[0077] Figure 4 Shown is a graph comparing the transcriptional activity of the core promoter library in two replicates ("Rep 1" and "Rep 2") of the MPRA core promoter screen.

[0078] Figure 5AA histogram of the transcriptional activity (quantified by mCherry fluorescence ("mCherry")) of the ybTATA core promoter (SEQ ID NO: 9) measured using a dual reporter gene flow assay in HepG2 cells is shown. Transcriptional activity was assessed when ybTATA was inserted into a dual reporter gene construct alone ("ybTATA only"), or paired with a negative control enhancer (SEQ ID NO: 147), a synthetic bone marrow-specific enhancer (SEQ ID NO: 145), an endogenous bone marrow-specific enhancer (SEQ ID NO: 193), a synthetic hepatocyte-specific enhancer (SEQ ID NO: 146), or an endogenous hepatocyte-specific enhancer (SEQ ID NO: 194). Wild-type cells ("WT") without plasmids were used as negative controls.

[0079] Figure 5B Bar graph comparing the average fold change of the geometric mean of the fluorescence intensity (gMFI) core promoter screened in HepG2 cells using a dual reporter flow assay. Transcriptional activity of the core promoter was assessed when ybTATA was inserted into the dual reporter construct alone ("ybTATA only"), or paired with an endogenous hepatocyte-specific enhancer (SEQ ID NO: 194), a synthetic hepatocyte-specific enhancer (SEQ ID NO: 146), an endogenous myeloid-specific enhancer (SEQ ID NO: 193), a synthetic myeloid-specific enhancer (SEQ ID NO: 145), or a negative control enhancer (SEQ ID NO: 147).

[0080] Figure 5C Bar graph comparing the average fold change of the geometric mean of fluorescence intensity (gMFI) core promoters screened in K562 cells using a dual reporter flow assay. Transcriptional activity of the core promoter was assessed when ybTATA was inserted into the dual reporter construct alone ("ybTATA only"), or paired with an endogenous hepatocyte-specific enhancer (SEQ ID NO: 194), a synthetic hepatocyte-specific enhancer (SEQ ID NO: 146), an endogenous myeloid-specific enhancer (SEQ ID NO: 193), a synthetic myeloid-specific enhancer (SEQ ID NO: 145), or a negative control enhancer (SEQ ID NO: 147).

[0081] Figure 5DHistograms of transcriptional activity (quantified by mCherry fluorescence ("mCherry")) of the ybTATA core promoter (SEQ ID NO: 9) measured using a dual reporter gene flow assay in K562 cells are shown. Transcriptional activity was assessed when ybTATA was inserted into a dual reporter gene construct alone ("ybTATA only"), or paired with a negative control enhancer (SEQ ID NO: 147), a synthetic myeloid-specific enhancer (SEQ ID NO: 145), an endogenous myeloid-specific enhancer (SEQ ID NO: 193), a synthetic hepatocyte-specific enhancer (SEQ ID NO: 146), or an endogenous hepatocyte-specific enhancer (SEQ ID NO: 194). Wild-type cells ("WT") without plasmids were used as negative controls.

[0082] Figure 6 Shown is a scatter plot comparing the activation fold of the transcriptional activity of the core promoter library screened using the MPRA screening method in HepG2 cells when paired with different enhancers. Comparison of each core promoter paired with synthetic HepG2 specific enhancer SEQ ID NO: 146 relative to the activation fold of the core promoter paired with negative control enhancer SEQ ID NO: 147 ("HepSyn compared to negative") and each core promoter paired with synthetic K562 specific enhancer SEQ ID NO: 145 relative to the activation fold of the core promoter paired with no enhancer ("KSyn compared to no enhancer"). The dotted line represents the line of y=x, and the summarized points represent ybTATA (SEQ ID NO: 9) and minP (SEQ ID NO: 5) core promoters.

[0083] Figure 7 Shown is a scatter plot comparing the transcriptional activation of two core promoter libraries with different spacing sequences ("background 1" with the sequence of SEQ ID NO: 208 or "background 2" with the sequence of SEQ ID NO: 209) screened using MPRA in HepG2 cells. The dashed line represents the line where y=x.

[0084] Figure 8 Scatter plots comparing the transcriptional activity of a sublibrary of de novo designed core promoters screened using the MPRA screening method in HepG2 cells when paired with different synthetic enhancers are shown. The transcriptional activity of each core promoter paired with the synthetic HepG2-specific enhancer SEQ ID NO: 146 ("HepG2 synthetic") and the transcriptional activity when paired with the synthetic K562-specific enhancer SEQ ID NO: 145 ("K562 synthetic") are compared. The dotted line represents the line where y=x.

[0085] Fig. 9A The scatter plot of the transcriptional activity of the sublibrary of the core promoter with different length spacing from the TATA sequence to the initiator element (Inr) sequence designed from scratch is shown. The transcriptional activity in HepG2 cells when paired with the synthetic HepG2 enhancer (SEQ ID NO:146) was measured using MPRA screening. The transcriptional activity of each core promoter ("founding combination") with the standard TATA of 30 nucleotides to the Inr spacing was compared with the transcriptional activity of the corresponding core promoter ("with short spacing") with the TATA of 28 nucleotides shortened to the Inr spacing. Highly active core promoters (corresponding to SEQ ID NO:141 with standard spacing or SEQ ID NO:7 with short spacing) are circled in red. The dotted line represents the line of y=x.

[0086] Fig. 9B Violin plots of the transcriptional activity of SEQ ID NO:141 (core promoter with standard TATA to Inr spacing of 30 nucleotides) and SEQ ID NO:7 (corresponding core promoter with shorter TATA to Inr spacing of 28 nucleotides) are shown. Each bar in the figure contains the activity value of each of the approximately 40 redundant barcodes paired with the corresponding core promoter. The transcriptional activity in HepG2 cells when paired with a synthetic HepG2 enhancer (SEQ ID NO:146) was measured.

[0087] Fig. 10A The scatter plot of the transcriptional activity of the core promoter library with or without transcription pause site is shown. The transcriptional activity in HepG2 cells when paired with synthetic HepG2 enhancer (SEQ ID NO:146) was measured using MPRA screening. The transcriptional activity of each core promoter ("founding combination") without transcription pause site is compared with the transcriptional activity of the corresponding core promoter ("with pause site") with transcription pause site. The core promoter containing the pause site of SEQ ID NO:196 is represented by a black circle. The dotted line represents the line of y=x.

[0088] Fig. 10BThe transcription activation fold of the core promoter library paired with synthetic HepG2 enhancer (SEQ ID NO:146) with or without transcription pause site is shown compared to the scatter plot of negative control (SEQ ID NO:147). The activation fold of the core promoter with transcription pause site relative to the core promoter without transcription pause site was measured in HepG2 cells using MPRA screening relative to negative control (SEQ ID NO:147). The activation fold of each core promoter with transcription pause site ("with pause site") relative to the corresponding core promoter ("founding combination") without transcription pause site was measured in HepG2 cells using MPRA screening. The sequence with the best pause site is represented by a black circle. The dotted line represents the line of y=x.

[0089] Fig.11A Scatter plots comparing the transcriptional activity of a core promoter library screened using the MPRA screening method in HepG2 cells when paired with different synthetic enhancers are shown. The transcriptional activity of each core promoter paired with the synthetic HepG2-specific enhancer SEQ ID NO: 146 ("HepG2 synthetic") and the transcriptional activity when paired with the synthetic K562-specific enhancer SEQ ID NO: 145 ("K562 synthetic") are compared. The core promoter containing the YY1 motif is represented by a dark circle. The dotted line represents the line where y=x.

[0090] Fig. 11B A scatter plot comparing the transcriptional activity of a core promoter library screened using the MPRA screening method in HepG2 cells when paired with different enhancers that are not activated in HepG2 cells is shown. The transcriptional activity of each core promoter paired with the endogenous K562-specific enhancer SEQ ID NO: 193 ("K562 endogenous") and the transcriptional activity when paired with the negative control enhancer SEQ ID NO: 147 ("negative control") are compared. The core promoter containing the YY1 motif is represented by a dark circle. The dotted line represents the line where y=x.

[0091] Fig. 11C Scatter plots comparing the transcriptional activity of core promoter libraries with or without the YY1 motif are shown. The transcriptional activity in HepG2 cells when paired with a synthetic HepG2 enhancer (SEQ ID NO: 146) was measured using MPRA screening. The transcriptional activity of each core promoter without the YY1 motif ("founding combination") was compared with the transcriptional activity of the corresponding core promoter with a transcription pause site ("with YY1"). The dotted line represents the line of y=x.

[0092] Fig.11DScatter plots comparing the transcriptional activity of a core promoter library with or without a YY1 motif are shown. The transcriptional activity in HepG2 cells when paired with a synthetic K562 enhancer (SEQ ID NO: 145) was measured using MPRA screening. The transcriptional activity of each core promoter without a YY1 motif ("Founding Combination") was compared to the transcriptional activity of the corresponding core promoter with a transcription pause site ("With YY1"). The dotted line represents the line where y=x.

[0093] Fig. 12A A scatter plot comparing the transcriptional activity of point mutants of the ybTATA core promoter (SEQ ID NO:9) in HepG2 cells when paired with the synthetic HepG2-specific enhancer SEQ ID NO: 146 is shown. The activity of each possible point mutation at each position in the sequence is shown as a shaded circle, with the darkest shade representing T, the next darkest shade representing A, the lightest shade representing G, and the next lightest shade representing C. The activity of the ybTATA sequence (SEQ ID NO:9) provided at the bottom of the figure is represented by a dotted line colored based on the identity of the nucleotide present at that position in SEQ ID NO:9.

[0094] Fig. 12B A scatter plot comparing the transcriptional activity of point mutants of the minP core promoter (SEQ ID NO:5) in HepG2 cells when paired with the synthetic HepG2-specific enhancer SEQ ID NO: 146 is shown. The activity of each possible point mutation at each position in the sequence is shown as a shaded circle, with the darkest shade representing T, the next darkest shade representing A, the lightest shade representing G, and the next lightest shade representing C. The activity of the minP sequence (SEQ ID NO:5) provided at the bottom of the figure is represented by a dashed shaded line based on the identity of the nucleotide present at that position in SEQ ID NO:5.

[0095] Fig.13A A sequence logo plot illustrating the relative enrichment of each possible nucleotide and adjacent residues in the TATA sequence is shown.

[0096] Fig. 13B A sequence logo plot illustrating the relative enrichment of each possible nucleotide and adjacent residues in the Inr sequence is shown.

[0097] Fig. 13C Shown is a sequence logogram illustrating the relative enrichment of each possible nucleotide and adjacent residues in the YY1 transcription factor binding motif sequence.

[0098] Fig.13DA sequence logo plot illustrating the relative enrichment of each possible nucleotide and adjacent residues in the HNF4α transcription factor binding motif sequence is shown.

[0099] Fig.14A A heat map showing the activity of a double point mutant of minP (SEQ ID NO: 5) in HepG2 cells when paired with the synthetic HepG2-specific enhancer SEQ ID NO: 146 is shown. The lighter the shading, the higher the transcriptional activity. The core promoter with the sequence SEQ ID NO: 15 (containing T15G and A40C substitutions relative to SEQ ID NO: 5) is represented by a white box.

[0100] Fig. 14B A heat map showing the activity of a double point mutant of minP (SEQ ID NO: 5) in K562 cells when paired with the synthetic K562-specific enhancer SEQ ID NO: 145 is shown. Lighter shading indicates higher transcriptional activity. The core promoter with sequence SEQ ID NO: 15 (containing T15G and A40C substitutions relative to SEQ ID NO: 5) is represented by a white box.

[0101] Fig.15A Scatter plots comparing the transcriptional activity of a core promoter library screened using the MPRA screening method in HepG2 cells when paired with different synthetic enhancers are shown. The transcriptional activity of each core promoter paired with the synthetic K562-specific enhancer SEQ ID NO: 145 ("K562 synthetic") and the transcriptional activity when paired with the synthetic HepG2-specific enhancer SEQ ID NO: 146 ("HepG2 synthetic") are compared. SEQ ID NO: 5 (minP) and SEQ ID NO: 9 (ybTATA) are represented by circles. The dotted line represents the line where y = x.

[0102] Fig. 15B Shown is a scatter plot comparing the activation fold of the transcriptional activity of the core promoter library screened using the MPRA screening method in HepG2 cells when paired with different enhancers. Comparison of each core promoter paired with synthetic HepG2 specific enhancer SEQ ID NO: 146 relative to the activation fold of the core promoter paired with negative control enhancer SEQ ID NO: 147 ("HepG2 synthesis compared to negative") and each core promoter paired with synthetic K562 specific enhancer SEQ ID NO: 145 relative to the activation fold of the core promoter without enhancer pairing ("K562 synthesis compared to no") . SEQ ID NO: 5 (minP) and SEQ ID NO: 9 (ybTATA) are represented by circles. The dotted line represents the line of y = x.

[0103] Fig.16A Violin plots of the transcriptional activity of selected core promoters in HepG2 cells when paired with the synthetic HepG2-specific enhancer SEQ ID NO: 146 are shown. Each bar in the figure contains the activity value for each of the approximately 40 redundant barcodes paired with the corresponding core promoter. The activities of the core promoters of SEQ ID NO: 7, SEQ ID NO: 6, SEQ ID NO: 5 (minP) and SEQ ID NO: 9 (ybTATA) are compared.

[0104] Fig. 16B Violin plots of the transcriptional activity of selected core promoters in HepG2 cells when paired with the negative control enhancer SEQ ID NO: 147 are shown. Each bar in the figure contains the activity value for each of the approximately 40 redundant barcodes paired with the corresponding core promoter. The activities of the core promoters of SEQ ID NO: 7, SEQ ID NO: 6, SEQ ID NO: 5 (minP) and SEQ ID NO: 9 (ybTATA) are compared.

[0105] Fig.17 Shown is a scatter plot comparing the activation fold of the transcriptional activity of the core promoter library screened using the MPRA screening method in HepG2 cells when paired with different enhancers. The activation folds of each core promoter paired with synthetic HepG2 specific enhancer SEQ ID NO: 146 relative to the core promoter paired with negative control enhancer SEQ ID NO: 147 ("HepSyn compared to negative") and each core promoter paired with synthetic K562 specific enhancer SEQ ID NO: 145 relative to the activation folds of the core promoter paired with no enhancer ("KSyn compared to no enhancer"). The dotted line represents the line where y=x, and the black dots represent the core promoters of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15.

[0106] Fig.18A scatter plot comparing the transcriptional activity of a core promoter library screened using the MPRA screening method in HepG2 cells when paired with different enhancers is shown. The transcriptional activity of each core promoter when paired with a synthetic HepG2-specific enhancer SEQ ID NO: 146 ("HepG2 synthetic") or a synthetic K562-specific enhancer SEQ ID NO: 145 ("K562 synthetic") is compared. The dashed line represents the line of y=x, and the black dots represent the core promoters of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15.

[0107] Fig.19A A schematic diagram of the core promoters of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 7 is shown, indicating the regions corresponding to the TATA box and the initiator element (Inr). If present, the regions corresponding to the transcription pause site and the YY1 motif are also indicated.

[0108] Fig.19B A schematic diagram of the core promoters of SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12 is shown, indicating the regions corresponding to the TATA box and the initiator element (Inr). If present, the regions corresponding to the transcription pause site and the YY1 motif are also indicated.

[0109] Fig.19C Schematic diagrams of the core promoters of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 4 and SEQ ID NO: 110 are shown, indicating the regions corresponding to the TATA box and the initiator element (Inr). If present, the regions corresponding to the transcription pause site and the YY1 motif are also indicated. In SEQ ID NO: 15 and SEQ ID NO: 4, which represent variants of the minP core promoter, point mutations relative to the minP sequence (SEQ ID NO: 5) are indicated by boxes.

[0110] Fig. 20AA comparison of the promoter activity of the core promoter paired with the K562-specific enhancer in HepG2 cells as determined by MPRA screening ("Screening Activity") and by dual reporter gene qPCR assay ("qPCR Activity") is shown. The activities of the core promoters of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15 were compared.

[0111] Fig. 20B Shown is a comparison of the promoter activity of core promoters paired with HepG2-specific enhancers in HepG2 cells as determined by MPRA screening ("screening activity") and by dual reporter gene qPCR assay ("qPCR activity"). The activities of the core promoters of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15 were compared.

[0112] Fig. 20C A comparison of the promoter activity of the core promoter paired with a K562-specific enhancer in K562 cells as determined by MPRA screening ("Screening Activity") and by dual reporter qPCR assay ("qPCR Activity") is shown. The activities of the core promoters of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15 were compared.

[0113] Fig.21AShown is a comparison of the transcriptional activity of the minP variant of SEQ ID NO:4 ("minP activity") and the ybTATA promoter of SEQ ID NO:9 ("yb_TATA activity") in H4 cells when paired with an H4-specific enhancer ("H4-specific enhancer 1" or "H4-specific enhancer 2") or a liver-specific enhancer.

[0114] Fig.21B Shown is a comparison of the transcriptional activity of the minP variant of SEQ ID NO:4 ("minP activity") and the ybTATA promoter of SEQ ID NO:9 ("yb_TATA activity") in H4 hepatocytes when paired with a HepG2-specific enhancer ("H4-specific enhancer 1" or "H4-specific enhancer 2") or a liver-specific enhancer.

[0115] Fig. 21C Comparison of the cell type specificity of the minP variant of SEQ ID NO: 4 ("minP activity") and the ybTATA promoter of SEQ ID NO: 9 ("yb_TATA activity") is shown.

[0116] Fig.22A Violin plots of the transcriptional activity of the core promoter screened in bone marrow cells when paired with a synthetic hepatocyte-specific enhancer (SEQ ID NO: 146), a synthetic bone marrow-specific enhancer (SEQ ID NO: 145), an endogenous hepatocyte-specific enhancer (SEQ ID NO: 194), an endogenous bone marrow-specific enhancer (SEQ ID NO: 193), a random sequence with no enhancer activity ("Random"), or a negative control enhancer (SEQ ID NO: 147) are shown.

[0117] Fig. 22B Violin plots of the transcriptional activity of the core promoter screened in hepatocytes when paired with a synthetic hepatocyte-specific enhancer (SEQ ID NO: 146), a synthetic bone marrow-specific enhancer (SEQ ID NO: 145), an endogenous hepatocyte-specific enhancer (SEQ ID NO: 194), an endogenous bone marrow-specific enhancer (SEQ ID NO: 193), a random sequence with no enhancer activity ("Random"), or a negative control enhancer (SEQ ID NO: 147) are shown.

[0118] Fig.23Scatter plots comparing the transcriptional activity of a library of core promoter sequences screened using the MPRA screening method in HepG2 and K562 cells when paired with cell type specific enhancers are shown: the transcriptional activity of each core promoter in HepG2 cells when paired with the synthetic HepG2 specific enhancer SEQ ID NO: 146 ("HepG2 synthetic") and the transcriptional activity of each core promoter in K562 cells when paired with the synthetic K562 specific enhancer SEQ ID NO: 145 ("K562 synthetic") are compared. The dashed line represents the line of y=x, and the black dots represent the core promoters of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15.

[0119] Fig.24 21,849 enhancers screened using MPRA screening method when paired with different enhancers (including synthetic HepG2 specific enhancer SEQ ID NO: 146 and synthetic K562 specific enhancer SEQ ID NO: 145) are shown: hexagonal box plots (hexbin plots) of the transcriptional activity of the core promoter library in HepG2 and K562 cells. The transcriptional activity of each core promoter paired with different enhancers between HepG2 and K562 cell lines is compared. The dot cluster corresponding to the core promoter paired with synthetic HepG2 specific enhancer (SEQ ID NO: 146) is represented by a dotted ellipse, and the dot cluster corresponding to the core promoter paired with synthetic K562 specific enhancer (SEQ ID NO: 145) is represented by a solid ellipse. DETAILED DESCRIPTION

[0120] Although gene therapy has the potential to treat a variety of diseases associated with genetic mutations or altered gene expression, there may be risks associated with such therapies, in part due to inaccurate targeting of therapeutic payloads to cells or tissues. Restricting payload expression to target cell types, cell states, or tissue types, such as diseased cells or tissues, can reduce the side effects of gene therapy caused by inaccurate targeting. Polynucleotide sequences encoding cell type-specific or cell state-specific expression of payloads are described herein. The polynucleotide sequence may include a payload under the transcriptional control of a promoter, such as a transgenic or therapeutic polynucleotide. The promoter may promote cell type or cell state-specific transcription initiation, thereby resulting in cell type or cell state-specific expression of the payload. In some embodiments, the promoter may include a response element capable of binding to a cognate ligand, a coactivator, or a corepressor to regulate payload transcription, and a core promoter capable of recruiting transcriptional machinery to initiate transcription of the payload when combined with a response element bound to a cognate ligand, a coactivator, or a corepressor. As described herein, the core promoter can be a switchable core promoter that promotes high levels of transcription in the presence of an activated response element (such as an enhancer that binds to a cognate ligand or coactivator), and promotes low or no transcription in the presence of an inactivated response element (such as an enhancer that does not bind to a cognate ligand or coactivator or an enhancer that binds to a corepressor). The cognate ligand can be a transcription factor or a sequence-specific DNA binding factor.

[0121] The polynucleotides of the present disclosure (e.g., promoters, core promoters, response elements, payloads, or combinations thereof) may comprise recombinant polynucleotide sequences. The recombinant polynucleotide sequences may be engineered to encode tissue type-specific, cell type-specific, or cell state-specific transcription of the payload. In some embodiments, the transcription level of the payload can depend on the cell type (e.g., neurons, kidney cells, hepatocytes, podocytes, retinal cells, epithelial cells, muscle cells, erythrocytes, platelets, bone marrow cells, endothelial cells, epidermal cells, lymphocytes, glial cells, mesenchymal cells, adipocytes, or fibroblasts), cell state (e.g., diseased cells or healthy cells; activated or non-activated engineered cells, such as activated or non-activated CAR T cells), tissue type (e.g., diseased tissue, healthy tissue, neural tissue (e.g., central nervous system, peripheral nervous system), kidney tissue, eye tissue, muscle tissue, blood, skin, fat, bone, cancer tissue, thymus tissue, gastrointestinal tissue (e.g., stomach, intestine), spleen tissue, placental tissue, pancreatic tissue, lung tissue, liver tissue, heart tissue, or brain tissue (e.g., cerebrum, cerebellum, adrenal glands)), or a combination thereof. In some embodiments, a recombinant polynucleotide of the present disclosure may comprise a core promoter as described herein (e.g., an engineered core promoter), a response element as described herein (e.g., an engineered response element), a payload as described herein (e.g., a transgene or a therapeutic polynucleotide), or a combination thereof.

[0122] Promoters can be selected to enhance transcription in the cell type, cell state or tissue type of interest, reduce transcription in other cell types, cell states or tissue types, or a combination thereof. In some embodiments, promoters can be selected or engineered to regulate the level of payload transcription (e.g., adjusted to a therapeutic level, such as a level approximately the same as the wild-type form of the transgenic in the target cell type or cell state). In some embodiments, promoters can be selected or engineered to regulate the cell state dependency of payload transcription. Regulating the transcription level can include regulating transcription to a desired level. The transcription level of payload can control the expression level of a protein encoded by the payload. For example, a high level of transgenic transcription can result in a high level of expression of a protein encoded by a transgenic. The core promoter of the present disclosure (e.g., an engineered core promoter) can be engineered or selected for both strength (e.g., strong transcriptional activation) and specificity (e.g., when paired with a response element in a transcriptionally active state, compared to a response element in a transcriptionally inactive state, specific activation).

[0123] Also described herein is a method for delivering a polynucleotide sequence of the present disclosure to a subject. In some embodiments, the polynucleotide may be a part of a viral vector capable of delivering the polynucleotide to a subject's cell. The viral vector may include a viral reverse terminal repeat sequence, which includes a viral replication origin, so that viral replication of the polynucleotide sequence can be performed. The viral vector may further include a viral capsid, which encapsulates the polynucleotide and promotes the delivery of the polynucleotide to a cell. The method for delivering a polynucleotide composition to a subject may include administering a viral vector comprising the polynucleotide to the subject. When the polynucleotide is delivered to a subject, the payload encoded by the polynucleotide may be transcribed in a cell-type-dependent, cell-state-dependent or tissue-type-dependent manner in the subject's cell.

[0124] Further described herein is a method for treating a disease or condition by delivering a polynucleotide composition of the present disclosure to a subject and expressing a therapeutic protein or therapeutic polynucleotide encoded by a polynucleotide in a cell type-dependent, cell state-dependent or tissue type-dependent manner in a subject. The therapeutic protein can be a wild-type form of a protein that is mutated or underexpressed in a disease or condition. The therapeutic polynucleotide can be a polynucleotide (e.g., gRNA or tRNA) targeting a gene associated with a disease or condition. The polynucleotide composition can be delivered to a subject as part of a viral vector. The subject may suffer from a disease or condition, such as a disease or condition caused by a mutation or altered expression of a protein. In some embodiments, the polynucleotide composition may include a transgene encoding a wild-type copy of a protein with a mutation or altered expression. When the polynucleotide composition is delivered to a subject, the transgene can be selectively transcribed in the subject's target cell type, cell state or tissue type. In some embodiments, the protein encoded by the transgene is expressed in the subject at a level that depends on the transgene transcription level. Transcription of the transgene, expression of a protein encoded by the transgene, or both, can treat a disease or condition in a subject in a cell type-dependent, cell state-dependent, or tissue type-dependent manner.

[0125] Further described herein are methods for identifying a switchable core promoter disclosed herein. A switchable core promoter may be an engineered core promoter disclosed herein. A method for identifying a switchable core promoter may include: introducing a core promoter library comprising a first sub-library and a second sub-library into a cell population; wherein the first sub-library comprises a plurality of core promoters, wherein a core promoter in the plurality of core promoters is linked to a first response element, and a unique barcode sequence; wherein the second sub-library comprises the plurality of core promoters, wherein a core promoter in the plurality of promoters is linked to a second response element, and a unique barcode sequence; and identifying the switchable core promoter as a core promoter that promotes higher transcription of the unique barcode when paired with the first response element than when paired with the second response element. The method may further include activating the first response element. The second response element may not be activated. The first response element may be an activated response element and the second enhancer sequence may be an inactive response element or an unactivated response element. The first response element may be specific to a cell population. The cell population may be neurons, kidney cells, liver cells, muscle cells, or cancer cells. The first response element can be specific for neurons, kidney cells, liver cells, muscle cells, or cancer cells. The second response element can be specific for neurons, kidney cells, liver cells, muscle cells, or cancer cells. The plurality of core promoters can comprise an engineered core promoter, a synthetic core promoter, a wild-type core promoter, a variant core promoter, or a combination thereof.

[0126] As used herein, "switchable" can refer to the ability of a core promoter to combine with various response elements (e.g., cell type-specific enhancers, tissue type-specific enhancers, or cell state-specific enhancers) to promote high levels of transcription in the presence of a response element in a transcriptionally activated state (e.g., an activated response element) and to promote low or no transcription in the presence of a response element in a transcriptionally inactive or repressed state (e.g., an inactive response element or an inactive response element).

[0127] As used herein, "core promoter" or "core promoter sequence" may refer to a polynucleotide of a coding sequence, which recruits transcription machinery (e.g., RNA polymerase) to initiate transcription of downstream polynucleotides of a coding sequence (e.g., payload sequence), such as by binding to a universal transcription factor (GTF) that recruits RNA polymerase. As used herein, "engineered core promoter" or "engineered core promoter sequence" may refer to a non-naturally occurring core promoter or core promoter sequence. In some embodiments, "engineered core promoter" or "engineered core promoter sequence" is mutated, altered or engineered to a core promoter with a medium affinity for molecules (e.g., universal transcription factor (GTF)) that recruit transcription machinery (e.g., RNA polymerase). More specifically, the medium affinity is such that when there is no activated response element or there is an inactive response element, the concentration of these molecules (e.g., GTF) in the nucleus results in little or no transcription machinery being recruited to the engineered core promoter. However, when an activated response element is present, the activated response element causes an increase in the concentration of these molecules (e.g., GTF) at the core promoter, and the resulting increase in the local concentration of these molecules (e.g., GTF) at the core promoter overcomes the intermediate affinity, thereby allowing higher recruitment of the transcription machinery (e.g., RNA polymerase) to initiate higher transcription of a downstream polynucleotide of the coding sequence (e.g., payload sequence) compared to the recruitment and transcription levels of the transcription machinery in the absence of the activated response element.

[0128] As used herein, "response element" may refer to a polynucleotide encoding a sequence that binds to a cognate ligand (e.g., a transcription factor), a coactivator, a corepressor, or a combination thereof in a sequence-dependent manner. An "active response element" may refer to a polynucleotide encoding a sequence that can bind to a cognate ligand (e.g., a transcription factor), a coactivator, a corepressor, or a combination thereof in a sequence-dependent manner to promote the binding of the transcriptional machinery to a nearby core promoter (e.g., an engineered core promoter). An "inactive response element" may refer to a polynucleotide encoding a sequence that cannot bind to a cognate ligand (e.g., a transcription factor), a coactivator, or a combination thereof in a sequence-dependent manner to promote the binding of the transcriptional machinery to a nearby core promoter (e.g., an engineered core promoter). An "activated response element" may be a response element that binds to a cognate ligand (e.g., a transcription factor) or a coactivator, or reduces binding to a core repressor (compared to when not activated), or a combination thereof, and the response element promotes high binding of the transcriptional machinery to a nearby core promoter (e.g., an engineered core promoter). An "inactive response element" can be an active response element that does not bind to a cognate ligand (e.g., a transcription factor) or coactivator, or has increased binding to a corepressor (compared to when activated), or a combination thereof, that has low or no promotion of binding of the transcriptional machinery to a nearby core promoter (e.g., an engineered core promoter). For example, an activated response element can promote increased binding of the transcriptional machinery to a nearby core promoter compared to the binding of an inactive response element to the same core promoter.

[0129] As used herein, "enhancer" or "enhancer region" may refer to a response element that binds to a cognate ligand or coactivator, or has low binding to a corepressor, to increase binding of the transcriptional machinery to a nearby core promoter, and thereby increase transcription of a nearby polynucleotide encoding a sequence of a payload (such as a transgene or therapeutic polynucleotide), wherein such binding is cell type dependent, cell state dependent, or tissue type dependent. An "active enhancer" may refer to a polynucleotide encoding a sequence that is capable of binding to a cognate ligand (e.g., a transcription factor), a coactivator, or has reduced binding to a corepressor (compared to when not activated), or a combination thereof, in a sequence-dependent manner that promotes binding of the transcriptional machinery to a nearby core promoter, such as an engineered core promoter, in the cell type, cell state, or tissue type, respectively. An "inactive enhancer" may refer to a polynucleotide encoding a sequence that is unable to bind to a cognate ligand (e.g., a transcription factor), a coactivator, or a combination thereof in a sequence-dependent manner, cell type-dependently, cell state-dependently, or tissue type-dependently, to promote the binding of the transcriptional machinery to a nearby core promoter, such as an engineered core promoter, in the cell type, cell state, or tissue type, respectively. An "activated enhancer" may be an enhancer in its specific cell type, cell state, or tissue type, such that it binds to a cognate ligand (e.g., a transcription factor) or a coactivator, or has reduced binding to a corepressor (compared to when not activated), or a combination thereof, which promotes the binding of the transcriptional machinery to a nearby core promoter, such as an engineered core promoter, in the cell type, cell state, or tissue type. An "inactive enhancer" can be an active enhancer that is not in its specific cell type, cell state, or tissue type, such that it does not bind to its cognate ligand (e.g., transcription factor) or co-activator, or has increased binding to corepressors (compared to when activated), or a combination thereof, wherein the active enhancer has low or no facilitation of binding of the transcriptional machinery to a nearby core promoter (e.g., an engineered core promoter).

[0130] Promoter

[0131] Polynucleotides (e.g., RNA or DNA polynucleotides) may include promoters that regulate or enhance the transcription of a payload (such as a transgenic or therapeutic polynucleotide). The promoter may be an engineered promoter. In some embodiments, the promoter may include a response element (e.g., an enhancer region) and a core promoter that serves as a pre-initiation complex formation site, or a combination thereof. The core promoter may be an engineered core promoter. In some embodiments, the sequence of the response element may include a protein binding sequence that binds one or more cognate ligands, coactivators, or co-repressors in a sequence-dependent manner. For example, a response element may be combined with a transcription factor (TF), which enhances the transcription of polynucleotides near the sequence encoding a payload (such as a transgenic or therapeutic polynucleotide). In some embodiments, the core promoter may include an engineered core promoter to promote high-level transcription in the presence of an active response element (e.g., an active enhancer) when activated, and to promote low transcription or no transcription in the presence of an inactive response element (e.g., an inactive enhancer). In some embodiments, the core promoter may comprise an engineered core promoter to promote high levels of transcription in the presence of an activated response element (e.g., an activated enhancer), and promote low or no transcription in the presence of an inactivated response element (e.g., an inactivated enhancer). In some embodiments, the core promoter may comprise a synthetic promoter that is engineered to promote high levels of transcription in the presence of an activated response element (e.g., an activated enhancer), and promote low or no transcription in the presence of an inactive response element (e.g., an inactive enhancer).

[0132] The element (for example, response element or core promoter) in the promoter can be selected or engineered to change the transcription rate of the downstream polynucleotide encoding the payload. In some embodiments, the promoter can be selected for ubiquitous transcription. For example, the promoter can be selected to promote high-level transcription in any cell type, tissue type or cell state. In some embodiments, the promoter can be selected for cell type specific transcription. In some embodiments, the promoter can be selected for tissue type specific transcription. In some embodiments, the promoter can be selected for cell state specific transcription. For example, the promoter can be selected to promote high-level transcription in target cells or tissue types (for example, excitatory neurons or renal tissue) or target cell states (for example, diseased cell states) and low-level transcription or no transcription in non-target cell types or states (for example, non-neuronal cells, non-renal tissues or non-diseased cells). In some embodiments, the target tissue can be nerve tissue, kidney tissue, eye tissue, muscle tissue, blood, skin, fat, bone, cancer tissue, thymus tissue, gastrointestinal tissue (e.g., stomach, intestine), spleen tissue, placental tissue, pancreatic tissue, lung tissue, liver tissue, heart tissue or brain tissue (e.g., cerebrum, cerebellum, adrenal gland). In some embodiments, the target cell type can be neurons, kidney cells, hepatocytes, podocytes, retinal cells, epithelial cells, muscle cells, red blood cells, platelets, bone marrow cells, endothelial cells, epidermal cells, lymphocytes, glial cells, interstitial cells, adipocytes or fibroblasts. In some embodiments, the target cell state can be a diseased cell, an actively dividing cell, a resting cell or a mutant cell. In some embodiments, the target cell can be a specific state of a cell. For example, for CAR T cells, the target state of a cell can be activated, and the non-target state can be inactive (e.g., unused).

[0133] In some embodiments, a promoter can promote cell type-specific transcription if it promotes transcription of a polynucleotide encoding a payload (i.e., a payload sequence) in a target cell type at least about 0.1-fold, at least about 0.25-fold, at least about 0.5-fold, at least about 0.75-fold, at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold as compared to the level of transcription of the payload sequence in a non-target cell type. In some embodiments, a promoter can promote cell state-specific transcription if it promotes transcription of a payload sequence in a target cell state by at least about 0.1-fold, at least about 0.25-fold, at least about 0.5-fold, at least about 0.75-fold, at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold as compared to the level of transcription of the payload sequence in a non-target cell state.

[0134] In some embodiments, a promoter can promote transcription to a desired level if it promotes transcription of a polynucleotide encoding a payload (i.e., a payload sequence) in a target cell type at a level that is at least about -0.75 times, at least about -0.5 times, at least about -0.25 times, at least about -0.1 times, at least about 0 times, at least about 0.1 times, at least about 0.25 times, at least about 0.5 times, at least about 0.75 times, at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the level of transcription of the endogenous form of the payload sequence in the target cell type. In some embodiments, a promoter can promote transcription of a desired level of a payload sequence if the promoter promotes transcription of the payload sequence in a target cell state at least about -0.75-fold, at least about -0.5-fold, at least about -0.25-fold, at least about -0.1-fold, at least about 0-fold, at least about 0.1-fold, at least about 0.25-fold, at least about 0.5-fold, at least about 0.75-fold, at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the level of transcription of the endogenous form of the payload sequence in the target cell state.

[0135] Response element

[0136] The promoter of polynucleotide can include response element, such as enhancer region. Response element can be bound to sequence-specific protein, such as cognate ligand (for example, transcription factor), coactivator and / or corepressor, to regulate transcription. For example, response element can recruit cognate ligand (for example, transcription factor), coactivator and / or corepressor, which enhances, represses or changes the transcription of downstream polynucleotides of the sequence encoding payload (such as transgenic or therapeutic polynucleotide). In some embodiments, response element can play the role of enhancing transcription rate when cognate ligand or coactivator are combined and / or when corepressor is combined to reduce. For example, response element can include transcription factor binding site, which combines the transcription factor of the transcription of the nearby polynucleotides comprising the coding sequence. In some embodiments, the response element can be an activated response element or an inactivated response element, wherein the activated response element is a response element bound to a transcription factor, relative to a response element not bound to a transcription factor, which enhances transcription and can enhance the transcription initiation of a core promoter, while the inactivated response element is a response element not bound to a transcription factor, so it does not enhance transcription or does not enhance the transcription initiation of a core promoter. In some embodiments, the response element can play a role in changing the transcription rate when a cognate ligand, a coactivator and / or a corepressor are bound. An enhancer region can be a response element that plays a role in enhancing the transcription rate when a cognate ligand or a coactivator is bound or a corepressor is bound to be reduced, wherein the binding of such a cognate ligand or a coactivator or the binding of a corepressor is reduced and the subsequent transcription rate enhancement is cell type dependent, cell state dependent or tissue type dependent. For example, an enhancer region can include a transcription factor binding site, which binds to one or more transcription factors that enhance the transcription of a nearby polynucleotide comprising a coding sequence, wherein the presence of the one or more transcription factors is cell type dependent, cell state dependent or tissue type dependent. In some embodiments, the transcription enhancement of the enhancer region can be regulated by one or more transcription factors (such as cell type, cell state or tissue type specific transcription factors), and is therefore cell type dependent, cell state dependent or tissue type dependent. For example, the enhancer region can be inactivated when in an unbound state, and can be activated when combined with one or more transcription factors, wherein this combination depends on the presence of one or more transcription factors, and wherein the presence of the one or more transcription factors is cell type dependent, cell state dependent or tissue type dependent. Alternatively or additionally, the enhancer region can be inactivated when in a state combined with one or more corepressors, and can be activated when the combination of one or more corepressors is reduced or not combined, wherein this combination depends on cell type dependent, cell state dependent or tissue type dependent. Relative to an inactivated enhancer, an activated enhancer can enhance the recruitment of polymerase to the core promoter.Active enhancers can enhance the recruitment of polymerase to the core promoter relative to inactive enhancers.

[0137] The response element (e.g., enhancer region) can be paired with a core promoter (such as an engineered core promoter described herein) to promote transcription of a polynucleotide encoding a payload. The sequence of the response element can be positioned in the polynucleotide sequence so that it affects the recruitment of the polymerase to the core promoter. For example, the response element (e.g., enhancer region) can be positioned 5' of the core promoter, or the response element can be positioned 3' of the polynucleotide encoding the payload.

[0138] Response elements (e.g., enhancer regions) can include sequences of cognate ligands or coactivators expressed in target cell types (e.g., neurons, nephrocytes, hepatocytes, podocytes, retinal cells, epithelial cells, myocytes, erythrocytes, platelets, bone marrow cells, endothelial cells, epidermal cells, lymphocytes, glial cells, interstitial cells, adipocytes or fibroblasts) or cell states (e.g., diseased cells or healthy cells) at higher levels compared to non-target cell types or non-target cell states. Alternatively or additionally, response elements (e.g., enhancer regions) can include sequences of co-repressors expressed in target cell types or cell states at lower levels compared to non-target cell types or non-target cell states. For example, an enhancer region for a promoter expressing a payload in nephrocytes can include a transcription factor binding sequence that is combined with a kidney-specific transcription factor. When combined with a kidney-specific transcription factor in nephrocytes, a kidney-specific enhancer region can enhance transcription initiation, thereby increasing the transcription of payload in nephrocytes relative to non-nephrocytes. In another example, the enhancer region of the promoter for expressing a payload in a central nervous system (CNS) cell may include a transcription factor binding sequence combined with a CNS-specific transcription factor. When combined with a CNS-specific transcription factor in a CNS cell, a CNS-specific enhancer region may enhance transcription initiation, thereby increasing the transcription of a payload in a CNS cell relative to a non-CNS cell. As another example, an enhancer region for expressing a payload in a hepatocyte may include a transcription factor binding sequence combined with a liver-specific transcription factor. When combined with a liver-specific transcription factor in a hepatocyte, a liver-specific enhancer region may enhance transcription initiation, thereby increasing the transcription of a payload in a hepatocyte relative to a non-hepatocyte. Examples of response elements are provided in Table 1.

[0139] Table 1 - Exemplary response element sequences

[0140]

[0141] The response element may comprise a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194. The response element may comprise a sequence having at least 90% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194. The response element may comprise the sequence of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194. In some embodiments, the response element may be an engineered response element. For example, the engineered response element may comprise the sequence of SEQ ID NO: 145 or SEQ ID NO: 146. In some embodiments, the response element may be an enhancer region. In some embodiments, the response element may be a liver-specific enhancer region, wherein the enhancer region is activated in hepatocytes. For example, the liver-specific enhancer region can comprise the sequence of SEQ ID NO: 146 or SEQ ID NO: 197. In some embodiments, the liver-specific enhancer / promoter can comprise the sequence of SEQ ID NO: 163-SEQ ID NO: 177. In some embodiments, the response element can be a bone marrow-specific enhancer, wherein the enhancer region is activated in bone marrow cells. For example, the bone marrow-specific enhancer region can comprise the sequence of SEQ ID NO: 145 or SEQ ID NO: 193. In some embodiments, the bone marrow-specific enhancer region / promoter can comprise the sequence of SEQ ID NO: 148-SEQ ID NO: 162.

[0142] Response elements (e.g., response elements of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194) can be appended to a core promoter or a promoter for expressing a polynucleotide comprising a payload sequence (e.g., a transgene encoding a therapeutic protein or a sequence encoding a therapeutic polynucleotide) to promote cell type-specific, tissue type-specific, or cell state-specific transcription of the polynucleotide encoding the payload (i.e., the payload sequence). In some embodiments, response elements can be combined or used in combination with other response elements to modulate the transcription level of the payload sequence. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more response elements can be combined to modulate the transcription level of the payload sequence. The combined 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more response elements can all be the same response element, different response elements, or any combination thereof. For example, a promoter can comprise a combination of sequences for transcriptional enhancement and sequences for transcriptional repression (e.g., via increased binding to a corepressor) to modulate payload expression in a cell type or cell state of interest. A response element (e.g., a response element of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194) can be paired with a core promoter (e.g., a core promoter of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) to form an engineered promoter. An engineered promoter can promote cell-specific payload expression under the transcriptional control of the engineered promoter.

[0143] Core promoter

[0144] The promoter of the polynucleotide may comprise a core promoter that promotes recruitment of the transcriptional machinery and transcription initiation. The core promoter may be an engineered core promoter. In some embodiments, the core promoter may be engineered to have a switchable activity when paired with a cell-specific response element (e.g., a cell-specific enhancer). A switchable core promoter may exhibit low or no activity (low or no transcriptional activation) when paired with a cell-specific response element (e.g., a cell-specific enhancer) in a cell that is not its specific cell type (e.g., a cell type that is not the specific cell type of the cell-specific response element), and may exhibit high activity (high transcriptional activation) when paired with the same cell-specific response element (e.g., the same cell-specific enhancer) but in a cell that is its specific cell type (e.g., a cell type that is the specific cell type of the same cell-specific response element), and then the same switchable core promoter may exhibit low or no activity (low or no transcriptional activation) when paired with a different cell-specific response element (e.g., a different cell-specific enhancer) in a cell that is not its specific cell type (e.g., a cell type that is not the specific cell type of the different cell-specific response element), and may exhibit high activity (high transcriptional activation) when paired with the same different cell-specific response element (e.g., the same different cell-specific enhancer) but in a cell that is its specific cell type (e.g., a cell type that is the specific cell type of the same different cell-specific response element). For example, a switchable core promoter (e.g., any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) paired with a neuron-specific enhancer can exhibit high transcriptional activity in neurons, while exhibiting low transcriptional activity in non-neuronal cells (e.g., kidney cells, hepatocytes, bone marrow cells, etc.). In another example, a switchable core promoter (e.g., any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) paired with a hepatocyte-specific enhancer can exhibit high transcriptional activity in hepatocytes, while exhibiting low transcriptional activity in non-hepatocytes (e.g., kidney cells, neurons, bone marrow cells, etc.). In some embodiments, the core promoter can be engineered to have a switchable activity when paired with a tissue-specific response element (e.g., a tissue-specific enhancer).A switchable core promoter can exhibit low or no activity (low or no transcriptional activation) when paired with a tissue-specific response element (e.g., a tissue-specific enhancer) in cells that are not its specific tissue type (e.g., cells that are not the specific tissue type of the tissue-specific response element), and can exhibit high activity (high transcriptional activation) when paired with the same tissue-specific response element (e.g., the same tissue-specific enhancer) but in cells that are its specific tissue type (e.g., cells of the specific tissue type that are the same tissue-specific response element), and then the same switchable core promoter can exhibit low or no activity (low or no transcriptional activation) when paired with a different tissue-specific response element (e.g., a different tissue-specific enhancer) in cells that are not its specific tissue type (e.g., cells of the specific tissue type that are not the different tissue-specific response element), and can exhibit high activity (high transcriptional activation) when paired with the same different tissue-specific response element (e.g., the same different tissue-specific enhancer) but in cells that are its specific tissue type (e.g., cells of the specific tissue type that are the same different tissue-specific response element). For example, a switchable core promoter (e.g., any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) paired with a CNS-specific enhancer can exhibit high transcriptional activity in cells of the CNS, but low transcriptional activity in non-CNS cells (e.g., cells of the kidney, liver, bone marrow, etc.). In another example, a switchable core promoter (e.g., any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) paired with a liver-specific enhancer can exhibit high transcriptional activity in hepatocytes, but low transcriptional activity in non-hepatocytes (e.g., cells of the kidney, CNS, bone marrow, etc.).The switchable core promoter can exhibit low activity or no activity (low transcriptional activation or no transcriptional activation) when paired with a cell state-specific response element (e.g., a cell state-specific enhancer) in a cell that is not its specific cell state (e.g., a cell that is not in the specific cell state of the cell state-specific response element), and can exhibit high activity (high transcriptional activation) when paired with the same cell state-specific response element (e.g., the same cell state-specific enhancer) but in a cell that is in its specific cell state (e.g., a cell that is in the specific cell state of the same cell state-specific response element), and then the same switchable core promoter can be paired with a cell state-specific response element (e.g., the same cell state-specific enhancer) in a cell that is not its specific cell state (e.g., a cell that is not in the specific cell state of the cell state-specific response element). A promoter may exhibit low activity or no activity (low or no transcriptional activation) when paired with a different cell state-specific response element (e.g., a different cell state-specific enhancer) in a cell that is not in its different specific cell state (e.g., a cell that is not in the specific cell state of the different cell state-specific response element), and may exhibit high activity (high transcriptional activation) when paired with a different cell state-specific response element (e.g., the same different cell state-specific enhancer) but in its specific different cell state (e.g., a cell that is in the specific cell state of the same different cell state-specific response element). For example, a switchable core promoter (e.g., any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) paired with a disease-specific enhancer may exhibit high transcriptional activity in cells that exhibit the disease, and low transcriptional activity in cells that do not exhibit the disease. In another example, a switchable core promoter (e.g., any of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) paired with a Rett-specific enhancer can exhibit high transcriptional activity in neurons expressing mutant MeCP2 associated with Rett syndrome, while exhibiting low transcriptional activity in neurons expressing functional MeCP2 associated with a normal neuronal phenotype. A switchable core promoter can exhibit high activity when paired with an enhancer that is dependent on cell type, cell state, or tissue type and is in a specific cell type, cell state, or tissue type. A switchable core promoter can display a wide dynamic range of activity when paired with a cell type-specific, cell state-specific, or tissue type-specific enhancer in the cell type, cell state, or tissue type, respectively, compared to when not in the cell type, cell state, or tissue type.

[0145] In some embodiments, the core promoter may be positioned downstream of the response element (i.e., 3'). In some embodiments, the core promoter may be positioned upstream of the polynucleotide encoding the payload sequence (e.g., transgenic or a sequence encoding therapeutic polynucleotides) (i.e., 5'). The core promoter may recruit a polymerase or a protein bound to a polymerase to initiate transcription of a downstream sequence of the core promoter. In some embodiments, the core promoter may recruit RNA polymerase (e.g., RNA polymerase II) or TATA binding protein (TBP), which recruits RNA polymerase when combined with a response element bound to a cognate ligand, a coactivator, or a corepressor. For example, the core promoter may be bound to a general transcription factor (GTF) that recruits RNA polymerase II (Pol II) to initiate transcription. The ability of the core promoter to recruit transcriptional machinery (e.g., RNA polymerase) or the affinity of the core promoter to the transcriptional machinery may affect the transcriptional level. In some embodiments, the core promoter may be changed to regulate the transcriptional level by changing the recruitment of the transcriptional machinery and / or the affinity to the transcriptional machinery. In some embodiments, the engineered core promoter is a mutated or altered core promoter, which has a reduced ability to recruit transcriptional machinery (e.g., RNA polymerase) and / or reduced affinity for the transcriptional machinery compared to the corresponding unmutated or unaltered core promoter. In some embodiments, the engineered core promoter is a de novo synthesized core promoter, which has a reduced ability to recruit transcriptional machinery (e.g., RNA polymerase) and / or reduced affinity for the transcriptional machinery compared to other core promoters (such as SEQ ID NO:5 or SEQ ID NO:9 core promoters). In some embodiments, the ability of the engineered core promoter to initiate transcriptional activity depends on pairing with a response element, wherein the initiation of transcriptional activity occurs when the response element is bound to a cognate ligand and / or a coactivator, and does not initiate transcriptional activity or initiates transcriptional activity at a low basal level when the response element is not bound to a cognate ligand and / or a coactivator or optionally to a corepressor.

[0146] In some embodiments, the core promoter is a minimal synthetic core promoter, such as a minP core promoter (SEQ ID NO: 5) or a variant of the minP core promoter (e.g., SEQ ID NO: 4 or SEQ ID NO: 15). The core promoter can be selected or engineered for one or more desired transcriptional properties (such as transcriptional level, cell type specificity, cell state specificity, tissue specificity, or cell genotype specificity). In some embodiments, when paired with a cell type specific, cell state specific, or tissue type specific response element (e.g., cell type specific, cell state specific, or tissue type specific enhancer), the core promoter can be engineered to selectively promote transcription initiation. Engineering the core promoter can include screening variants of the core promoter for transcriptional level, cell type specificity, cell state specificity, tissue specificity, or cell genotype specificity.

[0147] Core promoters described herein may include engineered sequences that serve as promoter switches, and the promoter switches may be selectively activated in target cell types, target tissue types, or target cell states. When paired with cell type specificity, tissue type specificity, or cell state specificity response elements in target cell types, target tissue types, or target cell states, switchable core promoters may easily promote transcription initiation, while showing low background transcription initiation in non-target cell types, non-target tissue types, or non-target cell states, respectively. Switchable core promoters may be used in combination with a variety of response elements or other response elements to promote cell type specificity, tissue type specificity, or cell state specificity transcription in a variety of cell types, tissue types, or cell states.

[0148] When paired with a response element that is specific for a target cell type, target tissue type, or target cell state, the switchable core promoter can promote transcription initiation in the target cell type, tissue type, or target cell state at a rate that is at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold greater than the rate of transcription initiation in a non-target cell type, non-target tissue type, or non-target cell state. In some embodiments, when paired with a response element that is specific for a target cell type, target tissue type, or target cell state, a switchable core promoter can promote transcription initiation in a target cell type, tissue type, or target cell state at a rate that is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation in the target cell type, target tissue type, or target cell state when paired with a response element that is not specific for the target cell type, target tissue type, or target cell state.

[0149] In some embodiments, when paired with an active response element, a switchable core promoter can promote transcription initiation at a rate that is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation when the switchable core promoter is paired with an inactive response element. In some embodiments, when paired with a response element that is specific for a target cell type, target tissue type, or target cell state, a switchable core promoter can promote transcription initiation in a target cell type, target tissue type, or target cell state at a rate that is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation in the target cell type, tissue type, or target cell state when the switchable core promoter is paired with an inactive response element. When paired with a response element bound to a cognate ligand or coactivator (e.g., an enhancer bound to a cognate ligand or coactivator) (activated response element), the switchable core promoter can promote transcription initiation at a rate that is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation when paired with a response element that is not bound to a cognate ligand or coactivator (e.g., an enhancer that is not bound to a cognate ligand or coactivator) (inactivated response element). An activated response element can be an enhancer that is specific for a target cell type, target tissue type, or target cell state, respectively, and is in that target cell type, target tissue type, or target cell state. In some embodiments, an inactivated response element can be an enhancer that is not specific for the cell type, tissue type, or cell state in which it is located.

[0150] When paired with a response element that has reduced binding to a cognate ligand or coactivator and / or reduced binding to a corepressor (e.g., an enhancer that binds to a cognate ligand or coactivator), a switchable core promoter can promote transcription initiation at a rate that is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation when paired with a response element that has not bound to a cognate ligand or coactivator and / or increased binding to a corepressor (e.g., an enhancer that has not bound to a cognate ligand or coactivator).

[0151] When paired with a response element that is capable of binding to a cognate ligand or coactivator (e.g., an enhancer that binds to a cognate ligand or coactivator) (active response element) (the response element binds to a cognate ligand or coactivator (e.g., an enhancer that binds to a cognate ligand or coactivator) (activated response element)), the switchable core promoter can promote transcription initiation at a rate that is comparable to that of a response element that is unable to bind to a cognate ligand or coactivator (e.g., an enhancer that cannot bind to a cognate ligand or coactivator) (inactive response element) (and thus the response element At least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the transcription initiation rate when paired with a cognate ligand or coactivator (e.g., an enhancer that is not bound to a cognate ligand or coactivator) (an inactivated response element). An active response element may be specific for a target cell type, target tissue type, or target cell state, and may be an activated response element when in that target cell type, target tissue type, or target cell state. An inactivated response element may be specific for a target cell type, target tissue type, or target cell state, but it may not be in that specific target cell type, target tissue type, or target cell state, respectively. An inactive response element may be a response element that cannot be activated regardless of the cell type, tissue type, or cell state in which it is located, and thus, may always be an inactive response element in a cell.

[0152] When paired with an enhancer that is specific for a target cell type, target tissue type, or target cell state, a switchable core promoter can promote transcription initiation in the target cell type, tissue type, or target cell state at a rate that is at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold greater than the rate of transcription initiation in a non-target cell type, non-target tissue type, or non-target cell state. In some embodiments, when paired with an enhancer that is specific for a target cell type, target tissue type, or target cell state, a switchable core promoter can promote transcription initiation in a target cell type, tissue type, or target cell state at a rate that is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation in the target cell type, target tissue type, or target cell state when paired with an enhancer that is not specific for the target cell type, target tissue type, or target cell state.

[0153] In some embodiments, when paired with an active enhancer, the switchable core promoter can promote transcription initiation at a rate that is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation when the switchable core promoter is paired with an inactive enhancer. In some embodiments, when paired with an enhancer that is specific for a target cell type, target tissue type, or target cell state, a switchable core promoter can promote transcription initiation in a target cell type, tissue type, or target cell state at a rate that is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation in the target cell type, tissue type, or target cell state when the switchable core promoter is paired with an inactive enhancer.

[0154] When paired with an enhancer (activated enhancer) bound to a cognate ligand or coactivator, a switchable core promoter can promote transcription initiation at a rate of at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation when paired with an enhancer (unactivated enhancer) that is not bound to a cognate ligand or coactivator. An activated enhancer can be specific to a target cell type, target tissue type, or target cell state, and be in the target cell type, target tissue type, or target cell state, respectively. In some embodiments, an unactivated enhancer can be non-specific to the cell type, tissue type, or cell state in which it is located.

[0155] When paired with an enhancer that has reduced binding to a cognate ligand or coactivator and / or reduced binding to a corepressor, a switchable core promoter can promote transcription initiation at a rate that is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation when paired with an enhancer that is not bound to a cognate ligand or coactivator and / or has increased binding to a corepressor.

[0156] When paired with an enhancer that is capable of binding to a cognate ligand or coactivator (active enhancer), which is bound to a cognate ligand or coactivator (activated enhancer), a switchable core promoter can promote transcription initiation at a rate that is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation when paired with an enhancer that is unable to bind to a cognate ligand or coactivator (inactive enhancer), and thus the enhancer is not bound to a cognate ligand or coactivator (unactivated enhancer). An active enhancer may be specific to a target cell type, target tissue type, or target cell state, and may be an activated enhancer when in that target cell type, target tissue type, or target cell state. An inactive enhancer may be specific to a target cell type, target tissue type, or target cell state, but may not be in that specific target cell type, target tissue type, or target cell state, respectively. An inactive enhancer may not be activated regardless of the cell type, tissue type, or cell state in which it is located, and therefore, may always be an inactive enhancer in a cell.

[0157] The through engineering approaches core promoter of the present disclosure provides high dynamic range, also referred to as activation multiple, relative to endogenous core promoter.In some embodiments, dynamic range can describe the transcriptional activity of the core promoter when paired with activated response element relative to the transcriptional activity of the core promoter when paired with unactivated response element.Core promoter with high dynamic range can promote transcription initiation in cells, and its rate is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times or at least about 200 times of the transcription initiation rate in cells with endogenous core promoters paired with the same response element. In some embodiments, a core promoter with a high dynamic range can promote transcription initiation when paired with an activated response element at a rate that is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation when paired with an inactive response element.

[0158] The engineered core promoters of the present disclosure provide a high dynamic range, also referred to as fold activation, relative to the endogenous core promoter for improved cell type specificity, tissue type specificity, or cell state specificity. In some embodiments, the dynamic range can describe the transcriptional activity of the core promoter when paired with an activated response element (e.g., an enhancer that binds to a cognate ligand or co-activator) relative to the transcriptional activity of the core promoter when paired with an inactive response element. A core promoter with a high dynamic range can promote transcription initiation in a target cell type, target tissue type, or target cell state at a rate that is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation in a non-target cell type, non-target tissue type, or non-target cell state. In some embodiments, a core promoter with a high dynamic range can promote transcription initiation when paired with an activated response element at a rate that is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation when paired with an inactive response element. In some embodiments, when paired with an activated enhancer, a core promoter with a high dynamic range can promote transcription initiation at a rate that is at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the rate of transcription initiation when paired with an inactive enhancer.

[0159] The core promoter may comprise one or more sequence elements. In some embodiments, the core promoter may comprise a polynucleotide encoding a TATA box sequence, a spacer sequence, and an initiator element sequence from 5' to 3'. In some embodiments, the core promoter may comprise a TATA box, a spacer, and an initiator element from 5' to 3'. In some embodiments, the core promoter may further comprise a transcription pause site, a YY1 transcription factor binding motif, or a combination thereof. In some embodiments, the core promoter may comprise a transcription factor binding motif. For example, the spacer sequence may comprise a transcription factor binding sequence. In some embodiments, the sequence elements within the core promoter may be as follows Fig.19A , Fig.19B or Fig.19C Examples of sequence elements that may be included in the core promoter of the present disclosure are provided in Table 2.

[0160] Table 2 - Exemplary core promoter sequence elements

[0161]

[0162]

[0163] The core promoter may comprise one or more sequence elements, such as a TATA box (e.g., TATAAA), an initiator element, an RNA polymerase binding sequence, a B recognition element (BRE, e.g., G / C, G / C, G / A, CGCC), a CCAAT box or a CAT box (e.g., GGCCAATCT) or a Pribnow box (e.g., TATAAT). In some embodiments, the core promoter may comprise a TATA box (e.g., an engineered TATA box of SEQ ID NO: 199-SEQ ID NO: 201 or SEQ ID NO: 213-SEQ ID NO: 215), e.g., as shown in SEQ ID NO: 4 and SEQ ID NO: 15. In some embodiments, the core promoter can comprise a TATA box sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO: 199-SEQ ID NO:201 or SEQ ID NO:213-SEQ ID NO:215.

[0164] In some embodiments, the core promoter can include an initiator element (e.g., an engineered initiator element of SEQ ID NO: 202-SEQ ID NO: 204, SEQ ID NO: 216, or SEQ ID NO: 217). In some embodiments, the core promoter can include an initiator element having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO: 202-SEQ ID NO: 204, SEQ ID NO: 216, or SEQ ID NO: 217.

[0165] In some embodiments, the core promoter may include a long spacer (e.g., an engineered long spacer between a TATA box and an initiator element, e.g., as shown in SEQ ID NO: 3 and SEQ ID NO: 69-SEQ ID NO: 108). The long spacer may have a length of no less than 31 nucleotide residues from the TATA box to the initiator element, wherein the number of nucleotide residues from the TATA box to the initiator element is counted from the first T in the TATA box to the A in the CAG in the initiator element (or if the initiator element is mutated, the corresponding CAG in the parent sequence), including the end value. In some embodiments, the long spacer may have a length of 31 to 48 nucleotide residues from the TATA box to the initiator element. In some embodiments, the long spacer may have a length of 31 to 44 nucleotide residues from the TATA box to the initiator element. In some embodiments, the long spacer may have a length of 31 to 42 nucleotide residues from the TATA box to the initiator element. In some embodiments, the long spacer may have a length of 31 to 37 nucleotide residues or 31 to 35 nucleotide residues from the TATA box to the initiator element. For example, the long spacer may have a length of 32 nucleotide residues from the TATA box to the initiator element. In some embodiments, the core promoter may include an engineered short spacer (e.g., an engineered short spacer) between the TATA box and the initiator element, wherein the number of nucleotide residues from the TATA box to the initiator element is counted from the first T in the TATA box to the CAG in the initiator element (or if the initiator element is mutated, the corresponding CAG in the parent sequence) A, including end values, for example, as shown in SEQ ID NO: 7, SEQ ID NO: 10 and SEQ ID NO: 109-SEQ ID NO: 125. The short spacer may have a length of no more than 28 nucleotide residues from the TATA box to the initiator element. In some embodiments, the short spacer may have a length of 22 to 29 nucleotide residues or 24 to 29 nucleotide residues from the TATA box to the initiator element. For example, the short spacer may have a length of 28 nucleotide residues from the TATA box to the initiator element. In some embodiments, the core promoter may include an engineered spacer between the TATA box and the initiator element, for example, as shown in SEQ ID NO: 13 and SEQ ID NO: 126-SEQ ID NO: 144. The spacer may have a length of about 30 nucleotide residues from the TATA box to the initiator element. The spacing between the TATA and Inr elements of the selected core promoter is as shown in FIG. Fig.19A , Fig.19B and Fig.19C In some embodiments, the spacer sequence of the core promoter may include a response element, such as a transcription factor binding site (e.g., Fig.13D). For example, the core promoter may contain a spacer sequence that binds HNF4α, as shown in SEQ ID NO:22-SEQ ID NO:30. Alternatively or additionally, a transcription factor binding site may be included after the Inr element. In some embodiments, the core promoter may be engineered into a background sequence, such as a sequence of SEQ ID NO:208 or SEQ ID NO:209.

[0166] In some embodiments, the core promoter can comprise a transcriptional pause site (e.g., SEQ ID NO: 196-SEQ ID NO: 198, SEQ ID NO: 211, or SEQ ID NO: 212), for example, as set forth in SEQ ID NO: 1, SEQ ID NO: 11, SEQ ID NO: 14, and SEQ ID NO: 16-SEQ ID NO: 21. In some embodiments, the core promoter can comprise a transcriptional pause site having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO: 196-SEQ ID NO: 198, SEQ ID NO: 211, or SEQ ID NO: 212.

[0167] In some embodiments, the core promoter may comprise a YY1 motif (e.g., SEQ ID NO: 205-SEQ ID NO: 207), for example, as shown in SEQ ID NO: 2, SEQ ID NO: 12, and SEQ ID NO: 31-SEQ ID NO: 68. In some embodiments, the core promoter may comprise a YY1 motif having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO: 205-SEQ ID NO: 207. In some embodiments, the core promoter may comprise a YY1 motif (e.g., SEQ ID NO: 205-SEQ ID NO: 207), for example, as shown in SEQ ID NO: 2, SEQ ID NO: 12, and SEQ ID NO: 31-SEQ ID NO: 68. In some embodiments, the core promoter may comprise a YY1 motif having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO: 205-SEQ ID NO: 207, and is capable of binding to YY1. In some embodiments, the engineered core promoter sequence may comprise one or more mutations relative to the founding core promoter sequence. In some embodiments, the engineered core promoter sequence may comprise one or more point mutations (e.g., T15A, T15G, A40T, or A40C) relative to SEQ ID NO: 5 (TAGAGGGTATATAATGGAAGCTCGACTTCCAGCTTGGCAATCCGG), for example, as shown in SEQ ID NO: 4 and SEQ ID NO: 15. In some embodiments, the engineered core promoter sequence may comprise one or more point mutations relative to SEQ ID NO: 9 (TCTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAG). In some embodiments, the engineered core promoter sequence may comprise one or more point mutations relative to SEQ ID NO: 210 (AGGACCGGATCAACTAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAATTGGTACCGAGCTCG).

[0168] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 213, a spacer, an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 202, and a pause site having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 198, optionally, the spacer may be 29 to 33 nucleotides.

[0169] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:213, a 31-nucleotide spacer, an initiator element having the sequence of SEQ ID NO:202, and a pause site of SEQ ID NO:198.

[0170] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 200, a spacer, an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 203, and a YY1 motif having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 205, optionally, the spacer may be 29 to 33 nucleotides.

[0171] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:200, a 31-nucleotide spacer, an initiator element having the sequence of SEQ ID NO:203, and a YY1 motif of SEQ ID NO:205.

[0172] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 201, a spacer, and a starter element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 202, optionally, the spacer may be 31 to 35 nucleotides.

[0173] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:201, a spacer region of 33 nucleotides, and an initiator element having the sequence of SEQ ID NO:202.

[0174] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 214, a spacer, and a starter element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 216, optionally, the spacer may be 30 to 34 nucleotides.

[0175] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:214, a spacer region of 32 nucleotides, and an initiator element having the sequence of SEQ ID NO:216.

[0176] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 213, a spacer, and a starter element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 204, optionally, the spacer may be 27 to 31 nucleotides.

[0177] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:213, a 29-nucleotide spacer, and an initiator element having the sequence of SEQ ID NO:204.

[0178] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 201, a spacer, and a starter element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 202, optionally, the spacer may be 27 to 31 nucleotides.

[0179] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:201, a 29-nucleotide spacer, and an initiator element having the sequence of SEQ ID NO:202.

[0180] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 213, a spacer, an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 203, and a pause site having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 211, optionally, the spacer may be 29 to 33 nucleotides.

[0181] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:213, a spacer of 31 nucleotides, an initiator element having the sequence of SEQ ID NO:203, and a pause site having the sequence of SEQ ID NO:211.

[0182] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 200, a spacer, an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 203, and a YY1 motif having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 206, optionally, the spacer may be 29 to 33 nucleotides.

[0183] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:200, a spacer of 31 nucleotides, an initiator element having the sequence of SEQ ID NO:203, and a YY1 motif having the sequence of SEQ ID NO:206.

[0184] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 201, a spacer, and a starter element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 204, optionally, the spacer may be 27 to 31 nucleotides.

[0185] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:201, a 29-nucleotide spacer, and an initiator element having the sequence of SEQ ID NO:204.

[0186] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 200, a spacer, an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 203, and a pause site having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 212, optionally, the spacer may be 29 to 33 nucleotides.

[0187] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:200, a spacer of 31 nucleotides, an initiator element having the sequence of SEQ ID NO:203, and a pause site having the sequence of SEQ ID NO:212.

[0188] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 215, a spacer, and a starter element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 217, optionally, the spacer may be 30 to 34 nucleotides.

[0189] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:215, a spacer region of 32 nucleotides, and an initiator element having the sequence of SEQ ID NO:217.

[0190] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 200, a spacer, and a starter element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or about 100% sequence identity to SEQ ID NO: 202, optionally, the spacer may be 27 to 31 nucleotides.

[0191] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:200, a 29-nucleotide spacer, and an initiator element having the sequence of SEQ ID NO:202.

[0192] In some embodiments, the switchable core promoter sequence may comprise a sequence of SEQ ID NO: 1 - SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10 - SEQ ID NO: 144. In some embodiments, the switchable core promoter sequence may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 1 - SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10 - SEQ ID NO: 144. Examples of switchable core promoter sequences are provided in Table 3.

[0193] Table 3 - Exemplary switchable core promoter sequences

[0194]

[0195]

[0196]

[0197]

[0198]

[0199]

[0200]

[0201]

[0202]

[0203] In some embodiments, the core promoter of the present disclosure can play the role of a switchable core promoter in a variety of cell types or cell states. Cell type specificity or cell state specificity can be given by a response element (for example, an enhancer sequence bound to a cell type specific transcription factor) paired with a switchable core promoter. For example, SEQ ID NO:1–SEQ ID NO:4, SEQ ID NO:7 or SEQ ID NO:10–SEQ ID NO:144 can be paired with a CNS-specific enhancer to promote CNS-specific transcription initiation, and can be paired with a kidney-specific enhancer to promote kidney-specific transcription initiation. When paired with a response element in the presence of cell type specificity, tissue type specificity or cell state specificity cognate ligand or coactivator (for example, when paired with an activated enhancer), a core promoter described herein can have low background transcriptional activation (for example, in the absence of an enhancer, in the presence of an inactive enhancer, or in the presence of an inactivated enhancer in the presence of a low level of transcriptional activation) and high activity (for example, high level of transcriptional activation). For example, a core promoter can have low transcriptional activation in the presence of an inactive enhancer. When paired with cell type specific, tissue type specific or cell state specific response elements in the cell type, tissue type or cell state of interest (for example, in the presence of a transcription factor or at a high level of transcription factor, the transcription factor is bound to the transcription factor binding sequence of the enhancer region sequence), the core promoter may have a high transcription initiation. When paired with cell type specific, tissue type specific or cell state specific response elements not in the cell type, tissue type or cell state of interest (for example, in the absence of a transcription factor or at a low level of transcription factor, the transcription factor is bound to the transcription factor binding sequence of the enhancer region sequence), the core promoter may have a low transcriptional activation. In some embodiments, when paired with cell type specific, tissue type specific or cell state specific response elements in the cell type, tissue type or cell state of interest, the core promoter may be engineered to have low background transcriptional activation and high transcriptional activation. The sequence of the core promoter may be changed or engineered to regulate transcriptional levels, tissue specificity or cell type specificity or cell state specificity. In some embodiments, the core promoter may include an engineered form of an endogenous core sequence. For example, the switchable core promoter of SEQ ID NO: 1 - SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 10 - SEQ ID NO: 144 can be paired with the response element of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193 or SEQ ID NO: 194.

[0204] Enhancer / Promoter

[0205] A promoter (e.g., an enhancer / promoter) can comprise a switchable core promoter (e.g., SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) paired with a response element (e.g., an enhancer comprising a transcription factor binding site or a co-activator binding site). In some embodiments, the response element of the promoter can confer cell type specificity, tissue type specificity, or cell state specificity. For example, the enhancer of SEQ ID NO: 146 or SEQ ID NO: 194 can confer liver specificity. In some embodiments, the enhancer of SEQ ID NO: 145 or SEQ ID NO: 193 can confer bone marrow specificity. In some embodiments, the switchable core promoter of the promoter can easily promote transcription initiation in the presence of an activated response element (e.g., an activated enhancer), while exhibiting low background transcription initiation in the presence of an inactive response element (e.g., an inactive enhancer). In some embodiments, the switchable core promoter of the promoter can readily promote transcription initiation in the presence of an activated response element (e.g., an activated enhancer), while exhibiting low background transcription initiation in the presence of an inactivated response element (e.g., an inactivated enhancer). The switchable core promoter of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144 can be paired with a response element of SEQ ID NO: 145 or SEQ ID NO: 146.

[0206] In some embodiments, the liver-specific enhancer / promoter may comprise a sequence of SEQ ID NO: 163-SEQ ID NO: 166, SEQ ID NO: 169, or SEQ ID NO: 172-SEQ ID NO: 177. In some embodiments, the bone marrow-specific enhancer / promoter may comprise a sequence of SEQ ID NO: 148-SEQ ID NO: 151, SEQ ID NO: 154, or SEQ ID NO: 157-SEQ ID NO: 162. Examples of enhancer / promoter sequences are provided in Table 4.

[0207] Table 4 - Exemplary enhancer / promoter sequences

[0208]

[0209]

[0210]

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219]

[0220] Payload

[0221] The payload of the present disclosure may include a coding sequence under the transcriptional control of a promoter (e.g., a promoter including a response element and a core promoter). In some embodiments, the payload may encode a transgenic or therapeutic polynucleotide for delivery to a cell (e.g., a cell of a human or non-human subject). In some embodiments, the payload may include a coding sequence encoding a protein (e.g., a protein without a mutation associated with a disease or condition). In some embodiments, the payload may include a coding sequence encoding a therapeutic polynucleotide (e.g., a gRNA targeting a gene associated with a disease or condition). When the payload is delivered to the cell, the coding sequence may be transcribed in the cell, thereby expressing the encoded protein or therapeutic polynucleotide. In some embodiments, the expression of a protein or therapeutic polynucleotide encoded by the coding sequence may treat, prevent or alleviate the symptoms of a disease or illness. In some embodiments, the payload may include a transgenic encoding a wild-type copy of a protein that is mutated or dysregulated in a disease or condition.

[0222] In some embodiments, cell state-specific transcription of a payload sequence (e.g., a transgenic) is required. For example, a transgenic lacking a mutation can be specifically transcribed in a neuron having a gene comprising a mutation or having a phenotype associated with a mutation. In another example, a transgenic lacking a mutation can be specifically transcribed in a retinal tissue having a gene comprising a mutation or having a phenotype associated with a mutation. In another example, a transgenic lacking a genetic variation can be specifically transcribed in a cell having a genetic variation or having a phenotype associated with a genetic variation. In some embodiments, cell-specific transcription of a payload sequence (e.g., a transgenic) is required. For example, a transgenic can be specifically transcribed in a neuron of a subject. In another example, a transgenic can be specifically transcribed in a subject's hepatocytes. In some embodiments, tissue-specific transcription of a payload sequence (e.g., a transgenic) is required. For example, a transgenic can be specifically transcribed in a cell of a CNS. In another example, a transgenic can be specifically transcribed in a hepatocyte. Examples of genes that can be encoded in a payload sequence (e.g., a transgenic) are provided in Table 5. In some embodiments, a gene can be delivered to a subject's cell as a transgenic to treat a disease or condition of the subject. Alternatively or additionally, the payload can encode a therapeutic polynucleotide (e.g., gRNA or tRNA) targeting a gene associated with a disease or condition. For example, the payload can encode a gRNA for gene editing that targets a gene in a target cell type, tissue type, or cell state. Examples of genes that can be targeted by therapeutic polynucleotides encoded by the payload are provided in Table 5.

[0223] Table 5 - Exemplary transgenic payloads or gene targets and indications

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232] Examples of genes that can be encoded by a payload sequence (e.g., a transgene) and delivered to a subject's cells to treat, prevent, or alleviate symptoms of a disease or condition include MECP2, GRN, PRPH2, RHO, UBE3A, DYRK1A, MEF2C, NSD1, ATRX, RPS6KA3, TCF4, ZEB2, FOXG1, CDKL5, a partial fragment of chromosome 2, SLC6A1, DMD, SERPINA1, ABCA4, CFTR, HEXA, RAB7A, ATP7B, HFE, LIPA, SCNN1A, PKD1, PKD2, PKHD1 , ACE, ALB, VHL, EPO, FH, ACE, TNF, SPP1, IL6, MYH9, TSC2, ADIPOQ, IL2, CCL2, TGFB1, UMOD, BCOR, FLCN, FLCN, TP53, CRP, PTEN, IFT88, CL DN14, AGT, MET, MYH9, YWHAE, HAMP, EPO, MUC1, BAP1, APOE, CYBA, GSTT1, IFNG, IGF1, IL2, ABCB1, SDHB, TSC2, BRAF, CDKN1B, GLA, KRT7, PP ARG, RET, TRPC6, NDRG1, GANAB, NOX4, ADIPOR1, GREB1L, ANKS6, NUTM2B, CAT, CYBA, CYBB, EGFR, HMOX1, LRP2, SERPINE1, PAX2, ABCB1, PP ARA, PPARG, PTGS2, RELA, RET, TLR4, UMOD, BAP1, RETN, GREB1L, FRAS1, CRB2, APRT, AXL, CCND1, CBR1, CPT1A, CYP1A1, CYP2B6, EDN1, ERB B2, HMGCR, MME, NFKB1, NGF, MAPK1, MAPK3, PTGS2, PTGS2, HLTF, SOD1, SOD2, SREBF2, HNF1B, TERT, TNFSF10, NDRG1, MBTPS2, WNT4, BCOR, INF2, ALG9, BICC1, TMEM67, IRX2, FREM1, ANKS6, FREM2, CD46, COL4A3, COL4A4, COL4A5, TTC21B, NPHP4, CD2AP, CFI, LAMB2, LMX1B or MYH9.Alternatively or additionally, the payload sequence can encode a therapeutic polynucleotide that targets MECP2, GRN, PRPH2, RHO, UBE3A, DYRK1A, MEF2C, NSD1, ATRX, RPS6KA3, TCF4, ZEB2, FOXG1, CDKL5, a portion of chromosome 2, SLC6A1, DMD, SERPINA1, ABCA4, CFTR, HEXA, RAB7A, ATP7B, HFE, LIPA, SCNN1A, PKD1, PKD2, PKHD1, ACE, ALB, VHL, EPO, FH, ACE, TNF, SPP1, IL6, MYH9, TSC2, ADIPOQ, IL2, CCL2, TGFB1, UMOD, BCOR, FLCN, FLCN, TP53, CRP, PTEN, IFT88, CLDN14, AGT, MET, MYH9, YWHA E, HAMP, EPO, MUC1, BAP1, APOE, CYBA, GSTT1, IFNG, IGF1, IL2, ABCB1, SDHB, TSC2, BRAF, CDKN1B, GLA, KRT7, PPARG, RET, TRPC6, NDRG1, GAN AB, NOX4, ADIPOR1, GREB1L, ANKS6, NUTM2B, CAT, CYBA, CYBB, EGFR, HMOX1, LRP2, SERPINE1, PAX2, ABCB1, PPARA, PPARG, PTGS2, RELA, RET , TLR4, UMOD, BAP1, RETN, GREB1L, FRAS1, CRB2, APRT, AXL, CCND1, CBR1, CPT1A, CYP1A1, CYP2B6, EDN1, ERBB2, HMGCR, MME, NFKB1, NGF, MAP K1, MAPK3, PTGS2, PTGS2, HLTF, SOD1, SOD2, SREBF2, HNF1B, TERT, TNFSF10, NDRG1, MBTPS2, WNT4, BCOR, INF2, ALG9, BICC1, TMEM67, IRX2, FREM1, ANKS6, FREM2, CD46, COL4A3, COL4A4, COL4A5, TTC21B, NPHP4, CD2AP, CFI, LAMB2, LMX1B or MYH9 genes to treat, prevent or alleviate the symptoms of diseases or conditions associated with the genes.

[0233] In some embodiments, a gene that can be encoded by a payload sequence or targeted by a therapeutic polynucleotide encoded by a payload sequence and delivered to cells of a subject to treat, prevent, or alleviate symptoms of a disease or condition can be associated with a disease or condition. For example, the genes and associated conditions may include PKD1 or PDK2 associated with autosomal dominant polycystic kidney disease; MECP2 associated with Rett syndrome; CNGA3 or CNGB3 associated with color blindness; ABCD1 associated with adrenomyeloneuropathy; UBE3A associated with Angelman syndrome; Tafazzin associated with Barth syndrome; CLN1, CLN2, CLN3, CLN4, CLN5, or CLN6 associated with Batten disease; ASPA associated with Canavan disease; PKD1 or PDK2 associated with autosomal dominant polycystic kidney disease; CYP21A2 associated with congenital adrenal hyperplasia; PMM2 associated with congenital glycosylation disorder 1a; LAMP2 associated with Danon disease; GLA associated with Fabry disease; GBA associated with Gaucher disease; GLB1 associated with GM1 gangliosidosis; and Glycogen SD. 1a-associated G6PC; F9 associated with hemophilia; Serping1 associated with hereditary angioedema; GALC associated with Krabbe disease; GUCY2D, ND1, ND6, ND4, RPE65, or AIPL1 associated with Leber disease; MTM1 associated with myotubular myopathy; mucopolysaccharidoses I, II, IIA, IIC, IIID, IVA, VI, VII, and IXA associated with leukemia; OTC associated with ornithine carbamoyltransferase deficiency; GAA associated with Pompe disease; HEXB associated with Sandhoff disease; SMN1 associated with spinal muscular atrophy; HEXA associated with Tay-Sachs; USH2D-WHRN and USH3A-CLN1 associated with Usher syndrome; SOD1 associated with ALS; and β-thalassemia associated with leukemia. or sickle cell disease-associated HBB; BEST1 associated with vitelliform maculopathy; CHM associated with choroideremia; FXN associated with Friedreich's ataxia; SLC37A4 associated with GSD1b; IGF1 associated with osteoporosis; RPGR or RHO associated with retinitis pigmentosa; USH1C or CIB2 associated with Usher 1C, 1F; SERPINA1 associated with alpha-1 antitrypsin deficiency; MECP2 associated with Rett syndrome; AC6, Serca2, VEGF-B, or PP1 associated with heart failure; GAD associated with Parkinson's disease; MBTPS2 associated with brain abnormalities, retardation, ectodermal dysplasia, skeletal malformations, Hirschsprung's disease, ear and eye abnormalities, cleft palate-cryptorchidism, and renal dysplasia-dysgenesis;CD46, COL4A3, COL4A4, COL4A5, TTC21B, NPHP4, CD2AP, CFI, LAMB2, LMX1B, or MYH9 associated with chronic kidney disease / disorder with a monogenic origin; TERT or IRX2 associated with clear cell sarcoma of the kidney; ERBB2 associated with renal collecting duct carcinoma; FREM1 associated with congenital anorphan syndrome; TMEM67 associated with cystic kidney; SOD1 associated with kidney stones; EDN1 or MME associated with renal failure; CPT1A, CYP2B6, HMGCR, NFKB1, NGF, or SREBF2 associated with chronic renal failure; INF2 associated with renal failure or chronic kidney disease / disorder with a monogenic origin; PTGS2, HLTF, NDRG1, or BCOR associated with renal neoplasms; CYP1A1, MAPK1, MAPK3, PTGS2, SOD2, or TNFSF10 associated with renal malignancies; and Potter ALG9, associated with polycystic kidney disease type I with microbrachycephaly, hypertelorism, and phocomelia; BICC1 or ANKS6, associated with autosomal dominant polycystic kidney disease; WNT4, associated with female sex reversal with renal, adrenal, and pulmonary dysplasia; FREM2, associated with unilateral renal dysgenesis; or HNF1B, associated with unilateral polycystic kidney dysplasia.

[0234] In some embodiments, a gene (e.g., a transgene) or therapeutic polynucleotide encoded by a payload can be transcribed in a target cell type, cell state, or tissue type at a level that is at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold greater than the level of transcription of the payload in a non-target cell type, cell state, or tissue type.

[0235] In some embodiments, a gene (e.g., a transgene) or therapeutic polynucleotide encoded by a payload can be transcribed in a target cell type, cell state, or tissue type at a level that is at least about -0.75 times, at least about -0.5 times, at least about -0.25 times, at least about -0.1 times, at least about 0 times, at least about 0.1 times, at least about 0.25 times, at least about 0.5 times, at least about 0.75 times, at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the level of transcription of a wild-type form of the payload in the target cell type, cell state, or tissue type.

[0236] In some embodiments, any core promoter disclosed herein (e.g., any of SEQ ID NO: 1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO: 10-SEQ ID NO: 144) paired with a response element for a target cell type, cell state, or tissue type can be used to transcribe a gene (e.g., a transgene) or therapeutic polynucleotide encoded by a payload in a target cell type, cell state, or tissue type at a level that is at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold higher than the level of transcription of the payload in a non-target cell type, cell state, or tissue type.

[0237] In some embodiments, any of the core promoters disclosed herein (e.g., SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 11) paired with a response element for a target cell type, cell state, or tissue type can be used. NO: 144), a gene (e.g., a transgene) or a therapeutic polynucleotide encoded by the payload is transcribed in the target cell type, cell state, or tissue type at a level that is at least about -0.75 times, at least about -0.5 times, at least about -0.25 times, at least about -0.1 times, at least about 0 times, at least about 0.1 times, at least about 0.25 times, at least about 0.5 times, at least about 0.75 times, at least about 1 times, at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, or at least about 200 times the level of transcription of the wild-type form of the payload in the target cell type, cell state, or tissue type.

[0238] Recombinant vector

[0239] In some embodiments, the polynucleotides of the present disclosure are introduced into a subject via a recombinant vector. In some embodiments, the engineered core promoter of the present disclosure (e.g., any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 10-SEQ ID NO: 144) is introduced into a subject via a recombinant vector. In some embodiments, the engineered core promoter of the present disclosure paired with a response element is introduced into a subject via a recombinant vector. In some embodiments, the engineered core promoter of the present disclosure paired with a response element upstream of a polynucleotide encoding a payload is introduced into a subject via a recombinant vector. In some embodiments, the vector is a plasmid, a viral vector, an expression cassette or a transformed cell.

[0240] In some embodiments, the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. Adeno-associated viral (AAV) vectors include vectors derived from any AAV serotype, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10. AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.V1, AAV.PHP.B, AA V.PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5 , AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17 and AAVhu68.

[0241] In some embodiments, the polynucleotide is introduced into the subject by a non-viral vector system. In some embodiments, the engineered core promoter of the present disclosure (e.g., any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) is introduced into the subject by a non-viral vector system. In some embodiments, the engineered core promoter of the present disclosure paired with the response element is introduced into the subject by a non-viral vector system. In some embodiments, the engineered core promoter of the present disclosure paired with the response element upstream of the polynucleotide encoding the payload is introduced into the subject by a non-viral vector system. In some embodiments, cationic lipids, polymers, hydrodynamic injection and / or ultrasound can be used to deliver polynucleotides to the subject in the absence of viruses. In some embodiments, cationic lipids, polymers, hydrodynamic injection and / or ultrasound can be used to deliver the engineered core promoter of the present disclosure (e.g., any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) to the subject in the absence of viruses. In some embodiments, cationic lipids, polymers, hydrodynamic injection, and / or ultrasound can be used to deliver the engineered core promoter of the present disclosure paired with a response element to a subject in the absence of viruses. In some embodiments, cationic lipids, polymers, hydrodynamic injection, and / or ultrasound can be used to deliver the engineered core promoter of the present disclosure paired with a response element upstream of a polynucleotide encoding a payload to a subject in the absence of viruses.

[0242] In some instances, the vector can be a eukaryotic vector, a prokaryotic vector (e.g., a bacterial vector), a viral vector, or any combination thereof. In some instances, the vector can be a viral vector. In some embodiments, the viral vector can be a retroviral vector, an adenoviral vector, an adeno-associated virus (AAV) vector, an alphavirus vector, a lentiviral vector (e.g., human or pig), a herpesvirus vector, an Epstein-Barr virus vector, an SV40 virus vector, a poxvirus vector, or a combination thereof. In some embodiments, the viral vector can be a recombinant vector, a hybrid vector, a chimeric vector, a self-complementary vector, a single-stranded vector, or any combination thereof.

[0243] In some embodiments, the viral vector can be an adeno-associated virus (AAV). In some embodiments, the AAV can be any AAV known in the art. In some embodiments, the viral vector can be a specific serotype. In some embodiments, the viral vector can be an AAV1 serotype, an AAV2 serotype, an AAV3 serotype, an AAV4 serotype, an AAV5 serotype, an AAV6 serotype, an AAV7 serotype, an AAV8 serotype, an AAV9 serotype, an AAV10 serotype, an AAV11 serotype, an AAV12 serotype, an AAV13 serotype, an AAV14 serotype, an AAV15 serotype, an AAV16 serotype, an AAV-DJ serotype, an AAV-DJ / 8 serotype, an AAV-DJ / 9 serotype, an AAV1 / 2 serotype , AAV.rh8 serotype, AAV.rh10 serotype, AAV.rh20 serotype, AAV.rh39 serotype, AAV.Rh43 serotype, AAV.Rh74 serotype, AAV.v66 serotype, AAV.Oligo001 serotype, AAV.SCH9 serotype, AAV.r3.45 serotype, AAV.RHM4-1 serotype, AAV.hu37 serotype, AAV.Anc80 serotype, AAV.Anc80L65 serotype, AAV.7m8 serotype, AAV.P hP.eB serotype, AAV.PhP.V1 serotype, AAV.PHP.B serotype, AAV.PhB.C1 serotype, AAV.PhB.C2 serotype, AAV.PhB.C3 serotype, AAV.PhB.C6 serotype, AAV.cy5 serotype, AAV2.5 serotype, AAV2tYF serotype, AAV3B serotype, AAV.LK03 serotype, AAV.HSC1 serotype, AAV.HSC2 serotype, AAV.HSC3 serotype, AAV.HSC4 serotype, AA V.HSC5 serotype, AAV.HSC6 serotype, AAV.HSC7 serotype, AAV.HSC8 serotype, AAV.HSC9 serotype, AAV.HSC10 serotype, AAV.HSC11 serotype, AAV.HSC12 serotype, AAV.HSC13 serotype, AAV.HSC14 serotype, AAV.HSC15 serotype, AAV.HSC16 serotype, AAV.HSC17 serotype or AAVhu68 serotype, a derivative of any of these serotypes, or any combination thereof.

[0244] In some embodiments, the AAV vector can be a recombinant vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, a single-stranded AAV, or any combination thereof.

[0245] In some embodiments, the AAV vector can be a recombinant AAV (rAAV) vector. Methods for producing recombinant AAV vectors can be known in the art, and in some cases, generally involve introducing into a production cell line: (1) DNA necessary for AAV replication and AAV capsid synthesis; (b) one or more auxiliary constructs comprising viral functions missing from the AAV vector; (c) a helper virus; and (d) a plasmid construct containing the AAV vector genome, such as ITRs, promoters, and payload sequences, etc. In some instances, the viral vectors described herein can be engineered by synthesis or other suitable means, with reference to published sequences, such as those available in the literature. For example, the genome and protein sequences of various serotypes of AAV, as well as the sequences of native terminal repeats (TRs), Rep proteins, and capsid subunits can be known in the art and can be found in the literature or in public databases such as GenBank or the Protein Data Bank (PDB).

[0246] In some instances, the method for producing the delivery vector herein includes packaging the polynucleotides of the present disclosure in an AAV vector. In some instances, the method for producing the delivery vector herein includes packaging the engineered core promoter of the present disclosure (e.g., any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 10-SEQ ID NO: 144) in an AAV vector. In some instances, the method for producing the delivery vector herein includes packaging the engineered core promoter of the present disclosure paired with a response element in an AAV vector. In some instances, the method for producing the delivery vector herein includes packaging the engineered core promoter of the present disclosure paired with a response element upstream of a polynucleotide encoding a payload in an AAV vector. In some examples, the method of producing the delivery vector described herein comprises: (a) introducing into a cell: (i) a polynucleotide disclosed herein (e.g., an engineered core promoter disclosed herein; an engineered core promoter disclosed herein paired with a response element; or an engineered core promoter disclosed herein paired with a response element upstream of a polynucleotide encoding a payload); and (ii) a viral genome comprising a replication (Rep) gene and a capsid (Cap) gene encoding a wild-type AAV capsid protein or a modified form thereof; (b) expressing a wild-type AAV capsid protein or a modified form thereof in a cell; (c) assembling AAV particles; and (d) packaging the polynucleotide disclosed herein in AAV particles, thereby generating an AAV delivery vector. In some examples, any polynucleotide disclosed herein can be packaged in an AAV vector. In some examples, the recombinant vector comprises one or more inverted terminal repeats, and the inverted terminal repeats comprise a 5' inverted terminal repeat, a 3' inverted terminal repeat, and a mutated inverted terminal repeat. In some examples, the mutated terminal repeat sequence lacks a terminal resolution site, thereby enabling the formation of self-complementary AAV.

[0247] In some instances, hybrid AAV vectors can be produced by transcapsidation, such as packaging an inverted terminal repeat (ITR) from a first serotype into a capsid of a second serotype, wherein the first and second serotypes may be different. In some instances, the Rep gene and ITR from a first AAV serotype (e.g., AAV2) can be used in a capsid from a second AAV serotype (e.g., AAV5 or AAV9), wherein the first and second AAV serotypes may be different. As a non-limiting example, a hybrid AAV serotype comprising an AAV2 ITR and an AAV9 capsid protein can be represented as AAV2 / 9. In some instances, hybrid AAV delivery vectors include AAV2 / 1, AAV2 / 2, AAV2 / 4, AAV2 / 5, AAV2 / 8, or AAV2 / 9 vectors.

[0248] In some instances, the AAV vector can be a chimeric AAV vector. In some instances, the chimeric AAV vector comprises exogenous amino acids or amino acid substitutions, or capsid proteins from two or more serotypes. In some instances, the chimeric AAV vector can be genetically engineered to increase transduction efficiency, selectivity, or a combination thereof.

[0249] In some examples, the AAV vector comprises a self-complementary AAV genome. The self-complementary AAV genome is generally known in the art and contains two DNA strands that can anneal together to form double-stranded DNA.

[0250] In some instances, the delivery vector can be a retroviral vector. In some instances, the retroviral vector can be a Moloney Murine leukemia virus vector, a spleen necrosis virus vector, or a vector derived from Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, or a mammary tumor virus, or a combination thereof. In some instances, a retroviral vector can be transfected so that most of the sequences encoding the structural genes of the virus (e.g., gag, pol, and env) can be deleted and replaced by a gene of interest (e.g., payload).

[0251] In some instances, the delivery vehicle can be a non-viral vector. Examples of non-viral vectors can include plasmids, lipid nanoparticles, lipid complexes, polymer vesicles, polyplexes, dendrimers, nanoparticles, and cell penetrating peptides. Non-viral vectors can include polynucleotides encoding promoters (e.g., including cell type-specific or cell state-specific response elements and switchable core promoters) and payload sequences, such as plasmids. Non-viral vectors can include engineered core promoters of the present disclosure (e.g., SEQ ID NO: 1–SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10–SEQ ID NO: 144). Non-viral vectors can include engineered core promoters of the present disclosure paired with response elements. Non-viral vectors can include engineered core promoters of the present disclosure paired with response elements upstream of polynucleotides encoding payload. In some instances, the delivery vehicle can be a plasmid. In some instances, the plasmid can be a small circular plasmid. In some embodiments, the vector can include naked DNA (e.g., naked DNA plasmid). In some embodiments, the non-viral vector includes DNA. In some embodiments, the non-viral vector comprises RNA. In some instances, the non-viral vector comprises circular double-stranded DNA. In some instances, the non-viral vector may comprise linear polynucleotides. In some instances, the non-viral vector comprises polynucleotides encoding one or more genes of interest and one or more regulatory elements. In some instances, the non-viral vector comprises a bacterial skeleton containing replication origins and antibiotic resistance genes or other selective markers for plasmid amplification in bacteria. In some instances, the non-viral vector contains one or more genes providing selective markers to induce target cells to retain the polynucleotides (e.g., plasmids) of the non-viral vector. In some instances, the non-viral vector may be formulated for delivery by injection with a syringe carrying a needle. In some instances, the non-viral vector may be formulated for delivery via electroporation. In some instances, the polynucleotides of the non-viral vector may be engineered by synthesis or other suitable means known in the art. For example, in some cases, genetic elements may be assembled to produce DNA ends by restriction digestion of the desired genetic sequence from a donor plasmid or an organism, and then the ends may be easily connected to another genetic sequence.

[0252] Methods for regulating payload translation

[0253] In some embodiments, the present disclosure provides a method of inserting a polynucleotide comprising a promoter as described herein (e.g., comprising an engineered core promoter paired with a response element, such as any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) and a payload into a recombinant polynucleotide cassette. The recombinant polynucleotide cassette can further regulate the expression of the payload (e.g., by regulating translation). In some embodiments, the recombinant polynucleotide cassette regulates the stability of the payload RNA. In some embodiments, the recombinant polynucleotide cassette comprises a 5'UTR effector region. In some embodiments, the recombinant polynucleotide cassette comprises a 3'UTR effector region. In some embodiments, the payload is codon optimized in the recombinant polynucleotide cassette. In some embodiments, an intron is inserted into the 5'UTR effector region or the payload sequence. In some embodiments, the intron is a natural intron or a synthetic intron.

[0254] In some embodiments, the recombinant polynucleotide cassette comprises a promoter as described herein (e.g., comprising an engineered core promoter paired with a response element, such as any of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144), a payload sequence, and one or more of: a 5'UTR effector region; a 3'UTR effector region; a codon-optimized payload sequence; and an intron in the payload sequence. In some embodiments, translation of the payload from a recombinant polynucleotide cassette comprising one or more of a 5'UTR effector region, a 3'UTR effector region, a codon-optimized payload sequence, and an intron in the payload sequence is increased compared to a recombinant polynucleotide cassette lacking one or more of a 5'UTR effector region, a 3'UTR effector region, a codon-optimized payload sequence, and an intron in the payload sequence. In some embodiments, translation of the payload from a recombinant polynucleotide cassette comprising one or more of a 5'UTR effector region, a 3'UTR effector region, a codon-optimized payload sequence, and an intron in the payload sequence is reduced compared to a recombinant polynucleotide cassette lacking one or more of the 5'UTR effector region, the 3'UTR effector region, the codon-optimized payload sequence, and an intron in the payload sequence.

[0255] In some embodiments, the 5'UTR effector region comprises one or more of the following: a structural element; a sequence motif; a nucleotide base content comprising at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99% or 100% G / C content; and a 5'UTR intron. In some embodiments, the structural element is a site (e.g., also referred to as a "cap-hiding site") that is in a 5' cap conformation, making the 5' cap inaccessible or less accessible to the translation machinery, thereby resulting in reduced or no translation compared to a 5'UTR lacking this structural element. In some embodiments, the structural element is an internal ribosome entry site (IRES). In some embodiments, the structural element is an RNA pseudoknot. In some embodiments, the structural element is an iron response element (IRE). In some embodiments, the structural element is a non-coding translation regulatory structure. In some embodiments, the structural element is a hairpin. In some embodiments, the structural element is a sequence (e.g., a cap-hiding site sequence, an IRES, an RNA pseudoknot, an IRE, or a non-coding translation regulatory structure) that changes conformation when the sequence element contacts a target RNA having at least partial complementarity therewith, such that the translation rate of the payload downstream of the structural element is increased or decreased compared to the translation of the payload before the sequence element contacts the target RNA. In some embodiments, the 5'UTR effector region further comprises a sequence element, wherein the nucleic acid sequence of the sequence element is at least partially complementary to the sequence of the target RNA, and wherein the conformation of the structural element changes when the sequence element contacts the target RNA having at least partial complementarity therewith. In some embodiments, the 5'UTR intron is a natural intron, a synthetic intron, or a fragment thereof.

[0256] In some embodiments, the 3'UTR comprises one or more of the following: a site for recruiting a polyA tail mechanism; a miRNA binding site; or a sequence motif. In some embodiments, the poly(A) tail recruitment mechanism comprises an enzyme. In some embodiments, the length of the poly(A) tail regulates protein expression from the polynucleotide. In some embodiments, the 3'UTR effector region comprises one, two, three, four, five, six, seven, eight, nine, ten or more miRNA binding sites. In some embodiments, the miRNA binding sites are directed to the same miRNA. In some embodiments, the miRNA binding sites are directed to different miRNAs. In some embodiments, the sequence motif is an AC-rich motif. In some embodiments, the sequence motif is an AU-rich element (ARE).

[0257] In some embodiments, the codon-optimized therapeutic polynucleotide sequence is at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99% or 100% codon optimized. In some embodiments, the introns in the therapeutic polynucleotide sequence are natural introns, synthetic introns or fragments thereof. In some embodiments, the recombinant polynucleotide cassette is encoded by a DNA vector.

[0258] In some embodiments, the combination of a promoter sequence and a payload sequence as described herein in a recombinant polynucleotide cassette results in the payload being expressed at a therapeutic level for reducing or alleviating at least one symptom of a disease or disorder. The therapeutic level can be -0.25 times, -0.5 times, 0 times, 0.25 times, 0.5 times, 0.75 times, 1 times, 1.5 times, 2 times, or 4 times the biological level of the payload.

[0259] Methods of treatment and pharmaceutical compositions

[0260] The present disclosure also encompasses methods for treating diseases or conditions characterized by abnormal gene expression. The method includes administering a therapeutically effective amount of a payload sequence as a part of a recombinant polynucleotide box. The recombinant polynucleotide box of the present disclosure can be formulated in a pharmaceutical composition. In addition to one or more recombinant polynucleotide boxes (e.g., comprising an engineered core promoter, such as any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 10-SEQ ID NO: 144), these compositions may also include pharmaceutically acceptable excipients, carriers, buffers, stabilizers or other materials well known to those skilled in the art. Such materials should be nontoxic and should not interfere with the efficacy of the active ingredient. The exact nature of the carrier or other materials may depend on the route of administration, such as oral, intravenous, skin or subcutaneous, nasal, intramuscular, intraperitoneal routes.

[0261] Pharmaceutical compositions for oral administration can be in tablet, capsule, powder or liquid form. Tablets can contain solid carriers, such as gelatin or adjuvants. Liquid pharmaceutical compositions usually contain liquid carriers such as water, petroleum, animal or vegetable oils, mineral oils or synthetic oils. Physiological saline solutions, glucose or other sugar solutions or glycols, such as ethylene glycol, propylene glycol or polyethylene glycol can be contained.

[0262] For intravenous, cutaneous or subcutaneous injection, or injection at the site of pain, the active ingredient will be in the form of an acceptable aqueous solution outside the intestine, the aqueous solution is pyrogen-free and has suitable pH, isotonicity and stability. Those skilled in the art can prepare suitable solutions using, for example, isotonic excipients (such as sodium chloride injection, Ringer's injection, sodium lactate Ringer's injection). Preservatives, stabilizers, buffers, antioxidants and / or other additives may be included as needed.

[0263] In some embodiments, polynucleotides of the present disclosure or recombinant polynucleotide cassettes of the present disclosure (e.g., polynucleotides or recombinant polynucleotide cassettes comprising an engineered core promoter, such as any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) can be administered to cells via lipid nanoparticles. In some embodiments, lipid nanoparticles can be administered at appropriate concentrations according to standard methods appropriate for the target cells.

[0264] In some embodiments, the polynucleotides of the present disclosure or the recombinant polynucleotide cassettes of the present disclosure (e.g., polynucleotides or recombinant polynucleotide cassettes comprising an engineered core promoter, such as any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) can be administered to cells via a viral vector. In some embodiments, the viral vector can be administered at an appropriate multiplicity of infection according to standard transduction methods suitable for the target cells. The titer of the administered viral vector or capsid can vary depending on the target cell type or cell state and number, and can be determined by a person skilled in the art. In some embodiments, administration of at least about 10 2 In some embodiments, at least about 10 3 10 4 10 5 10 6 10 7 10 8 10 9 10 10 10 11 10 12 or 10 13 Infected unit.

[0265] In some embodiments, a polynucleotide or recombinant polynucleotide cassette (e.g., a polynucleotide or recombinant polynucleotide cassette comprising an engineered core promoter, such as any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) is introduced into cells of any type or state, including but not limited to neural cells, eye cells (including retinal cells, retinal pigment epithelial cells, and corneal cells), lung cells, epithelial cells, skeletal muscle cells, dendritic cells, hepatocytes, pancreatic cells, bone cells, hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, and cardiac cells.

[0266] In some embodiments, polynucleotides of the present disclosure or recombinant polynucleotide cassettes of the present disclosure (e.g., polynucleotides or recombinant polynucleotide cassettes comprising an engineered core promoter, such as any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) can be introduced into cells in vitro via a viral vector to administer the modified cells to a subject. In some embodiments, a viral vector encoding a polynucleotide of the present disclosure or a recombinant polynucleotide cassette of the present disclosure is introduced into cells that have been removed from a subject. In some embodiments, the modified cells are placed back into the subject after the introduction of the viral vector.

[0267] In some embodiments, the dose of modified cells administered to a subject depends on the age and species of the subject, the disease or condition to be treated, and the cell type or state and mode of administration. In some embodiments, at least about 10 2 –10 8 In some embodiments, cells transduced with a viral vector are administered to a subject in an effective amount.

[0268] In some embodiments, the dose of the viral vector administered to a subject will vary depending on the age of the subject, the disease or condition to be treated, and the mode of administration. In some embodiments, the dose used to achieve a therapeutic effect is at least about 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 1015 , 10 16 or more transducing units of virus.

[0269] Administration of a pharmaceutically useful polynucleotide of the present disclosure or a polynucleotide cassette of the present disclosure is preferably a "therapeutically effective amount" or a "prophylactically effective amount" (as the case may be, although prophylaxis may be considered therapy), which is sufficient to show benefit to an individual. The actual amount administered, as well as the rate and time course of administration, will depend on the nature and severity of the protein aggregation disease being treated. The prescription of treatment (e.g., decisions regarding dosage, etc.) is within the responsibility of general practitioners and other physicians, and generally takes into account the condition to be treated, the condition of the individual patient, the site of delivery, the method of administration, and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. (ed.), 1980.

[0270] The compositions may be administered alone or in combination with other therapies, either simultaneously or sequentially, depending on the condition to be treated.

[0271] Diseases and conditions

[0272] In some embodiments, a recombinant polynucleotide of the present disclosure or a recombinant polynucleotide cassette of the present disclosure (e.g., a polynucleotide, a recombinant polynucleotide, or a recombinant polynucleotide cassette comprising an engineered core promoter, such as any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) is used to treat a disease or condition associated with abnormal expression of a gene or protein.In some embodiments, the disease or disorder is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuronal ceroid lipofuscinosis, amyotrophic lateral sclerosis (ALS), limbic predominant age-related TDP-43 encephalopathy (LATE), autosomal recessive polycystic kidney disease, renal failure, chronic renal malignancy, polycystic kidney disease type 2, renal failure, renal tumor, medullary cystic kidney disease type 2, clear cell sarcoma of the kidney, kidney stones, renal collecting duct carcinoma, polycystic kidney, Medullary cystic kidney disease1, congenital anorectal syndrome, cystic kidney, chronic kidney disease / disorders with a monogenic origin, unilateral renal dysgenesis, glomerulocystic nephropathy with hyperuricemia and isonephrosis, cystic kidney disease with ventriculomegaly, unilateral polycystic kidney dysplasia, brain anomalies, retardation, ectodermal dysplasia, skeletal malformations, Hirschsprung disease, ear and eye anomalies, cleft palate-cryptorchidism and renal dysplasia-dysgenesis, female sex reversal with renal, adrenal and lung dysplasia, Potter Polycystic kidney disease type I with microbrachycephaly, organ teleostosis, phocomelia, retinitis pigmentosa 7, macular degeneration, retinitis pigmentosa 4, Angelman syndrome, DYRK1A haploinsufficiency, MEF2C haploinsufficiency syndrome, Sotos syndrome, reverse Sotos syndrome, alpha thalassemia X-linked intellectual disability syndrome, Xp22.12 duplication, Coffin-Lowry syndrome, Pitt-Hopkins syndrome, Mowat-Wilson syndrome, FOXG1 syndrome, CDKL5 deficiency, West syndrome, 2q23.1 microdeletion syndrome, Doose syndrome, SLC6A1 epileptic encephalopathy, Duchenne muscular dystrophy, Becker muscular dystrophy, alpha-1 antitrypsin deficiency (AATD), macular degeneration / Stargardt disease, cystic fibrosis, Tay-Sachs, Charcot-Marie-Tooth disease, Wilson disease, hereditary hemochromatosis, Wolman disease, cholesterol ester storage disease, pseudohypoaldosteronism type 1, autosomal dominant polycystic kidney disease, color blindness, adrenomedullary neuropathy, Barth syndrome, Batten disease, Canavan disease, congenital adrenal hyperplasia, congenital glycosylation disorder 1a, Danon disease, Fabry disease, Gaucher disease, GM1 gangliosidosis, glycogenotype SD In some embodiments, the disease or disorder is Rett syndrome. In some embodiments, the disease or disorder is frontotemporal dementia. In some embodiments, the disease or disorder is a retinal disorder. In some embodiments, the retinal disorder comprises retinitis pigmentosa 7, retinitis pigmentosa 4, or macular degeneration.

[0273] In some embodiments, a polynucleotide of the present disclosure or a recombinant polynucleotide cassette of the present disclosure (e.g., a polynucleotide or recombinant polynucleotide cassette comprising an engineered core promoter, such as any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) can be administered to a subject in need thereof using a viral vector (e.g., an AAV vector) or a non-viral vector. For example, a subject in need thereof may have frontotemporal dementia or be at risk of frontotemporal dementia. Upon administration of the polynucleotide or the recombinant polynucleotide cassette, a payload sequence (e.g., encoding progranulin, polycystin-1, or polycystin-2) may be expressed in a cell type, cell state, or tissue type of interest (e.g., a diseased cell, a neuronal cell, a CNS tissue, a kidney cell, or a kidney tissue). The payload sequence may be selectively transcribed in a cell type, cell state, or tissue type of interest, thereby preventing unwanted side effects in a subject due to expression in a non-target tissue. The subject may be a human or non-human animal. Thus, the polynucleotides disclosed herein or the recombinant polynucleotide cassettes disclosed herein can serve as therapeutically effective vector replacement therapies that sense endogenous nucleic acids to regulate expression of payload sequences and prevent or minimize adverse side effects from overexpression of payload sequences.

[0274] As used herein, the term "therapeutic polynucleotide" may refer to a polynucleotide that is introduced into a cell and can be expressed in the cell, or to a polynucleotide that has therapeutic activity itself, such as gRNA or tRNA.

[0275] As used herein, the term "polynucleotide" refers to a single-stranded or double-stranded polymer of deoxyribonucleotide (DNA) or ribonucleotide (RNA) bases read from the 5' end to the 3' end. The term "RNA" includes dsRNA (double-stranded RNA), snRNA (small nuclear RNA), lncRNA (long non-coding RNA), mRNA (messenger RNA), miRNA (micro RNA) RNAi (inhibitory RNA), siRNA (small interfering RNA), shRNA (short hairpin RNA), tRNA (transfer RNA), rRNA (ribosomal RNA), snoRNA (small nucleolar RNA) and cRNA (complementary RNA). The term DNA includes cDNA, genomic DNA and DNA-RNA hybrids.

[0276] The term "amelioration" refers to any therapeutically beneficial result of treating a disease state (eg, Rett syndrome), including prevention, lessening of its severity or progression, remission, or cure.

[0277] As used herein, the term "mammal" includes humans and non-humans, and includes, but is not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0278] In the context of two or more nucleic acids or polypeptide sequences, the term "percent identity" refers to two or more sequences or subsequences having a specified percentage of identical nucleotides or amino acid residues when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms (e.g., BLASTP and BLASTN or other algorithms available to the skilled person) or by visual inspection. Depending on the application, the "percent identity" can be present in a region of the compared sequences, e.g., in a functional domain, or alternatively, in the full length of the two compared sequences.

[0279] For sequence comparison, usually one sequence acts as a reference sequence (also referred to as a subject sequence) compared to a test sequence (also referred to as a query sequence). Percent sequence identity is defined as the percent identity of a test sequence to a reference sequence. For example, when stating "sequence A having 50% sequence identity to sequence B", sequence A is a test sequence and sequence B is a reference sequence. When using a sequence comparison algorithm, the test and reference sequences are entered into a computer program, subsequence coordinates are specified if necessary, and sequence algorithm program parameters are specified. The sequence comparison algorithm then aligns the sequences according to the specified program parameters to achieve maximum alignment, introducing gaps in the alignment if necessary. The percent sequence identity of the test sequence relative to the reference sequence can then be determined based on the alignment of the test sequence to the reference sequence. The equation for the percent sequence identity of the aligned sequences is as follows:

[0280] [(number of identical positions) / (total number of positions in the test sequence)]×100%

[0281] For the purpose of this paper, the BLAST algorithm for sequence alignment is used to perform identity percentage and sequence similarity calculations, and the algorithm is described in Altschul et al., J.Mol.Biol.215:403-410 (1990). Software for performing BLAST analysis can be publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ). The BLAST algorithm uses a test sequence (also referred to as a query sequence) and a reference sequence (also referred to as a subject sequence) to search, or in some cases, a database of multiple reference sequences is used to search. The BLAST algorithm compares the short region of the test sequence (referred to as "word") with the reference sequence to score and find the high-scoring comparison region between the test sequence and the reference sequence, thereby performing sequence alignment. The score of each comparison is determined by the BLAST algorithm, and various factors, such as the number of comparison positions, and whether the introduction of a gap between the test sequence and the reference sequence will improve the comparison are considered. The comparison score of nucleic acid can be scored by setting a match / mismatch score. For protein sequences, a substitution matrix can be used to score the comparison score to evaluate the significance of the sequence alignment, for example, the similarity between the amino acids based on their substitution evolution probability. For the purposes of this article, the substitution matrix used is the BLOSUM62 matrix. For the purposes of this article, when using the BLASTN and BLASTP algorithms, the public default values ​​on April 6, 2023 are used. The BLASTN and BLASTP algorithms then output a "percent identity" output value and a "query coverage" output value. As used herein, the overall sequence identity percentage can then be calculated from the BLASTN or BLASTP output value as follows:

[0282] Sequence identity percentage = ("percent identity" output value) x ("query coverage" output value)

[0283] The following non-limiting example illustrates the calculation of the percent identity between two nucleic acid sequences. The percent identity is calculated as follows: [(number of identical nucleotide positions) / (total number of nucleotides in the test sequence)]×100%. The percent identity is calculated to compare test sequence 1: AAAAAGGGGG (length=10 nucleotides) with reference sequence 2: AAAAAAAAAA (length=10 nucleotides). The percent identity between test sequence 1 and reference sequence 2 is [(5) / (10)]×100%=50%. Test sequence 1 and reference sequence 2 have 50% sequence identity. In another example, the percent identity is calculated to compare test sequence 3: CCCCCGGGGGGGGGGCCCCC (length=20 nucleotides) with reference sequence 4: GGGGGGGGGG (length=10 nucleotides). The percent identity between test sequence 3 and reference sequence 4 is [(10) / (20)]×100%=50%. Test sequence 3 has 50% sequence identity with reference sequence 4. In another example, the percent identity is calculated to compare test sequence 5: GGGGGGGGGG (length = 10 nucleotides) with reference sequence 6: CCCCCGGGGGGGGGGCCCCC (length = 20 nucleotides). The percent identity between test sequence 5 and reference sequence 6 is [(10) / (10)]×100%=100%. Test sequence 5 has 100% sequence identity with reference sequence 6.

[0284] The following non-limiting example illustrates the calculation of percent identity between two protein sequences. Percent identity is calculated as follows: [(number of identical amino acid positions) / (total number of amino acids in the test sequence)]×100%. The percent identity is calculated to compare test sequence 7: FFFFFYYYYY (length=10 amino acids) with reference sequence 8: YYYYYYYYYYY (length=10 amino acids). The percent identity between test sequence 7 and reference sequence 8 is [(5) / (10)]×100%=50%. Test sequence 7 has 50% sequence identity with reference sequence 8. In another example, the percent identity is calculated to compare test sequence 9: LLLLLFFFFFYYYYYLLLLL (length=20 amino acids) with reference sequence 10: FFFFFYYYYY (length=10 amino acids). The percent identity between test sequence 9 and reference sequence 10 is [(10) / (20)]×100%=50%. Test sequence 9 has 50% sequence identity with reference sequence 10. In another example, the percent identity is calculated to compare test sequence 11: FFFFFYYYYY (length = 10 amino acids) with reference sequence 12: LLLLLFFFFFYYYYYLLLLL (length = 20 amino acids). The percent identity between test sequence 11 and reference sequence 12 is [(10) / (10)]×100%=100%. Test sequence 11 has 100% sequence identity with reference sequence 12.

[0285] As used herein, the term "subject" refers broadly to any animal, including, but not limited to, humans and non-human animals (eg, dogs, cats, cows, horses, sheep, pigs, poultry, fish, crustaceans, etc.).

[0286] As used herein, the term "effective amount" refers to an amount of a composition (e.g., a synthetic peptide) sufficient to achieve a beneficial or desired result. An effective amount can be administered in one or more administrations, applications or dosages, and is not intended to be limited to a specific formulation or route of administration.

[0287] As used herein, the term "therapeutically effective amount" is an amount effective to alleviate symptoms of a disease. A therapeutically effective amount can be a "prophylactically effective amount" since prevention can be considered therapy.

[0288] As used herein, the terms "administration" and "administering" refer to the action of giving a drug, prodrug or other agent or therapeutic treatment (e.g., peptide) to a subject or to cells, tissues and organs in vivo, in vitro or ex vivo. Exemplary routes of administration to the human body can be through the subarachnoid space of the brain or spinal cord (intrathecal), the eye (ocular), the mouth (oral), the skin (topical or transdermal), the nose (nasal), the lungs (inhalants), the oral mucosa (buccal or lingual), the ear, the rectum, the vagina, by injection (e.g., intravenous, subcutaneous, intratumoral, intraperitoneal, etc.), etc.

[0289] As used herein, the term "treatment" means a method of obtaining a beneficial or desired clinical outcome. Beneficial or desired clinical outcomes may include alleviating symptoms, reducing disease severity, inhibiting the underlying cause of a disease or condition, stabilizing a disease in a non-advanced state, delaying the progression of a disease, and / or ameliorating or alleviating disease symptoms.

[0290] As used herein, the term "pharmaceutical composition" refers to the combination of an active ingredient with an inert or active carrier, making the composition particularly suitable for therapeutic or diagnostic use in vitro, in vivo or ex vivo.

[0291] As used herein, the term "pharmaceutically acceptable" or "pharmacologically acceptable" refers to a composition that does not substantially produce adverse reactions (eg, toxic, allergic, or immune responses) when administered to a subject.

[0292] As used herein, the term "pharmaceutically acceptable carrier" refers to any standard pharmaceutical carrier, including but not limited to phosphate buffered saline solution, water, emulsions (e.g., such as oil / water or water / oil emulsions), glycerol, liquid polyethylene glycol, aprotic solvents (such as dimethyl sulfoxide, N-methylpyrrolidone and mixtures thereof), and various types of wetting agents, solubilizers, antioxidants, fillers, protein carriers (such as albumin), any and all solvents, dispersion media, coatings, sodium lauryl sulfate, isotonic and absorption delaying agents, disintegrants (e.g., potato starch or sodium starch glycolate), etc. The composition may also contain stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants, see, e.g., Martin, Remington's Pharmaceutical Sciences, 21st Edition, Mack Publ. Co., Easton, Pa. (2005), which is incorporated herein by reference in its entirety.

[0293] As used herein, the singular form "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0294] As used herein, the terms "about" and "approximately" when referring to a number are used herein to include numbers within 10%, 5% or 1% in either direction (greater than or less than) of that number unless otherwise specified or obvious from the context (unless the number exceeds 100% of possible values).

[0295] Numbered implementation plan

[0296] The following embodiments list non-limiting arrangements of the combination of features disclosed herein. Other arrangements of the combination of features are also contemplated. Specifically, each of these numbered embodiments is considered to be subordinate to or related to each preceding or subsequent numbered embodiment, regardless of the order in which they are listed. 1. An engineered core promoter sequence, comprising a TATA box, an initiator element, a spacer separating the TATA box and the initiator element, and one or more features selected from the following: a) the TATA box comprises a sequence having at least 85% sequence identity to any one of SEQ ID NO: 199-SEQ ID NO: 201; b) the initiator element comprises a sequence having at least 75% sequence identity to any one of SEQ ID NO: 202-SEQ ID NO: 204; c) the spacer is a short spacer comprising no less than 25 and no more than 29 nucleotide residues between the TATA box and the initiator element; d) the spacer is a long spacer comprising no less than 31 and no more than 48 nucleotide residues between the TATA box and the initiator element; e) a YY1 motif comprising a sequence having at least 80% sequence identity to any one of SEQ ID NO: 205-SEQ ID NO: 207; f) a transcription pause site comprising a sequence having at least 80% sequence identity to any one of SEQ ID NO: 196-SEQ ID NO: 207; NO:198; g) at least 70% sequence identity and at least one nucleotide substitution relative to SEQ ID NO:5, SEQ ID NO:9 or SEQ ID NO:210; and h) combinations thereof. 2. The engineered core promoter sequence of embodiment 1, comprising at least 70% sequence identity and nucleotide substitutions T15G and A40C relative to SEQ ID NO:5. 3. The engineered core promoter sequence of embodiment 1, comprising at least 70% sequence identity and nucleotide substitutions T15A and A40T relative to SEQ ID NO:5. 4. The engineered core promoter sequence of any one of embodiments 1 to 3, wherein the spacer comprises 29 to 31 nucleotides between the TATA box and the initiator element. 5. The engineered core promoter sequence of any one of embodiments 1 to 4, wherein the spacer comprises 30 nucleotides between the TATA box and the initiator element. 6. The engineered core promoter sequence of any one of embodiments 1 to 3, wherein the short spacer comprises 28 nucleotide residues between the TATA box and the initiator element. 7. The engineered core promoter sequence of any one of embodiments 1 to 3, wherein the long spacer comprises 32 nucleotide residues between the TATA box and the initiator element.8. The engineered core promoter sequence of any one of embodiments 1 to 7, wherein the TATA box comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 199-SEQ ID NO: 201. 9. The engineered core promoter sequence of any one of embodiments 1 to 8, wherein the TATA box comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 199-SEQ ID NO: 201.10. The engineered core promoter sequence of any one of embodiments 1 to 9, wherein the starter element comprises a sequence having at least 85% sequence identity to any one of SEQ ID NO: 202-SEQ ID NO: 204. 11. The engineered core promoter sequence of any one of embodiments 1 to 10, wherein the starter element comprises a sequence having at least 85% sequence identity to any one of SEQ ID NO: 202-SEQ ID NO: 204. 12. The engineered core promoter sequence of any one of embodiments 1 to 11, wherein the YY1 motif comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 205-SEQ ID NO: 207. 13. The engineered core promoter sequence of any one of embodiments 1 to 12, wherein the YY1 motif comprises the sequence of any one of SEQ ID NO: 205-SEQ ID NO: 207. 14. The engineered core promoter sequence of any one of embodiments 1 to 11, wherein the transcription pause site comprises a sequence having at least 95% sequence identity to any one of SEQ ID NO: 196-SEQ ID NO: 198. 15. The engineered core promoter sequence of any one of embodiments 1 to 11, wherein the transcription pause site comprises the sequence of any one of SEQ ID NO: 196-SEQ ID NO: 198. 16. The engineered core promoter of any one of embodiments 1 to 15, wherein the engineered core promoter comprises two or more features. 17. The engineered core promoter sequence of any one of embodiments 1 to 16, wherein the engineered core promoter comprises features a) and b). 18. The engineered core promoter of any one of embodiments 1 to 17, wherein the engineered core promoter comprises three or more features. 19. The engineered core promoter sequence of any one of embodiments 1 to 18, wherein the engineered core promoter comprises features a) and b) and at least one or more features. 20. The engineered core promoter sequence of any one of embodiments 1 to 19, wherein the engineered core promoter comprises features a), b) and c). 21. The engineered core promoter sequence of any one of embodiments 1 to 19, wherein the engineered core promoter comprises features a), b) and d).22. An engineered core promoter sequence as described in any one of embodiments 1 to 19, wherein the engineered core promoter comprises features a), b) and e). 23. An engineered core promoter sequence as described in any one of embodiments 1 to 19, wherein the engineered core promoter comprises features a), b) and f). 24. An engineered core promoter sequence comprising a sequence having at least 80%, 85%, 90%, 93%, 95%, 97%, 99% or 100% sequence identity to any one of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 10-SEQ ID NO: 144. 25. The engineered core promoter sequence of embodiment 23, wherein the engineered core promoter sequence comprises a sequence having at least 80%, 85%, 90%, 93%, 95%, 97%, 99% or 100% sequence identity to any one of SEQ ID NO: 1 - SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 10 - SEQ ID NO: 15 or SEQ ID NO: 110. 26. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein the engineered core promoter sequence comprises the sequence of SEQ ID NO: 7. 27. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein the engineered core promoter sequence comprises the sequence of SEQ ID NO: 1. 28. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein the engineered core promoter sequence comprises the sequence of SEQ ID NO: 2. 29. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein the engineered core promoter sequence comprises the sequence of SEQ ID NO: 3. 30. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein the engineered core promoter sequence comprises the sequence of SEQ ID NO: 4. 31. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein the engineered core promoter sequence comprises the sequence of SEQ ID NO: 10. 32. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein the engineered core promoter sequence comprises the sequence of SEQ ID NO: 11. 33. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein the engineered core promoter sequence comprises the sequence of SEQ ID NO: 12. 34. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein the engineered core promoter sequence comprises the sequence of SEQ ID NO: 13.35. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein the engineered core promoter sequence comprises the sequence of SEQ ID NO: 14. 36. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein the engineered core promoter sequence comprises the sequence of SEQ ID NO: 15. 37. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein the engineered core promoter sequence comprises the sequence of SEQ ID NO: 110. 38. The engineered core promoter sequence of any one of embodiments 1 to 37, wherein the engineered core promoter sequence comprises a TATA box, an RNA polymerase binding sequence, a B recognition element, a CCAAT box, or a Pribnow box. 39. The engineered core promoter sequence of any one of embodiments 1 to 38, wherein the engineered core promoter sequence is capable of recruiting a polymerase. 40. The engineered core promoter sequence of embodiment 39, wherein the polymerase is RNA polymerase II. 41. The engineered core promoter sequence of any one of embodiments 1 to 40, wherein the dynamic range of the engineered core promoter is higher than the dynamic range of SEQ ID NO: 6. 42. The engineered core promoter sequence of any one of embodiments 1 to 41, wherein the dynamic range of the engineered core promoter is higher than the dynamic range of SEQ ID NO: 9. 43. The engineered core promoter sequence of any one of embodiments 1 to 42, wherein the activity of the engineered core promoter is higher than the activity of SEQ ID NO: 6. 44. The engineered core promoter sequence of any one of embodiments 1 to 43, wherein the activity of the engineered core promoter is higher than the activity of SEQ ID NO: 9. 45. The engineered core promoter sequence of any one of embodiments 1 to 44, wherein the engineered core promoter has an activity higher than the activity of SEQ ID NO: 6 when paired with an active response element, a basal activity lower than the basal activity of SEQ ID NO: 6 when paired with an inactive response element, or both. 46. ​​An engineered core promoter sequence as described in any one of embodiments 1 to 45, wherein the engineered core promoter has an activity higher than the activity of SEQ ID NO: 9 when paired with an active response element, has a basal activity lower than the basal activity of SEQ ID NO: 9 when paired with an inactive response element, or both. 47. A recombinant polynucleotide comprising a promoter and a payload, wherein the promoter comprises: a response element capable of binding to a cognate ligand, a coactivator, or a corepressor; and an engineered core promoter sequence as described in any one of embodiments 1 to 46 capable of recruiting a polymerase; wherein the payload comprises a coding sequence.48. The recombinant polynucleotide of embodiment 47, wherein the response element is an enhancer. 49. The recombinant polynucleotide of embodiment 47 or embodiment 48, wherein binding of the cognate ligand or the coactivator to the response element increases transcription of the payload in a target cell type, target cell state, or target tissue. 50. The recombinant polynucleotide of embodiment 47, wherein binding of the corepressor to the response element decreases transcription of the payload in a non-target cell type, non-target cell state, or non-target tissue. 51. The recombinant polynucleotide of any one of embodiments 47 to 50, wherein the response element confers neuron-specific transcription of the payload. 52. The recombinant polynucleotide of any one of embodiments 47 to 50, wherein the response element confers muscle-specific transcription of the payload. 53. The recombinant polynucleotide of any one of embodiments 47 to 50, wherein the response element confers kidney-specific transcription of the payload. 54. The recombinant polynucleotide of any one of embodiments 47 to 53, wherein the payload encodes a protein. 55. The recombinant polynucleotide of embodiment 54, wherein the protein is a neuronal protein, a kidney protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. 56. The recombinant polynucleotide of embodiment 54 or embodiment 55, wherein the protein is associated with a genetic disorder, a neuronal disorder, a kidney disorder, an eye disorder, a muscle disorder, or a cancer. 57. The recombinant polynucleotide of any one of embodiments 54 to 56, wherein the protein is progranulin, MeCP2, polycystin-1, or polycystin-2. 58. The recombinant polynucleotide of any one of embodiments 47 to 53, wherein the payload encodes a therapeutic polynucleotide. 59. The recombinant polynucleotide of embodiment 58, wherein the therapeutic polynucleotide is a guide RNA or a suppressor tRNA. 60. The recombinant polynucleotide of embodiment 58 or embodiment 59, wherein the therapeutic polynucleotide targets a gene. 61. The recombinant polynucleotide of embodiment 60, wherein the gene is associated with a genetic disorder, a neuronal disorder, a kidney disorder, an eye disorder, a muscle disorder, or a cancer. 62. The recombinant polynucleotide of embodiment 60 or embodiment 61, wherein the gene is GRN, MECP2, PKD2 or PKD2. 63. An engineered viral vector comprising the recombinant polynucleotide of any one of embodiments 47 to 62 in the viral vector. 64. The engineered viral vector of embodiment 63, wherein the viral vector is an adenoviral vector, an adeno-associated viral vector or a lentiviral vector.65. The engineered viral vector of embodiment 64, wherein the adeno-associated viral vector is selected from the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10. AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, A AV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.V1, AAV.PHP.B, AAV. AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, and combinations thereof. 66. A pharmaceutical composition comprising a recombinant polynucleotide as described in any one of embodiments 47 to 62 or a viral vector as described in any one of embodiments 63 to 65 and a pharmaceutically acceptable carrier. 67. A method of expressing a payload in a target cell of a subject, the method comprising: administering to the subject a recombinant polynucleotide of any one of embodiments 47 to 62, a viral vector of any one of embodiments 63 to 65, or a pharmaceutical composition of embodiment 66; binding a cognate ligand, coactivator, or corepressor to the response element of the recombinant polynucleotide, wherein the cognate ligand or the coactivator is specific for the target cell, or wherein the corepressor is specific for a non-target cell; initiating transcription of the payload by recruiting a polymerase to the core promoter sequence; and transcribing the payload, thereby expressing the payload in the target cell. 68. The method of embodiment 67, comprising expressing the payload at a higher level in the cell type of interest than in the non-target cell.69. The method of embodiment 67 or embodiment 68, comprising initiating transcription at a higher rate in the cell type of interest than in the non-target cell. 70. The method of any one of embodiments 67 to 69, wherein the cognate ligand or the coactivator is present at a higher level in the target cell than in the non-target cell. 71. The method of any one of embodiments 67 to 70, wherein the cognate ligand is a transcription factor. 72. The method of any one of embodiments 67 to 69, wherein the co-repressor is present at a higher level in the non-target cell than in the target cell. 73. The method of any one of embodiments 67 to 72, wherein the target cell is a target cell state, and wherein the non-target cell is a non-target cell state. 74. The method of embodiment 73, wherein the target cell state is a diseased cell. 75. The method of embodiment 73 or embodiment 74, wherein the non-target cell state is a healthy cell. 76. The method of any one of embodiments 67 to 71, wherein the target cell is a target cell type, and wherein the non-target cell is a non-target cell type. 77. The method of embodiment 76, wherein the target cell type is a central nervous system cell, a neuron, a kidney cell, a retinal cell, a liver cell, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, an interstitial cell, an adipocyte, or a fibroblast. 78. The method of embodiment 76 or embodiment 77, wherein the non-target cell type is a central nervous system cell, a neuron, a kidney cell, a retinal cell, a liver cell, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, an interstitial cell, an adipocyte, or a fibroblast, or a combination thereof. 79. A method of treating a condition in a subject in need thereof, the method comprising: administering to the subject a composition comprising a recombinant polynucleotide as described in any one of embodiments 47 to 62, a viral vector as described in any one of embodiments 63 to 65, or a pharmaceutical composition as described in embodiment 66; and expressing a therapeutic sequence encoded by the payload of the recombinant polynucleotide in the target cells of the subject, thereby treating the condition. 80. The method of embodiment 79, wherein the target cell is a cell type associated with the disorder. 81. The method of embodiment 79, wherein the target cell is a cell state associated with the disorder. 82. The method of any one of embodiments 79 to 81, wherein the disorder is a genetic disorder, a neuronal disorder, a kidney disorder, an eye disorder, a muscle disorder, or a cancer.83. The method of any one of embodiments 79 to 82, wherein the disorder is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuronal ceroid lipofuscinosis, cancer, atherosclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, limbic predominant age-related TDP-43 encephalopathy, or polycystic kidney disease. 84. The method of any one of embodiments 79 to 83, wherein the disorder is any one of the disorders provided in Table 5. 85. The method of any one of embodiments 79 to 84, wherein the therapeutic sequence encodes a therapeutic protein. 86. The method of embodiment 85, wherein the therapeutic protein is a neuronal protein, a kidney protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. 87. The method of embodiment 85 or embodiment 86, wherein the therapeutic protein is associated with a genetic disorder, a neuronal disorder, a kidney disorder, an eye disorder, a muscle disorder, or a cancer. 88. The method of any one of embodiments 85 to 87, wherein the therapeutic protein is MECP2, progranulin, polycystin-1, or polycystin-2. 89. The method of any one of embodiments 85 to 88, wherein the therapeutic protein is encoded by a gene provided in Table 5. 90. The method of any one of embodiments 79 to 84, wherein the payload encodes a therapeutic polynucleotide. 91. The method of embodiment 90, wherein the therapeutic polynucleotide is a guide RNA or a suppressor tRNA. 92. The method of embodiment 90 or embodiment 91, wherein the therapeutic polynucleotide targets a gene provided in Table 5. 93. A method for identifying a switchable core promoter, the method comprising: introducing a core promoter library comprising a first sub-library and a second sub-library into a cell population; wherein the first sub-library comprises a plurality of core promoter sequences, wherein a core promoter sequence in the plurality of core promoter sequences is linked to a first enhancer sequence, and a unique barcode sequence; wherein the second sub-library comprises a plurality of core promoter sequences, wherein a core promoter sequence in the plurality of promoter sequences is linked to a second enhancer sequence, and a unique barcode sequence; and identifying a switchable core promoter as a core promoter sequence that promotes higher transcription of the unique barcode when paired with the first enhancer sequence than when paired with the second enhancer sequence. 94. The method of embodiment 93, further comprising activating the first enhancer sequence. 95. The method of embodiment 93 or embodiment 94, wherein the second enhancer sequence is not activated. 96. The method of any one of embodiments 93 to 95, wherein the first enhancer sequence is an active enhancer and the second enhancer sequence is an inactive enhancer. 97. The method of any one of embodiments 93 to 96, wherein the first enhancer sequence is specific to a cell population.98. The method of any one of embodiments 93 to 97, wherein the cell population is neurons, kidney cells, hepatocytes, muscle cells, or cancer cells. 99. The method of any one of embodiments 93 to 98, wherein the first enhancer sequence is specific for neurons, kidney cells, hepatocytes, muscle cells, or cancer cells. 100. The method of any one of embodiments 93 to 99, wherein the second enhancer sequence is specific for neurons, kidney cells, hepatocytes, muscle cells, or cancer cells. 101. The method of any one of embodiments 93 to 100, wherein the plurality of core promoter sequences comprises an engineered core promoter sequence, a synthetic core promoter sequence, a wild-type core promoter sequence, a variant core promoter sequence, or a combination thereof.

[0297] Additional numbered implementations

[0298] The following embodiments list non-limiting arrangements of the combination of features disclosed herein. Other arrangements of the combination of features are also contemplated. Specifically, each of these numbered embodiments is considered to be subordinate to or related to each preceding or subsequent numbered embodiment, regardless of the order in which they are listed. 1. An engineered core promoter, comprising a TATA box, an initiator element, a spacer separating the TATA box and the initiator element, and one or more features selected from the following: a) the TATA box comprises a sequence having at least 85% sequence identity to any one of SEQ ID NO: 199-SEQ ID NO: 201 or SEQ ID NO: 213-SEQ ID NO: 215; b) the initiator element comprises a sequence having at least 75% sequence identity to any one of SEQ ID NO: 202-SEQ ID NO: 204, SEQ ID NO: 216 or SEQ ID NO: 217; c) the spacer is a short spacer comprising no less than 25 and no more than 29 nucleotide residues from the TATA box to the initiator element; d) the spacer is a long spacer comprising no less than 31 and no more than 48 nucleotide residues from the TATA box to the initiator element; e) a YY1 motif comprising a sequence having at least 85% sequence identity to any one of SEQ ID NO: 205-SEQ ID NO: 206; NO:207; f) a transcription pause site comprising a sequence having at least 90% sequence identity to any one of SEQ ID NO:196-SEQ ID NO:198, SEQ ID NO:211 or SEQ ID NO:212; g) at least 70% sequence identity and at least one nucleotide substitution relative to SEQ ID NO:5, SEQ ID NO:9 or SEQ ID NO:210; and h) combinations thereof. 2. The engineered core promoter of embodiment 1, comprising at least 70% sequence identity and nucleotide substitutions T15G and A40C relative to SEQ ID NO:5. 3. The engineered core promoter of embodiment 1, comprising at least 70% sequence identity and nucleotide substitutions T15A and A40T relative to SEQ ID NO:5. 4. The engineered core promoter of any one of embodiments 1 to 3, wherein the spacer comprises 29 to 31 nucleotides from the TATA box to the initiator element. 5. The engineered core promoter of any one of embodiments 1 to 4, wherein the spacer comprises 30 nucleotides from the TATA box to the initiator element. 6. The engineered core promoter of any one of embodiments 1 to 3, wherein the short spacer comprises 28 nucleotide residues from the TATA box to the initiator element.7. The engineered core promoter of any one of embodiments 1 to 3, wherein the long spacer comprises 32 nucleotide residues from the TATA box to the initiator element. 8. The engineered core promoter of any one of embodiments 1 to 7, wherein the TATA box comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 199–SEQ ID NO: 201 or SEQ ID NO: 213–SEQ ID NO: 215. 9. The engineered core promoter of any one of embodiments 1 to 8, wherein the TATA box comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 199–SEQ ID NO: 201 or SEQ ID NO: 213–SEQ ID NO: 215. 10. The engineered core promoter of any one of embodiments 1 to 9, wherein the initiator element comprises a sequence having at least 85% sequence identity to any one of SEQ ID NO: 202–SEQ ID NO: 204, SEQ ID NO: 216, or SEQ ID NO: 217. 11. The engineered core promoter of any one of embodiments 1 to 10, wherein the initiator element comprises a sequence of any one of SEQ ID NO: 202-SEQ ID NO: 204, SEQ ID NO: 216, or SEQ ID NO: 217. 12. The engineered core promoter of any one of embodiments 1 to 11, wherein the YY1 motif comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 205-SEQ ID NO: 207. 13. The engineered core promoter of any one of embodiments 1 to 12, wherein the YY1 motif comprises a sequence of any one of SEQ ID NO: 205-SEQ ID NO: 207. 14. The engineered core promoter of any one of embodiments 1 to 11, wherein the transcription pause site comprises a sequence having at least 95% sequence identity to any one of SEQ ID NO: 196-SEQ ID NO: 198, SEQ ID NO: 211, or SEQ ID NO: 212. 15. The engineered core promoter of any one of embodiments 1 to 11, wherein the transcription pause site comprises a sequence of any one of SEQ ID NO: 196-SEQ ID NO: 198, SEQ ID NO: 211, or SEQ ID NO: 212. 16. The engineered core promoter of any one of embodiments 1 to 15, wherein the engineered core promoter comprises two or more features. 17. The engineered core promoter of any one of embodiments 1 to 16, wherein the engineered core promoter comprises features a) and b).18. The engineered core promoter of any one of embodiments 1 to 17, wherein the engineered core promoter comprises three or more features. 19. The engineered core promoter of any one of embodiments 1 to 18, wherein the engineered core promoter comprises features a) and b) and at least one or more features. 20. The engineered core promoter of any one of embodiments 1 to 19, wherein the engineered core promoter comprises features a), b) and c). 21. The engineered core promoter of any one of embodiments 1 to 19, wherein the engineered core promoter comprises features a), b) and d). 22. The engineered core promoter of any one of embodiments 1 to 19, wherein the engineered core promoter comprises features a), b) and e). 23. The engineered core promoter of any one of embodiments 1 to 19, wherein the engineered core promoter comprises features a), b) and f). 24. An engineered core promoter comprising a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 1 - SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10 - SEQ ID NO: 144. 25. The engineered core promoter of embodiment 24, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 1 - SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10 - SEQ ID NO: 144. 26. The engineered core promoter of embodiment 23, wherein the engineered core promoter comprises a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 1 - SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 10 - SEQ ID NO: 15, or SEQ ID NO: 110. 27. The engineered core promoter of embodiment 26, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 1 - SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 10 - SEQ ID NO: 15, or SEQ ID NO: 110. 28. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 7.29. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises the sequence of SEQ ID NO: 7. 30. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 1. 31. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises the sequence of SEQ ID NO: 1. 32. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 2. 33. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises the sequence of SEQ ID NO: 2. 34. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 3. 35. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises the sequence of SEQ ID NO: 3. 36. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 4 and comprising nucleotide substitutions T15G and A40T relative to SEQ ID NO: 5. 37. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises the sequence of SEQ ID NO: 4. 38. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 10. 39. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises the sequence of SEQ ID NO: 10. 40. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 11. 41. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises the sequence of SEQ ID NO: 11. 42. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 12. 43. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises the sequence of SEQ ID NO: 12.44. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 13. 45. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises the sequence of SEQ ID NO: 13. 46. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 14. 47. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises the sequence of SEQ ID NO: 14. 48. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 15 and comprising nucleotide substitutions T15G and A40C relative to SEQ ID NO: 5. 49. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises the sequence of SEQ ID NO: 15. 50. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 110. 51. The engineered core promoter of any one of embodiments 23 to 27, wherein the engineered core promoter comprises the sequence of SEQ ID NO: 110. 52. The engineered core promoter of any one of embodiments 1 to 51, wherein the engineered core promoter comprises a TATA box, an RNA polymerase binding sequence, a B recognition element, a CCAAT box, or a Pribnow box. 53. The engineered core promoter of any one of embodiments 1 to 52, wherein the engineered core promoter is capable of recruiting a polymerase. 54. The engineered core promoter of embodiment 53, wherein the polymerase is RNA polymerase II. 55. The engineered core promoter of any one of embodiments 1 to 54, wherein the dynamic range of the engineered core promoter is higher than the dynamic range of SEQ ID NO: 6. 56. The engineered core promoter of any one of embodiments 1 to 55, wherein the dynamic range of the engineered core promoter is higher than the dynamic range of SEQ ID NO: 9. 57. The engineered core promoter of any one of embodiments 1 to 56, wherein the activity of the engineered core promoter is higher than the activity of SEQ ID NO: 6. 58. The engineered core promoter of any one of embodiments 1 to 57, wherein the activity of the engineered core promoter is higher than the activity of SEQ ID NO: 9.59. The engineered core promoter of any one of embodiments 1 to 58, wherein the engineered core promoter paired with an activated response element produces a transcriptional activity that is higher than the transcriptional activity produced when the core promoter of SEQ ID NO: 6 is paired with the activated response element, the engineered core promoter paired with an activated response element produces a basal transcriptional activity that is lower than the basal transcriptional activity produced when the core promoter of SEQ ID NO: 6 is paired with an inactive response element, or both. 60. The engineered core promoter of any one of embodiments 1 to 59, wherein the engineered core promoter paired with an activated response element produces a transcriptional activity that is higher than the transcriptional activity produced when the core promoter of SEQ ID NO: 9 is paired with the activated response element, the engineered core promoter paired with an activated response element produces a basal transcriptional activity that is lower than the basal transcriptional activity produced when the core promoter of SEQ ID NO: 9 is paired with an inactive response element, or both. 61. An engineered response element comprising a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 145 or SEQ ID NO: 146. 62. The engineered response element of embodiment 61, wherein the engineered response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145 or SEQ ID NO: 146. 63. The engineered response element of embodiment 61 or embodiment 62, wherein the engineered response element comprises the sequence of SEQ ID NO: 145 or SEQ ID NO: 146. 64. The engineered response element of any one of embodiments 61 to 63, wherein the engineered response element is capable of binding to a cognate ligand, a coactivator, or a corepressor. 65. The engineered response element of embodiment 64, wherein the engineered response element is an enhancer. 66. The engineered response element of embodiment 64 or embodiment 65, wherein binding of the cognate ligand or the coactivator to the engineered response element increases transcription of a payload under the transcriptional control of the engineered response element paired with a core promoter in a target cell type, target cell state, or target tissue. 67. The engineered response element of embodiment 64, wherein binding of the corepressor to the engineered response element decreases transcription of a payload under the transcriptional control of the engineered response element paired with a core promoter in a non-target cell type, non-target cell state, or non-target tissue. 68. The engineered response element of any one of embodiments 61 to 67, wherein the engineered response element confers myeloid-specific transcription of a payload under the transcriptional control of the engineered response element paired with a core promoter.69. The engineered response element of embodiment 68, comprising the sequence of SEQ ID NO: 145. 70. The engineered response element of any one of embodiments 61 to 67, wherein the engineered response element confers liver-specific transcription of a payload under the transcriptional control of the engineered response element paired with a core promoter. 71. The engineered response element of embodiment 70, comprising the sequence of SEQ ID NO: 146. 72. An engineered promoter comprising a response element and a core promoter; wherein the response element comprises a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194, and wherein the core promoter comprises a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 1 - SEQ ID NO: 144, or SEQ ID NO: 210. 73. The engineered promoter of embodiment 72, wherein the core promoter comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 1 - SEQ ID NO: 144, or SEQ ID NO: 210. 74. The engineered promoter of embodiment 72 or embodiment 73, wherein the core promoter comprises a sequence of SEQ ID NO: 1-SEQ ID NO: 144 or SEQ ID NO: 210. 75. The engineered promoter of any one of embodiments 72 to 74, wherein the engineered promoter comprises a sequence of any one of SEQ ID NO: 148-SEQ ID NO: 177 or SEQ ID NO: 218-SEQ ID NO: 255. 76. An engineered promoter comprising a response element and an engineered core promoter of any one of embodiments 1 to 60. 77. The engineered promoter of any one of embodiments 72 to 76, wherein the response element is capable of binding to a cognate ligand, a coactivator, or a corepressor. 78. The engineered promoter of embodiment 77, wherein the response element is an enhancer. 79. An engineered promoter as described in embodiment 77 or embodiment 78, wherein binding of the cognate ligand or the coactivator to the response element increases transcription of the payload under the transcriptional control of the engineered promoter in a target cell type, target cell state, or target tissue.80. The engineered promoter of embodiment 77, wherein binding of the corepressor to the response element reduces transcription of a payload under the transcriptional control of the engineered promoter in a non-target cell type, non-target cell state, or non-target tissue. 81. The engineered promoter of any one of embodiments 72 to 80, wherein the response element confers bone marrow-specific transcription of a payload under the transcriptional control of the engineered promoter. 82. The engineered promoter of embodiment 81, wherein the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145 or SEQ ID NO: 193. 83. The engineered promoter of embodiment 81 or embodiment 82, wherein the response element comprises a sequence of SEQ ID NO: 145 or SEQ ID NO: 193. 84. The engineered promoter of any one of embodiments 72 to 80, wherein the response element confers liver-specific transcription of a payload under the transcriptional control of the engineered promoter. 85. The engineered promoter of embodiment 84, wherein the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 146 or SEQ ID NO: 194. 86. The engineered promoter of embodiment 84 or embodiment 85, wherein the response element comprises a sequence of SEQ ID NO: 146 or SEQ ID NO: 194. 87. The engineered promoter of any one of embodiments 72 to 80, wherein the response element confers neuron-specific transcription of a payload under the transcriptional control of the engineered promoter. 88. The engineered promoter of any one of embodiments 72 to 80, wherein the response element confers muscle-specific transcription of a payload under the transcriptional control of the engineered promoter. 89. The engineered promoter of any one of embodiments 72 to 80, wherein the response element confers kidney-specific transcription of a payload under the transcriptional control of the engineered promoter. 90. A recombinant polynucleotide comprising the engineered core promoter of any one of embodiments 1 to 60 and a payload, the payload comprising a coding sequence under the transcriptional control of the engineered core promoter. 91. A recombinant polynucleotide comprising: a response element comprising a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99% or 100% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193 or SEQ ID NO: 194; and a payload comprising a coding sequence under the transcriptional control of the response element.92. The recombinant polynucleotide of embodiment 91, wherein the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194. 93. The recombinant polynucleotide of embodiment 91 or embodiment 92, wherein the response element comprises a sequence of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194. 94. A recombinant polynucleotide comprising a promoter and a payload, wherein the promoter comprises: a response element capable of binding to a cognate ligand, a coactivator, or a corepressor; and an engineered core promoter of any one of embodiments 1 to 60 capable of recruiting a polymerase; wherein the payload comprises a coding sequence under the transcriptional control of the promoter. 95. The recombinant polynucleotide of embodiment 94, wherein the response element is an enhancer. 96. The recombinant polynucleotide of embodiment 94 or embodiment 95, wherein binding of the cognate ligand or the coactivator to the response element increases transcription of the payload in a target cell type, target cell state, or target tissue. 97. The recombinant polynucleotide of embodiment 94, wherein binding of the corepressor to the response element decreases transcription of the payload in a non-target cell type, non-target cell state, or non-target tissue. 98. The recombinant polynucleotide of any one of embodiments 94 to 97, wherein the response element confers neuron-specific transcription of the payload. 99. The recombinant polynucleotide of any one of embodiments 94 to 97, wherein the response element confers myeloid-specific transcription of the payload. 100. The recombinant polynucleotide of embodiment 99, wherein the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145 or SEQ ID NO: 193. 101. The recombinant polynucleotide of embodiment 99 or embodiment 11, wherein the response element comprises the sequence of SEQ ID NO: 145 or SEQ ID NO: 193. 102. The recombinant polynucleotide of any one of embodiments 94 to 97, wherein the response element confers liver-specific transcription of the payload. 103. The recombinant polynucleotide of embodiment 102, wherein the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 146 or SEQ ID NO: 194. 104. The recombinant polynucleotide of embodiment 102 or embodiment 103, wherein the response element comprises a sequence of SEQ ID NO: 146 or SEQ ID NO: 194.105. The recombinant polynucleotide of any one of embodiments 94 to 97, wherein the response element confers muscle-specific transcription of the payload. 106. The recombinant polynucleotide of any one of embodiments 94 to 97, wherein the response element confers kidney-specific transcription of the payload. 107. A recombinant polynucleotide comprising a promoter and a payload, wherein the promoter comprises: a response element capable of binding to a cognate ligand, coactivator, or corepressor, wherein the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194; and an engineered core promoter capable of recruiting a polymerase; wherein the payload comprises a coding sequence under the transcriptional control of the promoter. 108. The recombinant polynucleotide of any one of embodiments 90 to 107, wherein the payload encodes a protein. 109. The recombinant polynucleotide of embodiment 108, wherein the protein is a neuronal protein, a kidney protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. 110. The recombinant polynucleotide of embodiment 108 or embodiment 109, wherein the protein is associated with a genetic disorder, a neuronal disorder, a renal disorder, an ocular disorder, a muscle disorder, or a cancer. 111. The recombinant polynucleotide of any one of embodiments 108 to 110, wherein the protein is progranulin, MeCP2, polycystin-1, or polycystin-2. 112. The recombinant polynucleotide of any one of embodiments 90 to 107, wherein the payload encodes a therapeutic polynucleotide. 113. The recombinant polynucleotide of embodiment 112, wherein the therapeutic polynucleotide is a guide RNA or a suppressor tRNA. 114. The recombinant polynucleotide of embodiment 112 or embodiment 113, wherein the therapeutic polynucleotide targets a gene. 115. The recombinant polynucleotide of embodiment 114, wherein the gene is associated with a genetic disorder, a neuronal disorder, a renal disorder, an ocular disorder, a muscle disorder, or a cancer. 116. The recombinant polynucleotide of embodiment 114 or embodiment 115, wherein the gene is GRN, MECP2, PKD2 or PKD2. 117. An engineered viral vector comprising the engineered core promoter of any one of embodiments 1 to 60 in the viral vector. 118. An engineered viral vector comprising the engineered response element of any one of embodiments 61 to 71 in the viral vector. 119. An engineered viral vector comprising the engineered promoter of any one of embodiments 72 to 89 in the viral vector. 120. An engineered viral vector comprising the recombinant polynucleotide of any one of embodiments 90 to 116 in the viral vector.121. The engineered viral vector of any one of embodiments 117 to 120, wherein the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. 122. The engineered viral vector of embodiment 121, wherein the adeno-associated viral vector is selected from the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10. AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, A AV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.V1, AAV.PHP.B, AAV. 123. A cell comprising the engineered core promoter of any one of embodiments 1 to 60. 124. A cell comprising the engineered response element of any one of embodiments 61 to 71. 125. A cell comprising the engineered promoter of any one of embodiments 72 to 89. 126. A cell comprising the recombinant polynucleotide of any one of embodiments 90 to 116. 127. A cell comprising the engineered viral vector of any one of embodiments 117 to 122. 128. The cell of any one of embodiments 123 to 127, wherein the cell is a target cell. 129. The cell of any one of embodiments 123 to 128, wherein the cell is a diseased cell.130. A cell as described in any of embodiments 123 to 129, wherein the cell is a central nervous system cell, a neuron, a kidney cell, a retinal cell, a hepatocyte, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, a mesenchymal cell, an adipocyte, or a fibroblast. 131. A pharmaceutical composition comprising the engineered core promoter as described in any of embodiments 1 to 60 and a pharmaceutically acceptable carrier. 132. A pharmaceutical composition comprising the engineered response element as described in any of embodiments 61 to 71 and a pharmaceutically acceptable carrier. 133. A pharmaceutical composition comprising the engineered promoter as described in any of embodiments 72 to 89 and a pharmaceutically acceptable carrier. 134. A pharmaceutical composition comprising the recombinant polynucleotide as described in any of embodiments 90 to 116 and a pharmaceutically acceptable carrier. 135. A pharmaceutical composition comprising the engineered viral vector as described in any of embodiments 117 to 122 and a pharmaceutically acceptable carrier. 136. A method of expressing a payload in a target cell of a subject, the method comprising: administering to the subject a recombinant polynucleotide of any one of embodiments 90 to 116, a viral vector of any one of embodiments 117 to 122, or a pharmaceutical composition of embodiment 134 or embodiment 135; binding a cognate ligand, coactivator, or corepressor to the response element of the recombinant polynucleotide, wherein the cognate ligand or the coactivator is specific for the target cell, or wherein the corepressor is specific for a non-target cell; initiating transcription of the payload by recruiting a polymerase to the core promoter sequence; and transcribing the payload, thereby expressing the payload in the target cell. 137. The method of embodiment 136, comprising expressing the payload at a higher level in the target cell than in the non-target cell. 138. The method of embodiment 136 or embodiment 137, comprising initiating transcription in the target cell at a higher rate than in the non-target cell. 139. The method of any one of embodiments 136 to 138, wherein the cognate ligand or the coactivator is present at a higher level in the target cell than in the non-target cell. 140. The method of any one of embodiments 136 to 139, wherein the cognate ligand is a transcription factor. 141. The method of any one of embodiments 136 to 140, wherein the co-repressor is present at a higher level in the non-target cell than in the target cell. 142. The method of any one of embodiments 136 to 141, wherein the target cell is a target cell state, and wherein the non-target cell is a non-target cell state. 143. The method of embodiment 142, wherein the target cell state is a diseased cell.144. The method of embodiment 142 or embodiment 143, wherein the non-target cell state is a healthy cell. 145. The method of any one of embodiments 136 to 140, wherein the target cell is a target cell type, and wherein the non-target cell is a non-target cell type. 146. The method of embodiment 145, wherein the target cell type is a central nervous system cell, a neuron, a kidney cell, a retinal cell, a liver cell, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, a mesenchymal cell, an adipocyte, or a fibroblast. 147. The method of embodiment 145 or embodiment 146, wherein the non-target cell type is a central nervous system cell, a neuron, a kidney cell, a retinal cell, a liver cell, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, a mesenchymal cell, an adipocyte, a fibroblast, or a combination thereof. 148. A method of treating a disorder in a subject in need thereof, the method comprising: administering to the subject a composition comprising a recombinant polynucleotide as described in any one of embodiments 90 to 116, a viral vector as described in any one of embodiments 117 to 122, or a pharmaceutical composition as described in embodiment 134 or embodiment 135; and expressing a therapeutic sequence encoded by the payload of the recombinant polynucleotide in a target cell of the subject, thereby treating the disorder. 149. The method of embodiment 148, wherein the target cell is a cell type associated with the disorder. 150. The method of embodiment 148, wherein the target cell is a cell state associated with the disorder. 151. The method of any one of embodiments 148 to 150, wherein the disorder is a genetic disorder, a neuronal disorder, a renal disorder, an ocular disorder, a muscle disorder, or a cancer. 152. The method of any one of embodiments 148 to 151, wherein the disorder is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuronal ceroid lipofuscinosis, cancer, atherosclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, limbic predominant age-related TDP-43 encephalopathy, or polycystic kidney disease. 153. The method of any one of embodiments 148 to 152, wherein the disorder is any one of the disorders provided in Table 5. 154. The method of any one of embodiments 148 to 153, wherein the therapeutic sequence encodes a therapeutic protein. 155. The method of embodiment 154, wherein the therapeutic protein is a neuronal protein, a kidney protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. 156. The method of embodiment 154 or embodiment 155, wherein the therapeutic protein is associated with a genetic disorder, a neuronal disorder, a kidney disorder, an eye disorder, a muscle disorder, or a cancer.157. The method of any one of embodiments 154 to 156, wherein the therapeutic protein is MECP2, progranulin, polycystin-1, or polycystin-2. 158. The method of any one of embodiments 154 to 157, wherein the therapeutic protein is encoded by a gene provided in Table 5. 159. The method of any one of embodiments 148 to 158, wherein the payload encodes a therapeutic polynucleotide. 160. The method of embodiment 159, wherein the therapeutic polynucleotide is a guide RNA or a suppressor tRNA. 161. The method of embodiment 159 or embodiment 160, wherein the therapeutic polynucleotide targets a gene provided in Table 5. 162. A method of identifying a switchable core promoter, the method comprising: introducing a core promoter library comprising a first sub-library and a second sub-library into a cell population; wherein the first sub-library comprises a plurality of core promoters, wherein a core promoter in the plurality of core promoters is linked to a first response element, and a unique barcode sequence; wherein the second sub-library comprises the plurality of core promoters, wherein a core promoter in the plurality of promoters is linked to a second response element, and a unique barcode sequence; and identifying a switchable core promoter as a core promoter that promotes higher transcription of the unique barcode when paired with the first response element than when paired with the second response element. 163. The method of embodiment 162, further comprising activating the first response element. 164. The method of embodiment 162 or embodiment 163, wherein the second response element is not activated. 165. The method of any one of embodiments 162 to 164, wherein the first response element is an activated response element and the second enhancer sequence is an inactive response element or a non-activated response element. 166. The method of any one of embodiments 162 to 165, wherein the first response element is specific for a cell population. 167. The method of any one of embodiments 162 to 166, wherein the cell population is neurons, kidney cells, liver cells, muscle cells, or cancer cells. 168. The method of any one of embodiments 162 to 167, wherein the first response element is specific for neurons, kidney cells, liver cells, muscle cells, or cancer cells. 169. The method of any one of embodiments 162 to 168, wherein the second response element is specific for neurons, kidney cells, liver cells, muscle cells, or cancer cells. 170. The method of any one of embodiments 162 to 169, wherein the plurality of core promoters comprises an engineered core promoter, a synthetic core promoter, a wild-type core promoter, a variant core promoter, or a combination thereof.171. A recombinant polynucleotide as described in any one of embodiments 90 to 116, a viral vector as described in any one of embodiments 117 to 122, or a pharmaceutical composition as described in embodiment 134 or embodiment 135; for use in a method of treating a condition, the method comprising administering a composition comprising the recombinant polynucleotide, viral vector or pharmaceutical composition to a subject, and expressing a therapeutic sequence encoded by the payload of the recombinant polynucleotide in a target cell of the subject. 172. A recombinant polynucleotide, viral vector or pharmaceutical composition for use as described in embodiment 171, wherein the condition treated is a genetic condition, a neuronal condition, a renal condition, an eye condition, a muscle condition or cancer. 173. A recombinant polynucleotide, viral vector or pharmaceutical composition for use as described in any one of embodiments 171 to 172, wherein the condition is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuronal ceroid lipofuscinosis, cancer, atherosclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, limbic-predominant age-related TDP-43 encephalopathy, or polycystic kidney disease. 174. The recombinant polynucleotide, viral vector or pharmaceutical composition for use as described in any one of embodiments 171 to 173, wherein the disorder is any one of the disorders provided in Table 5.

[0299] Example

[0300] The invention is further described by the following non-limiting examples.

[0301] Example 1: Massively parallel reporter gene assay screening for switchable core promoters

[0302] This example describes a massively parallel reporter assay (MPRA) screen to identify switchable core promoters. The goal of the screen was to identify core promoters that promote high levels of transcription but exhibit low basal transcription initiation when paired with activated cell type-specific enhancer sequences.

[0303] A library of 3,649 core promoters was designed, containing variants of existing activatable core promoter sequences and core promoter sequences synthesized completely from scratch. Variants of existing core promoters were designed by mutagenesis of existing synthetic core promoters, including ybTATA (SEQ ID NO: 9) and minP (SEQ ID NO: 5) from pGL4. Synthetic core promoters were developed by randomly generating matches with TATA and initiator elements Inr within the predicted similarity score range. The final library contained 2157 sequence variants and 1484 completely de novo synthesized sequences.

[0304] Enhancer sequences were selected to be paired with core promoter library members to screen for high levels of cell state-specific transcriptional activation and low levels of basal transcriptional activation in a hepatoblastoid cell line (HepG2). Enhancers were selected based on cell type-specific activity in HepG2 cells and a bone marrow cell line (K562). Literature MPRA results were used to identify endogenous enhancers with cell type-specific activity by comparing the activation levels of different enhancers in HepG2 cells (a cancer cell model for hepatocytes) and K562 cells (a cancer cell model for bone marrow cells), such as Figure 1 As shown. Enhancers with HepG2-specific activity appear in the upper left region of the figure, and enhancers with K562-specific activity appear in the lower right region of the figure. Enhancers with low activity in two cell types appear in the lower left region of the figure. Three enhancers are selected for core promoter library screening: endogenous enhancers with HepG2-specific activation (SEQ ID NO: 194), endogenous enhancers with K562-specific activation (SEQ ID NO: 193) and negative control enhancers (SEQ ID NO: 147) that do not show activation in HepG2 or K562 cells. In addition, synthetic enhancer sequences are designed based on the sampling motif matching of transcription factors selected for specific expression in primary hepatoblasts or bone marrow cells. A synthetic enhancer associated with a transcription factor highly expressed in primary fetal hepatoblasts was selected as a HepG2-specific enhancer (SEQ ID NO: 146), and a synthetic enhancer associated with a transcription factor highly expressed in primary fetal liver bone marrow cells was selected as a K562-specific enhancer (SEQ ID NO: 145) for core promoter screening.

[0305] Each member of the core promoter library was cloned into six different constructs containing each of the five different enhancer sequences identified in the enhancer screen ("HepG2 Syn" (SEQ ID NO: 146), "K562 Syn" (SEQ ID NO: 145), "HepG2 End" (SEQ ID NO: 194), or "K562 End" (SEQ ID NO: 193)), a negative control enhancer ("Negative", SEQ ID NO: 147), or a random sequence with no enhancer activity ("Random"). The resulting constructs generated for each core promoter library member were as follows: Figure 2As shown. In addition to the enhancer and core promoter sequences, each construct includes a random barcode sequence appended during PCR prior to cloning for high-throughput sequence identification, and a reporter gene open reading frame ("reporter ORF") for expression readout. The random barcodes are associated with the enhancer: core promoter constructs through a next-generation sequencing run. The barcode in the 5'UTR of the reporter gene identifies the enhancer: core promoter that drives expression in the reporter gene, because the enhancer: core promoter itself is not transcribed. The library complexity is sufficient to represent each of the 21,849 enhancer-core promoter constructs with a median of 20 redundant barcodes. Library members are first cloned with different enhancers and associated with barcodes respectively, and then the entire library is subcloned into the pGL4 reporter gene backbone.

[0306] The resulting 21,849 enhancer-promoter constructs were screened for cell type-specific transcriptional activation in HepG2 and K562 cell lines. The transcriptional activity of each enhancer-promoter construct was measured in HepG2 and K562 cells using a massively parallel reporter gene molecule assay, as shown in Figure 2. Figure 3 and Fig. 22B (HepG2) and Fig.22A (K562). All 21,849 constructs were introduced into HepG2 and K562 cell lines via transfection. The transcriptional activity of each construct was expressed as the ratio of RNA transcripts per million (tpm) / DNA tpm ("activity") in the amplicon next-generation sequencing library prepared from RNA and DNA harvested from the transfected cells. The activation fold of each core promoter paired with the synthetic HepG2-specific enhancer SEQ ID NO: 146 relative to the core promoter paired with the negative control enhancer SEQ ID NO: 147 ("HepSyn compared to negative") and the activation fold of each core promoter paired with the synthetic K562-specific enhancer SEQ ID NO: 145 relative to the core promoter paired with no enhancer ("KSyn compared to no enhancer") were compared, as shown in Figure 2. Fig.17 The transcriptional activity of each core promoter paired with the synthetic HepG2-specific enhancer SEQ ID NO: 146 ("HepG2 synthetic") or the synthetic K562-specific enhancer SEQ ID NO: 145 ("K562 synthetic") was tested in HepG2 cells. Fig.18 The transcriptional activity of each core promoter in HepG2 cells when paired with the synthetic HepG2-specific enhancer SEQ ID NO: 146 ("HepG2 synthetic") and the transcriptional activity of each core promoter in K562 cells when paired with the synthetic K562-specific enhancer SEQ ID NO: 145 ("K562 synthetic") were compared, as shown in FIG. Fig.23 When the activity of the entire 21,000-member library was compared between different cell lines, a switching behavior was observed, as shown in Fig.24 The transcriptional activity of each core promoter paired with the synthetic HepG2-specific enhancer SEQ ID NO: 146 or the synthetic K562-specific enhancer SEQ ID NO: 145 was compared between HepG2 and K562 cell lines. Fig.24 As shown, 21,849 designs within the MPRA were isolated based on the pairing of the core promoter with either a synthetic HepG2-specific enhancer SEQ ID NO: 146 specific for HepG2 cells or a synthetic K562-specific enhancer SEQ ID NO: 145 specific for K562 cells. When paired with the HepG2-specific enhancer (SEQ ID NO: 146), 3,000 core promoters were more active in HepG2 than in K562. Similarly, when paired with the K562 enhancer (SEQ ID NO: 145), 3,000 core promoters showed higher activity in K562. This Fig.24 The core promoter paired with a negative control enhancer (such as a random enhancer sequence) appears in the Fig.24 In the cluster in the lower left part of the middle figure, this shows that the core promoter paired with the inactive enhancer has low transcriptional activity in both cell lines. In summary, the synthetic (SEQ ID NO: 146) or endogenous (SEQ ID NO: 194) HepG2-specific enhancer promotes higher levels of transcription compared to the corresponding synthetic (SEQ ID NO: 145) or endogenous (SEQID NO: 193) K562-specific enhancer, and the synthetic enhancer promotes higher levels of transcription compared to the endogenous enhancer. The background transcription levels of the negative control enhancer and the random sequence without enhancer activity ("Random") were observed. The MPRA screening was performed in six replicates, and the activity levels were well correlated between the first replicate ("Rep 1") and the second replicate ("Rep 2"), as shown in Figure 1. Figure 4 shown.

[0307] Prior to MPRA screening, flow cytometry was also performed on HepG2 cells (eg Figure 5A as shown) or K562 cells (as Figure 5DThe expression of fluorescent markers from dual reporter constructs was orthogonally measured to verify the activity of the selected enhancer. The dual reporter construct comprises an enhancer / core promoter operably connected to a sequence encoding mCherry and a CMV promoter operably connected to a sequence encoding GFP. YbTATA was inserted into the dual reporter construct ("ybTATA only") alone, or paired with a negative control enhancer (SEQ ID NO: 147), a synthetic K562 specific enhancer (SEQ ID NO: 145), an endogenous K562 specific enhancer (SEQ ID NO: 193), a synthetic HepG2 specific enhancer (SEQ ID NO: 146) or an endogenous HepG2 specific enhancer (SEQ ID NO: 194), the transcriptional activity of the core promoter was assessed. Wild-type cells ("WT") without plasmids were used as negative controls. Under the transcriptional control of the enhancer-promoter construct, transcriptional activity was measured as a function of the fluorescence from mCherry. Figure 5B and Figure 5C The mean fold change in geometric mean fluorescence intensity (gMFI) for each enhancer used in the dual reporter flow assay in HepG2 cells and K562 cells is presented separately. The measurements of enhancer activity were well agreed between the MPRA screen and the dual reporter flow assay, but MPRA was found to be more sensitive to small differences in activity levels.

[0308] Cell-specific activation of 3,649 core promoters in HepG2 cells was assessed by comparing the transcriptional activity of each core promoter relative to a negative control enhancer or no enhancer when paired with a HepG2-specific enhancer (HepEndo or HepSyn) or a K562-specific enhancer (KEndo or KSyn). Figure 6 Fold activation in HepG2 cells with different synthetic enhancers (KSyn or HepSyn) relative to no enhancer or negative control enhancer is shown. Figure 6 As shown, the fold activation of each core promoter correlated well between the synthetic K562-specific enhancer and the synthetic HepG2-specific enhancer, but the overall activation of the HepG2-specific enhancer was higher.

[0309] To further validate the MPRA screen, the core promoter activity of core promoters with different random sequences inserted into the gap between the TATA and Inr sequences of the core promoter were compared. Figure 7It was shown that the transcriptional activity of 1484 fully synthetic core promoters from the two libraries was similar regardless of which spacer sequence was used ("background 1" with the sequence of SEQ ID NO: 208 or "background 2" with the sequence of SEQ ID NO: 209). These results indicate that the sequence of the spacer between TATA and Inr does not affect the core promoter activity, suggesting that any sequence with an appropriate spacing between TATA and Inr can be used. In addition, as Figure 8 The core promoter responds similarly to the differently active enhancers, as shown by the correlation between the activities of the constructs with the HepG2 synthetic enhancer and the constructs with the K562 synthetic enhancer.

[0310] The members of the core promoter library were evaluated based on the activation level in HepG2 cells when paired with a HepG2-specific enhancer (core promoter strength) and the relative activation level when paired with a HepG2-specific enhancer compared to when paired with no enhancer, a negative control enhancer, or a different cell type-specific enhancer (core promoter dynamic range). SEQ ID NO: 1–SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 10–SEQ ID NO: 14, and SEQ ID NO: 16–SEQ ID NO: 144 were identified as top core promoter candidates in the MPRA screen based on strength and dynamic range. The core promoters of SEQ ID NO: 1–SEQ ID NO: 3, SEQ ID NO: 7, and SEQ ID NO: 10–SEQ ID NO: 14 were selected for further evaluation. The switchable core promoter candidates retain the ability to act as a switch with a wide dynamic range in different enhancers and different cell lines. When paired with SEQ ID NO: 145, the switchable core promoter will show low activity in HepG2 cells but high activity in K562 cells, and when paired with SEQ ID NO: 146, it will show high activity in HepG2 cells but low activity in K562 cells.

[0311] Example 2: Specific activation of the core promoter

[0312] This example describes specific transcriptional activation by the core promoters identified in the MPRA screen described in Example 1. Specific activation of the core promoters was determined by comparing the transcriptional activation of each core promoter when paired with an active, cell type-specific enhancer relative to the transcriptional activation when paired with an inactive enhancer (SEQ ID NO: 147; GCCACTGCACTCCGTGCTGGGCAACTGAGTGAGACCCCATCTCAAAAAACTCAAAAAAGAGTTAAAATAAATCACTGTCTATTGTGCCAAAGAGCTGTTGAAGTCATCATTCTTAGAAGAATAGACAGATGGTATTTCAAGGCTT) or a random sequence with no enhancer activity (SEQ ID NO: 195; AAAACGACGGCCAGTGAATTGACGCGTATTGGGATGGAACGGCCTCCACGGCCACTAGT).The active enhancer was selected from a synthetic K562 cell type specific enhancer (SEQ ID NO: 145; TGCTATTTTTAGCGGGCTTTTTTTGACGGGAGGAAGGAAGGAGGGAGAGGGACGGGAAGTAAAGAGAAAAAGAGGAAGTGAAAGCTAAGAAGGAAGTGACGGCTGGCGGGGACAGATAAGAGTTGTCTAGTTGTGATAATGGAACTGCTGAGTCATGGATTGCAGAGTCAC), a synthetic HepG2 cell type specific enhancer (SEQ ID NO: 146; GGTTAATGATTAACCGTGTAAATAATTAGCGGATCACGTGATGGTCACGTGTTGGTTCAAGGCCAGAGTCAAGGTCGGGAGTCCAAAGTCCAGAAGTGCAAGGTCCGGTGTTTACTTTGGGTGTTTACCTTCC), an endogenous K562 cell type specific enhancer (SEQ ID NO: 147; NO: 193; GGTTAATGATTAACCGTGTAAATAATTAGCGGATCACGTGATGGTCACGTGTTGGTTCAAGGCCAGAGTCAAGGTCGGGAGTCCAAAGTCCAGAAGTGCAAGGTCCGGTGTTTACTTTGGGTGTTTACCTTCC) or endogenous HepG2 cell type-specific enhancer (SEQ ID NO: 194; AGAAACACGGCACAGATGACGGCTTTAAAAGAAAAGAGTCCATTGACTGGAAAAGCAAACAGTATGATGGTCAAAGGCCAAGAATCAGAAAACAGAGATTTTTCCTCTTCTCTTGTTTCACAAAGTAAATAAACATGAGACATAT).

[0313] The core promoter expression construct was generated by splicing an enhancer (e.g., any one of SEQ ID NO: 145-SEQ ID NO: 147, SEQ ID NO: 193, SEQ ID NO: 194, or a random sequence without enhancer activity) and a core promoter (e.g., any one of SEQ ID NO: 1-SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 10-SEQ ID NO: 13, and SEQ ID NO: 16-SEQ ID NO: 144) together such that the construct sequence from 5' to 3' contained the enhancer followed by the core promoter. The transcriptional activation of each enhancer / promoter construct was measured in HepG2 cells, and the activation fold was determined by measuring the transcriptional activation when paired with an active enhancer divided by the transcriptional activation when paired with an inactive enhancer or no enhancer.

[0314] The fold activation of selected core promoters (SEQ ID NO: 1 - SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 10 - SEQ ID NO: 13, and SEQ ID NO: 16 - SEQ ID NO: 144) identified from the MPRA screen are provided in Table 6.

[0315] Table 6 - Activation folds of selected core promoters

[0316]

[0317]

[0318]

[0319]

[0320]

[0321] As shown in Table 6, the transcriptional activation fold of the HepG2 cell type-specific enhancer in HepG2 cells was higher than that of the K562 cell type-specific enhancer in HepG2 cells, indicating that the identified core promoter selectively initiates transcription in the presence of enhancers specific to a given cell type, while showing low transcriptional activation in the presence of other cell type-specific enhancers.

[0322] Example 3: Further analysis of core promoter-specific activation

[0323] This example describes further analysis of core promoter-specific transcriptional activation identified using the MPRA screening method described in Example 1.

[0324] Specific activation of the selected core promoters (SEQ ID NO: 1-SEQ ID NO: 15) was determined by comparing the transcriptional activation of each core promoter when paired with an active, cell type-specific enhancer relative to the transcriptional activation when paired with an inactive enhancer (SEQ ID NO: 147) or no enhancer (SEQ ID NO: 195). The active enhancers were selected from a synthetic K562 cell type-specific enhancer (SEQ ID NO: 145), a synthetic HepG2 cell type-specific enhancer (SEQ ID NO: 146), an endogenous K562 cell type-specific enhancer (SEQ ID NO: 193), or an endogenous HepG2 cell type-specific enhancer (SEQ ID NO: 194). The core promoter of SEQ ID NO: 8 (GGGTACGCCCCTTTTTATGCGCGTGATTACTGCACAGGAATTGG) was included as a negative control, which corresponds to a core promoter that exhibits low transcriptional activation.

[0325] The core promoter expression construct was generated by splicing an enhancer (e.g., any one of SEQ ID NO: 145-SEQ ID NO: 147, SEQ ID NO: 193, SEQ ID NO: 194, or a random sequence without enhancer activity) and a core promoter (e.g., any one of SEQ ID NO: 1-SEQ ID NO: 15) together such that the construct sequence included the enhancer from 5' to 3', followed by the core promoter. The selected enhancer + core promoter sequences determined are provided in Table 7.

[0326] Table 7 - Enhancer / promoter sequences determined

[0327]

[0328]

[0329]

[0330]

[0331]

[0332]

[0333]

[0334]

[0335]

[0336]

[0337] Transcriptional activation of each enhancer / promoter construct was measured in HepG2 cells and fold activation was determined by measuring the transcriptional activation when paired with an active enhancer divided by the transcriptional activation when paired with an inactive enhancer or a random sequence with no enhancer activity (no enhancer).

[0338] The activation folds of selected core promoters (SEQ ID NO: 1 - SEQ ID NO: 15) are provided in Table 8.

[0339] Table 8 - Activation folds of selected core promoters

[0340]

[0341] As shown in Table 8, the transcriptional activation fold of the HepG2 cell type-specific enhancer in HepG2 cells was higher than that of the K562 cell type-specific enhancer in HepG2 cells, indicating that the identified core promoter selectively initiates transcription in the presence of enhancers specific to a given cell type, while showing low transcriptional activation in the presence of other cell type-specific enhancers.

[0342] Example 4: Effect of the distance between TATA and Inr on transcriptional activation

[0343] This embodiment describes the effect of the spacing between TATA and Inr in the core promoter on transcriptional activation. Compare the transcriptional activation of the core promoter with a short spacing (corresponding to the deletion of two bases between TATA and Inr) or a longer spacing (corresponding to the standard 30 nucleotide spacing from TATA to Inr), wherein the number of nucleotide residues from the TATA box to the starter element is counted from the first T in the TATA box to the CAG in the starter element (or if the starter element is mutated, it is the corresponding CAG in the parent sequence) A, including the end value. Examples of core promoters with short 28 nucleotide spacing include SEQ ID NO: 7, SEQ ID NO: 10 and SEQ ID NO: 109-SEQ ID NO: 125. Examples of core promoters with standard 30 nucleotide spacing include SEQ ID NO: 13 and SEQ ID NO: 126-SEQ ID NO: 144.

[0344] The activity of the core promoter with a short spacing of 28 nucleotides or with a standard spacing of 30 nucleotides was compared when paired with a synthetic HepG2 cell type specific enhancer (SEQ ID NO: 146) in HepG2 cells. Fig. 9AWhen paired with the enhancer of SEQ ID NO: 146, although no single spacing increased transcriptional activation of all core promoters, the shorter spacing increased transcriptional activation of SEQ ID NO: 7 including a spacing of 28 nucleotides relative to SEQ ID NO: 141 including a standard spacing of 30 nucleotides, as shown in FIG. Fig. 9B Among the most redundant barcodes, SEQ ID NO: 7 showed higher transcriptional activation than SEQ ID NO: 141, suggesting that the shorter spacing increased the transcriptional activation of this core promoter.

[0345] Example 5: Effect of Pause Sites on Transcriptional Activation

[0346] This embodiment describes the effect of the pause site in the core promoter on transcriptional activation. The transcriptional activity and activation fold of the core promoter with and without the transcription pause site were compared. Ten different transcription pause sites were tested in the case of 20 different core promoters. Examples of core promoter sequences with pause sites include SEQ ID NO: 1, SEQ ID NO: 11, and SEQ ID NO: 16-SEQ ID NO: 21. Examples of pause site sequences include SEQ ID NO: 196-SEQ ID NO: 198, SEQ ID NO: 211, or SEQ ID NO: 212. Examples of core promoter sequences without pause sites include SEQ ID NO: 13 and SEQ ID NO: 126-SEQ ID NO: 144.

[0347] Fig. 10A and Fig. 10B The activity of the core promoter with or without a pause site (“founder combination”) is shown ( Fig. 10A ) and activation multiple ( Fig. 10B ). Transcriptional activity in HepG2 cells when paired with a synthetic HepG2 enhancer (SEQ ID NO: 146) was measured using MPRA screening. The activation fold of each core promoter with a transcriptional pause site ("with a pause site") relative to the corresponding core promoter without a transcriptional pause site ("founding combination") was measured in HepG2 cells using MPRA screening. Sequences with the same pause site sequence as SEQ ID NO: 196 are indicated with red circles. Fig. 10A and Fig. 10BAs shown, there is a high correlation between activity and fold activation between sequences with and without pause sites. In addition, sequences containing pause sites of SEQ ID NO: 196-SEQ ID NO: 198, SEQ ID NO: 211 or SEQ ID NO: 212 consistently show increased activity relative to corresponding sequences lacking a pause site. Overall, these data suggest that pause sites do not increase activity or activation overall.

[0348] Example 6: Effect of the YY1 motif on transcriptional activation

[0349] This example describes the effect of the YY1 transcription factor motif in the core promoter on transcriptional activation. The transcriptional activity of the core promoter with and without the YY1 motif after transfection into HepG2 cells was compared. Examples of core promoter sequences with the YY1 motif include SEQ ID NO: 2, SEQ ID NO: 12, and SEQ ID NO: 31-SEQ ID NO: 68. Examples of the YY1 transcription factor motif include SEQ ID NO: 205-SEQ ID NO: 208.

[0350] Similarly, the YY1 motif immediately downstream of Inr in the core promoter sequence is associated with active promoters. To test the effect of the YY1 motif on cell type-specific activation, the transcriptional activity of 288 fully synthetic promoters with the YY1 motif was compared with that of the core promoter lacking the YY1 motif after transfection into HepG2 cells. Fig.11A As shown in Figure 1, the core promoter with the YY1 motif exhibited higher transcriptional activity in HepG2 cells than the sequence without the YY1 motif when paired with the K562 synthetic enhancer (SEQ ID NO: 145), but not when paired with the HepG2 synthetic enhancer (SEQ ID NO: 146). This was confirmed by the following: the sequence with the YY1 motif (in Fig.11A The transcriptional activity of the core promoter with or without the YY1 motif when paired with the HepG2 synthetic enhancer (SEQ ID NO: 146) or the K562 synthetic enhancer (SEQ ID NO: 145) is shown in Figure 2. Fig. 11C and Fig.11D The data show that the YY1 motif confers enhancer specificity to the core promoter. In addition, the YY1 motif increases overall activity, especially when paired with the K562 synthetic enhancer (SEQ ID NO: 145), such as Fig.11D shown.

[0351] In addition, if Fig. 11BAs shown, the core promoter with the YY1 motif exhibited higher background in HepG2 cells relative to sequences without the YY1 motif. This was confirmed by the following: when paired with an inactive enhancer (SEQ ID NO: 146, "negative control") or an endogenous enhancer of a different cell type (SEQ ID NO: 193), compared to the core promoter lacking the YY1 motif, Fig. 11B The sequences with the YY1 motif indicated by red circles in the Figure 2 show higher basal transcriptional activity. Together, these data suggest that the core promoter with the YY1 motif provides more enhancer-specific transcriptional activation and has higher overall transcriptional activity compared to the core promoter without the YY1 motif, despite having an elevated background activity.

[0352] Example 7: Transcriptional Activation of ybTATA and minP Variants

[0353] This example describes the transcriptional activation of ybTATA and minP variants, including variations in the TATA sequence and the Inr sequence. The transcriptional activity of core promoters with TATA sequence variations after transfection into HepG2 cells was compared. Variants of the ybTATA founder sequence (SEQ ID NO:9) and the minP founder sequence (SEQ ID NO:5) were paired with a synthetic HepG2 enhancer (SEQ ID NO:146) screened for transcriptional activation in HepG2. The transcriptional activity of the ybTATA variants and the minP variants were respectively as shown in FIG. Fig. 12A and Fig. 12B The effect of each nucleotide substitution A (green circle), T (red circle), C (blue circle) or G (orange circle) at each position within the core promoter sequence on transcriptional activity was compared with the corresponding founder sequence (SEQ ID NO: 9 or SEQ ID NO: 5, dotted line). Fig. 12A and Fig. 12B As shown, substitutions at positions 7 and 8 of the TATA sequence (corresponding to positions 16 and 17 of ybTATA and positions 14 and 15 of minP) increased transcriptional activation. Fig.13A The relative transcriptional activity of the TATA sequence with each possible nucleotide substitution is illustrated. Substitution in position 4 of Inr (corresponding to position 40 of minP) increases transcriptional activity. Fig. 13B The relative transcriptional activity of the Inr sequences with each possible nucleotide substitution is illustrated. Fig. 13C The relative transcriptional activity of the YY1 motif sequence with each possible nucleotide substitution is illustrated. Fig.13D The relative transcriptional activity of the HNF4α motif sequence with each possible nucleotide substitution is illustrated.

[0354] Double mutants were screened in the context of the minP founder sequence (SEQ ID NO: 5), such as Fig.14A and Fig. 14B The activity of the double-point mutant of minP (SEQ ID NO: 5) was measured in HepG2 cells when paired with the synthetic HepG2-specific enhancer SEQ ID NO: 146 ( Fig.14A ), or when paired with the synthetic K562-specific enhancer SEQ ID NO: 145, the activity of the double point mutant was measured in K562 cells ( Fig. 14B ). The lighter the shading, the higher the transcriptional activity. Some double mutants with elevated transcriptional activation also showed an increase in background activation. The double mutant sequence containing the substitutions T15G and A40C (SEQ ID NO: 15) showed the greatest increase in the transcriptional dynamic range. The effects of the double mutations on transcriptional activation were consistent with different enhancers.

[0355] Example 8: Characterization of candidate switchable core promoters

[0356] This example describes the characterization of candidate switchable core promoters identified using the assays described in Examples 1-8. Candidate switchable core promoters (corresponding to SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, and SEQ ID NO: 10-SEQ ID NO: 15) were selected based on high transcriptional activation activity and low background transcriptional activity (corresponding to high fold activation).

[0357] SEQ ID NO: 1, SEQ ID NO: 11 and SEQ ID NO: 14 include a pause site; SEQ ID NO: 2 and SEQ ID NO: 12 include a YY1 motif; SEQ ID NO: 3 includes a long gap between TATA and Inr; SEQ ID NO: 4 includes T15A and A40T substitutions relative to minP (SEQ ID NO: 5); SEQ ID NO: 6 (GTACTTATATAAGGGGGTGGGGGCGCGTTCGTCCTCAGTCGCGATCGAACACTCGAGCCGAGCAGACGTGCCTACGGACCG) shows high transcriptional activation but also shows high background; SEQ ID NO: 7 and SEQ ID NO: 10 include a short gap between TATA and Inr; SEQ ID NO: 13 is a fully synthetic promoter with strong transcriptional activation; and SEQ ID NO: 15 includes T15G and A40C substitutions relative to minP. SEQ ID NO: 8 shows low transcriptional activation and is included as a negative control. SEQ ID NO: 5 (minP) and SEQ ID NO: 9 (ybTATA) were included for comparison.

[0358] The transcriptional activation properties of SEQ ID NO: 1 - SEQ ID NO: 4, SEQ ID NO: 7, and SEQ ID NO: 10 - SEQ ID NO: 15 were evaluated in HepG2 cells. Fig.15A Shown is the transcriptional activity of the screened core promoter paired with either the synthetic K562 enhancer (SEQ ID NO: 145) or the synthetic HepG2 enhancer (SEQ ID NO: 146). Fig. 15B Fold activation of the screened core promoters with synthetic K562 enhancer (SEQ ID NO: 145) relative to no enhancer or with synthetic HepG2 enhancer (SEQ ID NO: 146) relative to an inactive enhancer (SEQ ID NO: 147, "negative") is shown. The core promoters ybTATA (SEQ ID NO: 9) and minP (SEQ ID NO: 5) were Fig.15A and Fig. 15B Shown as an orange circle.

[0359] The core promoter of SEQ ID NO:7 was identified as having high transcriptional activation and high dynamic range. Fig.16AAs shown, SEQ ID NO:7 showed high transcriptional activation in HepG2 cells when paired with a synthetic HepG2 enhancer (SEQ ID NO:146). The activation of SEQ ID NO:7 was comparable to that of the highly active SEQ ID NO:6 and was higher than that of SEQ ID NO:5 (minP) or SEQ ID NO:9 (ybTATA). Fig. 16B As shown, SEQ ID NO: 7 exhibits low background transcription when paired with an inactive enhancer (SEQ ID NO: 147). The background activation of SEQ ID NO: 7 is lower than any of SEQ ID NO: 6, SEQ ID NO: 5 or SEQ ID NO: 9. Fig.16A and Fig. 16B The violin plots in show the redundant barcodes for each enhancer / promoter construct. Together, these data suggest that the core promoter of SEQ ID NO: 7 functions as a switchable core promoter that promotes high levels of transcription in that cell type when paired with a cell type-specific enhancer, and exhibits low background transcription when paired with a different cell type-specific enhancer in the cell type of the previous cell type-specific enhancer, or when the enhancer is absent in the cell type of the previous cell type-specific enhancer.

[0360] Example 9: Verification of core promoter activity

[0361] This example describes the validation of several core promoters in K562 lymphoblastoid and HepG2 hepatoma cell lines using a K562-specific enhancer or a HepG2-specific enhancer ("HSyn"). The core promoters screened include SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15. The core promoters were each cloned into a construct containing a synthetic K562-specific enhancer or a synthetic HepG2-specific enhancer, and the transcriptional activity of the constructs was tested. The core promoter activity was determined using the MPRA screening described in Example 1 and using a dual reporter quantitative PCR (qPCR) assay (as the dual reporter flow assay described in Example 1, except that qPCR was used instead of MFI for readout)

[0362] Fig. 20AShown is a comparison of promoter activity of promoters with K562-specific enhancers determined by MPRA screening ("Screening activity") and by dual reporter qPCR assay ("qPCR activity") in HepG2 cells. Fig. 20B Shown is a comparison of promoter activities of promoters with HepG2-specific enhancers determined by MPRA screening ("Screening activity") and by dual reporter qPCR assay ("qPCR activity") in HepG2 cells. Fig. 20C Comparison of promoter activity of promoters with K562-specific enhancers as determined by MPRA screening ("Screening Activity, K562") and by dual reporter qPCR assay ("qPCR Activity") in K562 cells is shown. Variants of the minP core promoter, including SEQ ID NO:4 and SEQ ID NO:15, performed well in both cell lines, showing increased expression when paired with enhancers of the corresponding cell types. When paired with enhancers of the corresponding cell types, SEQ ID NO:4 and SEQ ID NO:15 showed approximately 3-fold the activity of the core promoter of SEQ ID NO:9. The core promoter of SEQ ID NO:7 also performed well in K562 cells when paired with a K562-specific enhancer.

[0363] Example 10: Enhanced activity of the minP variant core promoter

[0364] This example describes the activity of the minP variant core promoter relative to the ybTATA core promoter in H4 glioma and HepG2 liver cancer cell lines. The minP variant core promoter (SEQ ID NO: 4, "minP_T14A_A39T") and the ybTATA core promoter (SEQ ID NO: 9) were each cloned into three constructs containing two different H4-specific enhancers ("H4-specific enhancer 1" and "H4-specific enhancer 2") or one of the liver-specific enhancers. The activity of the core promoter in H4 and HepG2 cell lines was measured by a dual reporter gene assay that measured activity. Fig.21A A comparison of the transcriptional activity of the minP variant of SEQ ID NO: 4 ("minP activity") and the ybTATA promoter of SEQ ID NO: 9 ("yb_TATA activity") in H4 cells when paired with an H4-specific enhancer or a liver-specific enhancer is shown. Fig.21A As shown, the minP variant core promoter of SEQ ID NO: 4 exhibited enhanced activity compared to the ybTATA core promoter when paired with the H4-specific enhancer in the H4 cell line. Fig.21BA comparison of the transcriptional activity of th...

Claims

1. An engineered core promoter, wherein the engineered core promoter comprises a sequence having at least 80% sequence identity to SEQ ID NO:4 and comprising nucleotide substitutions T15G and A40T relative to SEQ ID NO:

5.

2. The engineered core promoter of claim 1, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO:4 and including the nucleotide substitutions T15G and A40T relative to SEQ ID NO:

5.

3. The engineered core promoter of claim 1 or claim 2, wherein the engineered core promoter comprises the sequence of SEQ ID NO:

4.

4. The engineered core promoter of any one of claims 1 to 3, wherein the engineered core promoter further comprises a transcription pause site.

5. The engineered core promoter of claim 4, wherein the transcription pause site comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 196 - SEQ ID NO: 198, SEQ ID NO: 211 or SEQ ID NO:

212.

6. The engineered core promoter of claim 4 or claim 5, wherein the transcription pause site comprises the sequence of any one of SEQ ID NO: 196 - SEQ ID NO: 198, SEQ ID NO: 211 or SEQ ID NO:

212.

7. The engineered core promoter of any one of claims 1 to 6, wherein the engineered core promoter further comprises a YY1 motif.

8. The engineered core promoter of claim 7, wherein the YY1 motif comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 205 - SEQ ID NO:

207.

9. The engineered core promoter of claim 7 or claim 8, wherein the YY1 motif comprises a sequence having the sequence of any one of SEQ ID NO: 205 - SEQ ID NO:

207.

10. The engineered core promoter of any one of claims 1 to 9, wherein the engineered core promoter comprises a spacer region of 30 to 34 nucleotides.

11. The engineered core promoter of any one of claims 1 to 10, wherein the engineered core promoter paired with an activated response element produces a transcriptional activity that is higher than the transcriptional activity produced when the core promoter of SEQ ID NO: 6 is paired with the activated response element, the engineered core promoter paired with an activated response element produces a basal transcriptional activity that is lower than the basal transcriptional activity produced when the core promoter of SEQ ID NO: 6 is paired with an inactive response element, or both.

12. The engineered core promoter of any one of claims 1 to 11, wherein the engineered core promoter paired with an activated response element produces a transcriptional activity that is higher than the transcriptional activity produced when the core promoter of SEQ ID NO: 9 is paired with the activated response element, the engineered core promoter paired with an activated response element produces a basal transcriptional activity that is lower than the basal transcriptional activity produced when the core promoter of SEQ ID NO: 9 is paired with an inactive response element, or both.

13. An engineered promoter comprising a response element and the engineered core promoter of any one of claims 1 to 12.

14. The engineered promoter of claim 13, wherein the response element confers bone marrow-specific transcription, liver-specific transcription, neuron-specific transcription, muscle-specific transcription, or kidney-specific transcription of a payload under the transcriptional control of the engineered promoter.

15. The engineered promoter of claim 13 or claim 14, wherein the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193 or SEQ ID NO:

194.

16. The engineered promoter of any one of claims 13 to 15, wherein the response element comprises the sequence of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193 or SEQ ID NO:

194.

17. A recombinant polynucleotide comprising an engineered core promoter as described in any one of claims 1 to 12 or an engineered promoter as described in any one of claims 13 to 16 and a payload comprising a coding sequence under the transcriptional control of the engineered core promoter.

18. The recombinant polynucleotide of claim 17, wherein the payload encodes a protein.

19. The recombinant polynucleotide of claim 18, wherein the protein is a neuronal protein, a kidney protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein.

20. The recombinant polynucleotide of claim 18 or claim 19, wherein the protein is associated with a genetic disorder, a neuronal disorder, a renal disorder, an eye disorder, a muscle disorder, or cancer.

21. The recombinant polynucleotide of any one of claims 18 to 20, wherein the protein is progranulin, MeCP2, polycystin-1 or polycystin-2.

22. The recombinant polynucleotide of claim 17, wherein the payload encodes a therapeutic polynucleotide.

23. The recombinant polynucleotide of claim 22, wherein the therapeutic polynucleotide is a guide RNA or a suppressor tRNA.

24. The recombinant polynucleotide of claim 22 or claim 23, wherein the therapeutic polynucleotide targets a gene.

25. The recombinant polynucleotide of claim 24, wherein the gene is associated with a genetic disorder, a neuronal disorder, a kidney disorder, an eye disorder, a muscle disorder, or cancer.

26. The recombinant polynucleotide of claim 24 or claim 25, wherein the gene is GRN, MECP2, PKD2 or PKD2.

27. An engineered viral vector comprising an engineered core promoter as described in any one of claims 1 to 12, an engineered promoter as described in any one of claims 13 to 16, or a recombinant polynucleotide as described in any one of claims 17 to 26 in the viral vector.

28. The engineered viral vector of claim 27, wherein the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector.

29. The engineered viral vector of claim 28, wherein the adeno-associated viral vector is selected from the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10. AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, A AV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.V1, AAV.PHP.B, AAV. PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AA V.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68 and their combinations.

30. A pharmaceutical composition comprising an engineered core promoter as described in any one of claims 1 to 12, an engineered promoter as described in any one of claims 13 to 16, a recombinant polynucleotide as described in any one of claims 17 to 26, or a viral vector as described in any one of claims 27 to 29, and a pharmaceutically acceptable carrier.

31. A method of treating a condition in a subject in need thereof, the method comprising: administering to the subject a composition comprising the recombinant polynucleotide of any one of claims 17 to 26, the viral vector of any one of claims 27 to 29, or the pharmaceutical composition of claim 30; as well as The therapeutic sequence encoded by the recombinant polynucleotide payload is expressed in target cells of the subject, thereby treating the disorder.

32. The method of claim 31, wherein the target cell is a cell type or cell state associated with the disorder.

33. The method of claim 31 or claim 32, wherein the disorder is a genetic disorder, a neuronal disorder, a kidney disorder, an eye disorder, a muscle disorder, or cancer.

34. The method of any one of claims 31 to 33, wherein the disorder is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuronal ceroid lipofuscinosis, cancer, atherosclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, limbic-predominant age-related TDP-43 encephalopathy, or polycystic kidney disease.

35. The method of any one of claims 31 to 34, wherein the therapeutic sequence encodes a therapeutic protein.

36. The method of claim 35, wherein the therapeutic protein is a neuronal protein, a kidney protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein.

37. The method of claim 35 or claim 36, wherein the therapeutic protein is associated with a genetic disorder, a neuronal disorder, a renal disorder, an ocular disorder, a muscle disorder, or cancer.

38. The method of any one of claims 35 to 37, wherein the therapeutic protein is MECP2, progranulin, polycystin-1, or polycystin-2.

39. The method of any one of claims 31 to 34, wherein the payload encodes a therapeutic polynucleotide.

40. The method of claim 39, wherein the therapeutic polynucleotide is a guide RNA or a suppressor tRNA.

41. A method for identifying a switchable core promoter, the method comprising: introducing a core promoter library comprising the first sub-library and the second sub-library into a cell population; wherein the first sub-library comprises a plurality of core promoters, wherein a core promoter in the plurality of core promoters is linked to a first response element, and a unique barcode sequence; wherein the second sub-library comprises the plurality of core promoters, wherein a core promoter in the plurality of promoters is linked to a second response element, and a unique barcode sequence; as well as A switchable core promoter is identified as a core promoter that promotes higher transcription of the unique barcode when paired with the first response element than when paired with the second response element.

42. The method of claim 41, further comprising activating the first response element.

43. The method of claim 41 or claim 42, wherein the second response element is not activated.

44. The method of any one of claims 41 to 43, wherein the first response element is an activated response element and the second enhancer sequence is an inactive response element or a non-activated response element.

Images