Engineering bacterium for producing phenazine-1-carboxylic acid and phenazine-1-formamide under temperature control as well as construction method and application of engineering bacterium

Through the method of gene replacement and control of expression vectors, an engineered bacteria that can efficiently produce phenazine-1-carboxylic acid and phenazine-1-formamide respectively at different temperatures was constructed, which solved the problem that the prior art could not produce these two substances at the same time, achieved efficient production and maintained the growth performance of the strain.

CN120137869APending Publication Date: 2025-06-13QILU UNIVERSITY OF TECHNOLOGY (SHANDONG ACADEMY OF SCIENCES)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510298864.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-13
Publication Date
2025-06-13

AI Technical Summary

Technical Problem

The prior art cannot simultaneously controllable production of phenazine-1-carboxylic acid and phenazine-1-formamide, and lacks an engineered bacteria that can produce both substances at the same time.

Method used

By replacing the phzO gene in the genome of Pseudomonas chlororophis Qlu-1 with the tktA gene, the pykF gene is replaced with the ppsA gene, and introducing a control expression vector, the temperature control of the expression of the phzH gene is achieved, thereby regulating the production of phenazine-1-carboxylic acid and phenazine-1-formamide.

Benefits of technology

It is achieved that the engineered bacteria can produce phenazine-1-carboxylic acid and phenazine-1-formamide efficiently under different temperature conditions without affecting the growth performance of the strain.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120137869A_ABST
    Figure CN120137869A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of bioengineering, in particular to an engineering bacterium for producing phenazine-1-carboxylic acid and phenazine-1-formamide through temperature control as well as a construction method and application of the engineering bacterium, expression of a phzH gene is controlled through temperature, and then production of the phenazine-1-carboxylic acid and the phenazine-1-formamide is regulated and controlled; specifically, the repressor protein cI857 generated by the temperature-sensitive repressor protein cI857 gene at 30-32 DEG C can prevent the transcription initiation of promoters pR and pL, so that the phzH gene is not expressed, and at the moment, the engineering bacterium can only produce phenazine-1-carboxylic acid; when the temperature is adjusted to 42 DEG C or above, the repressor protein cI857 is subjected to conformational change and inactivated, the promoters pR and pL start, the phzH gene is expressed, and at the moment, the engineering bacterium only produces phenazine-1-formamide.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and particularly relates to an engineered bacterium for temperature-controlled production of phenazine-1-carboxylic acid and phenazine-1-carboxamide, and a construction method and application thereof. Background Art

[0002] Disclosing the information of this background art section is only intended to enhance the understanding of the overall background of the present invention, and it is not necessarily regarded as an admission or an indication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] Chemically synthesized insecticides are widely used to prevent diseases and pest damage. However, due to environmental and mammalian safety issues, the increasing use of agrochemicals has become a global concern and has been widely criticized. Minimizing the use of chemical pesticides and finding alternative methods are the future development directions of pesticides. Biogenic pesticides have become one of the focuses of attention due to their high efficiency and high environmental compatibility.

[0004] Phenazine substances are nitrogen-containing heterocyclic compounds and are a class of bioactive substances secreted by microorganisms such as Pseudomonas and Streptomyces. They play an important role in the interaction between strains and other organisms. Currently, phenazine-1-carboxylic acid (PCA) has been widely used due to its good effect in crop disease control. As a derivative of phenazine-1-carboxylic acid, phenazine-1-carboxamide also has good control effects on some crop diseases, such as wheat head blight, wheat take-all, rice sheath blight, pepper blight, etc. Therefore, phenazine-1-carboxamide is a potential candidate for a new type of biopesticide.

[0005] Currently, the engineered bacteria for producing phenazine substances can only produce phenazine-1-carboxylic acid or phenazine-1-carboxamide alone, and cannot produce these two phenazine substances controllably at the same time. Summary of the Invention

[0006] In order to overcome the above problems, the present invention provides an engineered bacterium for temperature-controlled production of phenazine-1-carboxylic acid and phenazine-1-carboxamide, and a construction method and application thereof.

[0007] To achieve the above technical objectives, the present invention adopts the following technical solutions:

[0008] In the first aspect of the present invention, there is provided an engineered bacterium for temperature-controlled production of phenazine-1-carboxylic acid and phenazine-1-carboxamide, which uses Pseudomonas chlororaphis Qlu-1 as the starting bacterium, replaces the phzO gene in its genome with the tktA gene, and replaces the pykF gene with the ppsA gene; and a control expression vector is introduced;

[0009] The control expression vector is a recombinant expression vector obtained by inserting the phzH gene into the starting expression vector;

[0010] The starting expression vector includes: promoter pR, promoter pL, and the temperature-sensitive repressor protein cI857 gene;

[0011] The expression of the phzH gene is controlled by promoters pR and pL; promoters pR and pL are regulated by the temperature-sensitive repressor protein cI857.

[0012] Among them, the Pseudomonas chlororaphis Qlu-1 is the Pseudomonas chlororaphis Qlu-1 described in Chinese Patent CN112111440A.

[0013] In the second aspect of the present invention, there is provided a method for constructing an engineered bacterium for temperature-controlled production of phenazine-1-carboxylic acid and phenazine-1-carboxamide as described in the first aspect, including the following steps:

[0014] Using Pseudomonas chlororaphis Qlu-1 as the starting bacterium, replacing the phzO gene in its genome with the tktA gene and the pykF gene with the ppsA gene; and introducing the control expression vector.

[0015] In the third aspect of the present invention, there is provided the application of the engineered bacterium for temperature-controlled production of phenazine-1-carboxylic acid and phenazine-1-carboxamide as described in the first aspect in the production of phenazine-1-carboxylic acid and phenazine-1-carboxamide.

[0016] In the fourth aspect of the present invention, there is provided a method for temperature-controlled production of phenazine-1-carboxylic acid and phenazine-1-carboxamide, including:

[0017] Inoculating the engineered bacterium for temperature-controlled production of phenazine-1-carboxylic acid and phenazine-1-carboxamide into a fermentation medium for cultivation. When the fermentation temperature is between 30 and 32 °C, the engineered bacterium ferments to produce phenazine-1-carboxylic acid; when the fermentation temperature is 42 °C or higher, the engineered bacterium ferments to produce phenazine-1-carboxamide.

[0018] The beneficial effects of the present invention are as follows:

[0019] (1) Research shows that phenazine-1-carboxamide in Pseudomonas chlororaphis is catalyzed from phenazine-1-carboxylic acid by the PhzH enzyme. Therefore, the production of phenazine-1-carboxylic acid and phenazine-1-carboxamide can be controlled by regulating the expression of the PhzH enzyme. In the present invention, the expression of the phzH gene is controlled by temperature, and further the production of phenazine-1-carboxylic acid and phenazine-1-carboxamide is regulated. Specifically, the repressor protein cI857 produced by the temperature-sensitive repressor protein cI857 gene at 30-32 °C can prevent the transcriptional initiation of promoters pR and pL, so that the phzH gene is not expressed. At this time, the engineered bacteria can only produce phenazine-1-carboxylic acid. When the temperature is adjusted to 42 °C or above, the repressor protein cI857 undergoes a conformational change and becomes inactivated, and promoters pR and pL are activated, and the phzH gene is expressed. At this time, the engineered bacteria only produce phenazine-1-carboxamide.

[0020] (2) When the growth curves of the engineered bacteria for temperature-controlled production of phenazine-1-carboxylic acid and phenazine-1-carboxamide provided by the present invention are compared with those of the engineered bacteria in the comparative example, the growth of the strain is not affected after gene manipulation. Brief Description of the Drawings

[0021] The specification drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention.

[0022] Figure 1 is the map of the recombinant plasmid pk18-tktA-phzO-UD;

[0023] Figure 2 is the PCR verification result of the strain QPCA-T. Among them, for external primer detection: 1 is DNA Ladder DL2000, 2 is the amplified fragment using the genome of strain Qlu-1 as a template, 3 is the amplified fragment using the genome of strain Qlu-1 as a template, 4 is the amplified fragment using the genome of strain Qlu-1 as a template, 5 is the amplified fragment using the genome of strain QPCA-T as a template, 6 is the amplified fragment using the genome of strain QPCA-T as a template, 7 is the blank control; for internal primer detection: 1 is DNA Ladder DL5000, 2 is the blank control, 3 is the amplified fragment using the genome of strain QPCA-T as a template, 4 is the amplified fragment using the genome of strain Qlu-1 as a template;

[0024] Figure 3 is the map of the recombinant plasmid pk18-ppsA-pykF-UD;

[0025] Figure 4PCR verification results for strain QPCA-TP. Among them, for external primer detection: 1 is the blank control, 2 and 3 are amplified fragments using the genome of strain QPCA-TP as the template, 4 is DNA Ladder DL5000, 5 and 6 are amplified fragments using the genome of strain Qlu-1 as the template; for internal primer detection: 1 is DNA Ladder DL2000, 2 is an amplified fragment using the genome of strain Qlu-1 as the template, 3 is an amplified fragment using the genome of strain QPCA-TP as the template, 4 is the blank control;

[0026] Figure 5 It is the map of the control expression vector;

[0027] Figure 6 It is the yields of phenazine-1-carboxylic acid produced by strain QPCA-T, strain QPCA-TP, and strain QPCAN-TP during fermentation at 30°C;

[0028] Figure 7 It is the yields of phenazine-1-carboxamide produced by strain QPCA-T, strain QPCA-TP, and strain QPCAN-TP during fermentation at 42°C;

[0029] Figure 8 It is the growth curve. Detailed implementation manners

[0030] It should be noted that the following detailed description is exemplary and is intended to provide further illustration of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.

[0031] It should be noted that the terms used herein are only for describing the specific implementation manners and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular forms are also intended to include the plural forms. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0032] The first typical embodiment of the present invention provides an engineered bacterium for thermo-controlled production of phenazine-1-carboxylic acid and phenazine-1-carboxamide, which uses Pseudomonas chlororaphis Qlu-1 as the starting bacterium, replaces the phzO gene in its genome with the tktA gene and the pykF gene with the ppsA gene; and introduces a control expression vector;

[0033] The control expression vector is a recombinant expression vector obtained by inserting the phzH gene into the starting expression vector;

[0034] The starting expression vector includes: promoter pR, promoter pL, and the temperature-sensitive repressor protein cI857 gene;

[0035] The expression of the phzH gene is controlled by promoters pR and pL; promoters pR and pL are regulated by the temperature-sensitive repressor protein cI857.

[0036] In one or more embodiments, the nucleotide sequence of the phzO gene is as shown in SEQ ID NO:1;

[0037] The nucleotide sequence of the tktA gene is as shown in SEQ ID NO:2;

[0038] The nucleotide sequence of the pykF gene is as shown in SEQ ID NO:3;

[0039] The nucleotide sequence of the ppsA gene is as shown in SEQ ID NO:4;

[0040] The nucleotide sequence of the phzH gene is as shown in SEQ ID NO:5;

[0041] The nucleotide sequence of the control expression vector is as shown in SEQ ID NO:6.

[0042] In one or more embodiments, the starting expression vector is the pBV220K plasmid, and the nucleotide sequence of the starting expression vector is as shown in SEQ ID NO:7.

[0043] In a second typical embodiment of the present invention, there is provided a method for constructing an engineered bacterium for thermo-controlled production of phenazine-1-carboxylic acid and phenazine-1-carboxamide as described in the first aspect, comprising the following steps:

[0044] Using Pseudomonas chlororaphis Qlu-1 as the starting bacterium, replacing the phzO gene in its genome with the tktA gene and the pykF gene with the ppsA gene; and introducing the control expression vector.

[0045] In one or more embodiments, the method for replacing the phzO gene with the tktA gene includes:

[0046] Amplifying the upstream and downstream homologous arms of the phzO gene fragment and the tktA gene fragment to obtain phzO-U, phzO-D, and the tktA fragment respectively; using fusion PCR to ligate the tktA fragment with phzO-U and phzO-D to obtain the fusion fragment tktA-phzO-UD;

[0047] Insert the fusion fragment tktA-phzO-UD into the plasmid pk18moBsacB to obtain the recombinant plasmid pk18-tktA-phzO-UD;

[0048] After introducing the recombinant plasmid pk18-tktA-phzO-UD into Escherichia coli S17-1(λpir), perform biparental hybridization culture with Pseudomonas chlororaphis Qlu-1, thereby introducing the recombinant plasmid into Pseudomonas chlororaphis Qlu-1;

[0049] Screen for positive clones to obtain the strain QPCA-T.

[0050] Preferably, the primers for amplifying the upstream homologous arm of the phzO gene fragment include phzO-F1 and phzO-R1, and the nucleotide sequences are shown in SEQ ID NO:8 and SEQ ID NO:9 respectively;

[0051] The primers for amplifying the downstream homologous arm of the phzO gene fragment include phzO-F2 and phzO-R2, and the nucleotide sequences are shown in SEQ ID NO:10 and SEQ ID NO:11 respectively;

[0052] The primers for amplifying the tktA gene include tktA-F3 and tktA-R3, and the nucleotide sequences are shown in SEQ ID NO:12 and SEQ ID NO:13 respectively;

[0053] The primers for ligating the tktA fragment with phzO-U and phzO-D by fusion PCR are phzO-F1 and tktA-R3.

[0054] Preferably, the method for screening positive clones specifically includes sucrose plate screening, replica screening and PCR screening.

[0055] In one or more embodiments, the method for replacing the pykF gene with the ppsA gene includes:

[0056] Amplify the upstream and downstream homologous arms of the pykF gene fragment and the ppsA gene fragment to obtain pykF-U, pykF-D and the ppsA fragment respectively; use fusion PCR to ligate the ppsA fragment with pykF-U and pykF-D to obtain the fusion fragment ppsA-pykF-UD;

[0057] Insert the fusion fragment ppsA-pykF-UD into the plasmid pk18moBsacB to obtain the recombinant plasmid pk18-ppsA-pykF-UD;

[0058] The recombinant plasmid pk18-ppsA-pykF-UD was introduced into Escherichia coli S17-1(λpir) and then co-cultured with strain QPCA-T to introduce the recombinant plasmid into strain QPCA-T;

[0059] Positive clones were screened to obtain strain QPCA-TP.

[0060] Preferably, the primers for amplifying the upstream homologous arm of the pykF gene fragment include pykF-F1 and pykF-R1, and the nucleotide sequences are shown in SEQ ID NO:14 and SEQ ID NO:15 respectively;

[0061] The primers for amplifying the downstream homologous arm of the pykF gene fragment include pykF-F2 and pykF-R2, and the nucleotide sequences are shown in SEQ ID NO:16 and SEQ ID NO:17 respectively;

[0062] The primers for amplifying the ppsA gene include ppsA-F3 and ppsA-R3, and the nucleotide sequences are shown in SEQ ID NO:18 and SEQ ID NO:19 respectively;

[0063] The primers for ligating the ppsA fragment with pykF-U and pykF-D are pykF-F1 and ppsA-R3.

[0064] Preferably, the method for screening positive clones specifically includes sucrose plate screening, replica screening and PCR screening.

[0065] In one or more embodiments, the construction method of the control expression vector includes:

[0066] The phzH gene was inserted into the starting expression vector by restriction enzyme digestion and ligation technology to obtain the control expression vector.

[0067] In one or more embodiments, the method for introducing the control expression vector includes:

[0068] The control expression vector was introduced by electroporation.

[0069] In a third typical embodiment of the present invention, an application of the temperature-controlled engineering bacteria for producing phenazine-1-carboxylic acid and phenazine-1-carboxamide described in the first aspect in the production of phenazine-1-carboxylic acid and phenazine-1-carboxamide is provided.

[0070] In one or more embodiments, the temperature-controlled engineering bacteria for producing phenazine-1-carboxylic acid and phenazine-1-carboxamide are inoculated into a fermentation medium for culture. When the fermentation temperature is 30-32 °C, the engineering bacteria ferment to produce phenazine-1-carboxylic acid; when the fermentation temperature is 42 °C or higher, the engineering bacteria ferment to produce phenazine-1-carboxamide.

[0071] The fourth typical embodiment of the present invention provides a method for temperature-controlled production of phenazine-1-carboxylic acid and phenazine-1-carboxamide, comprising:

[0072] Inoculating an engineered bacterium for temperature-controlled production of phenazine-1-carboxylic acid and phenazine-1-carboxamide into a fermentation medium for cultivation. When the fermentation temperature is 30-32°C, the engineered bacterium ferments to produce phenazine-1-carboxylic acid; when the fermentation temperature is 42°C or higher, the engineered bacterium ferments to produce phenazine-1-carboxamide.

[0073] In one or more embodiments, the fermentation medium is selected from KB medium.

[0074] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with specific examples.

[0075] Example 1

[0076] Construction of an engineered bacterium for temperature-controlled production of phenazine-1-carboxylic acid and phenazine-1-carboxamide:

[0077] (1) Inoculate Pseudomonas chlororaphis Qlu-1 into KB medium and culture it overnight at 30°C with shaking at 180 rpm. Extract the genome of Pseudomonas chlororaphis Qlu-1 using a prokaryotic genome extraction kit and store it at -20°C for later use.

[0078] (2) Search for the upstream and downstream sequences of the tktA gene and the phzO gene in the sequenced genome data of Pseudomonas chlororaphis Qlu-1. Using the genome of Pseudomonas chlororaphis Qlu-1 as a template and phzO-F1 / phzO-R1, phzO-F2 / phzO-R2, tktA-F3 / tktA-R3 as primers, amplify the upstream and downstream homologous arms of the phzO gene fragment and the tktA gene fragment; obtain phzO-U, phzO-D, and tktA fragments respectively. Using phzO-F1 / tktA-R3 as primers, connect the tktA fragment with phzO-U and phzO-D by fusion PCR to obtain the fusion fragment tktA-phzO-UD;

[0079] Insert the fusion fragment tktA-phzO-UD into the pk18moBsacB plasmid by enzymatic digestion and ligation (the restriction enzyme sites are EcoRI and BamHI) to obtain the recombinant plasmid pk18-tktA-phzO-UD (the map is as Figure 1 shown);

[0080] The nucleotide sequence of the recombinant plasmid pk18-tktA-phzO-UD is as follows:

[0081] tgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctat

[0082] ctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgcca

[0083] gctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatga

[0084] ggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccg

[0085] ccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactccaagacgaggcagcgcggctatcgtggctggccacga

[0086] cgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccga

[0087] gaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatgga

[0088] agccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcggatgcccgacggcgaggatctcgtcgtg

[0089] acccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctac

[0090] ccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttct

[0091] gagcgggactctggggttcgctagaggatcgatcctttttaacccatcacatatacctgccgttcactattatttagtgaaatgagatattatgatattttctgaattgtgattaaaaaggc

[0092] aactttatgcccatgcaacagaaactataaaaaatacagagaatgaaaagaaacagatagattttttagttctttaggcccgtagtctgcaaatccttttatgattttctatcaaacaaaa

[0093] gaggaaaatagaccagttgcaatccaaacgagagtctaatagaatgaggtcgaaaagtaaatcgcgcgggtttgttactgataaagcaggcaagacctaaaatgtgtaaagggc

[0094] aaagtgtatactttggcgtcaccccttacatattttaggtctttttttattgtgcgtaactaacttgccatcttcaaacaggagggctggaagaagcagaccgctaacacagtacataaa

[0095] aaaggagacatgaacgatgaacatcaaaaagtttgcaaaacaagcaacagtattaacctttactaccgcactgctggcaggaggcgcaactcaagcgtttgcgaaagaaacgaa

[0096] ccaaaagccatataaggaaacatacggcatttcccatattacacgccatgatatgctgcaaatccctgaacagcaaaaaaatgaaaaatatcaagtttctgaatttgattcgtccaca

[0097] attaaaaatatctcttctgcaaaaggcctggacgtttgggacagctggccattacaaaacgctgacggcactgtcgcaaactatcacggctaccacatcgtctttgcattagccgga

[0098] gatcctaaaaatgcggatgacacatcgatttacatgttctatcaaaaagtcggcgaaacttctattgacagctggaaaaacgctggccgcgtctttaaagacagcgacaaattcgat

[0099] gcaaatgattctatcctaaaagaccaaacacaagaatggtcaggttcagccacatttacatctgacggaaaaatccgtttattctacactgatttctccggtaaacattacggcaaaca

[0100] aacactgacaactgcacaagttaacgtatcagcatcagacagctctttgaacatcaacggtgtagaggattataaatcaatctttgacggtgacggaaaaacgtatcaaaatgtaca

[0101] gcagttcatcgatgaaggcaactacagctcaggcgacaaccatacgctgagagatcctcactacgtagaagataaaggccacaaatacttagtatttgaagcaaacactggaact

[0102] gaagatggctaccaaggcgaagaatctttatttaacaaagcatactatggcaaaagcacatcattcttccgtcaagaaagtcaaaaacttctgcaaagcgataaaaaacgcacggc gaagatggctaccaaggcgaagaatctttatttaacaaagcatactatggcaaaagcacatcattcttccgtcaagaaagtcaaaaacttctgcaaagcgataaaaaacgcacggc

[0103] tgagttagcaaacggcgctctcggtatgattgagctaaacgatgattacacactgaaaaaagtgatgaaaccgctgattgcatctaacacagtaacagatgaaattgaacgcgcga tgagttagcaaacggcgctctcggtatgattgagctaaacgatgattacacactgaaaaaagtgatgaaaccgctgattgcatctaacacagtaacagatgaaattgaacgcgcga

[0104] acgtctttaaaatgaacggcaaatggtacctgttcactgactcccgcggatcaaaaatgacgattgacggcattacgtctaacgatatttacatgcttggttatgtttctaattctttaact acgtctttaaaatgaacggcaaatggtacctgttcactgactcccgcggatcaaaaatgacgattgacggcattacgtctaacgatatttacatgcttggttatgtttctaattctttaact

[0105] ggcccatacaagccgctgaacaaaactggccttgtgttaaaaatggatcttgatcctaacgatgtaacctttacttactcacacttcgctgtacctcaagcgaaaggaaacaatgtcg ggcccatacaagccgctgaacaaaactggccttgtgttaaaaatggatcttgatcctaacgatgtaacctttacttactcacacttcgctgtacctcaagcgaaaggaaacaatgtcg

[0106] tgattacaagctatatgacaaacagaggattctacgcagacaaacaatcaacgtttgcgccgagcttcctgctgaacatcaaaggcaagaaaacatctgttgtcaaagacagcatc tgattacaagctatatgacaaacagaggattctacgcagacaaacaatcaacgtttgcgccgagcttcctgctgaacatcaaaggcaagaaaacatctgttgtcaaagacagcatc

[0107] cttgaacaaggacaattaacagttaacaaataaaaacgcaaaagaaaatgccgatgggtaccgagcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcga cttgaacaaggacaattaacagttaacaaataaaaacgcaaaagaaaatgccgatgggtaccgagcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcga

[0108] ttccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggccagc ttccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggccagc

[0109] aggtaggccgacaggctcatgccggccgccgccgccttttcctcaatcgctcttcgttcgtctggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcat

[0110] cagccatccgcttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaaca

[0111] cccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggat

[0112] ggatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaagcgctgcttccctgctgttttgtggaatatctaccgactggaaacaggcaaatgcagga

[0113] aattactgaactgaggggacaggcgagagacgatgccaaagagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacc

[0114] tcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattc

[0115] ggcgcaaagtgcgtcgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggcttctgtttctatcagctcctgaaaatctcgataactcaaaaaata

[0116] cgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccagg

[0117] atttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggctt

[0118] ctgtttctatcagggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatccctt

[0119] aacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctacca

[0120] gcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccactt

[0121] caagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccgga

[0122] taaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccac

[0123] gcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgt

[0124] cgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggcct

[0125] tttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtga

[0126] gcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagc

[0127] gcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagc

[0128] tatgacatgattacgaattcacacgcatcgtggtgatcagtgagatcagtgacaccggggtagtgttcagcacccatgccggaagccagaaaggtcgcgaactgacagaaaacc

[0129] cctgggcctcggggacgctgtattggcgcgaaaccagccagcagatcatcctcaatggccaggccgtgcgcatgccggatgccaaggctgacgaggcctggttgaagcgcc

[0130] cttatgccacgcatccgatgtcatcggcgtctcgccagagtgaagagctcacggatgtcgaggccctgcgcaacgccgccagggaactggccgaggttccaggtccgctgcc

[0131] gcgtcccgagggttattgcgtgtttgagttgcggcttgaatcgctggagttctggggtaacggccaggatcgcctgcatgaacgcttgcgctatgaccgcagcgctgaaggctgg

[0132] aaacatcgccgattacagccgtagggtaccgagataaatatgctttgaagtgctggctgctccaacttcgaactcattgcgcgaacttcaacacttatgacacccggtcaacatgag

[0133] aagagtccagatgcgaaagaacgcgtattcgaaataccaaacagagagtccggatcaccaaagtgtgtaacgacattaattcctatctgaatcttatagttgctctagaacgttgtcc

[0134] ttgacccagcgatagacatcgggccaaagactacacaaacaaagtcagacattactgaggctgctaccatgccaagccgtcgtgagcgtgccaacgccattcgtgccctcagca

[0135] tggatgccgtgcaaaaagccaacagcggccatcccggtgcccctatgggtatggcggatatcgccgaggtactttggcgtgactacctgaagcacaacccgagcaatccatcct

[0136] tcgccgaccgtgaccgcttcgtgctgtccaacggccacggctcgatgctgatctactcgctgctgcacctgactggctacgacgtcaccatcgacgacctgaagagcttccgcca

[0137] gctgcacagccgcaccccgggccacccggagttcggctacaccccgggcgtcgagaccactaccggcccgctgggccaaggcctggccaacgccgtgggcttcgccctgg

[0138] cggaaaaggtcctggcggcgcagttcaaccgtcccggccacaacgtcgtcgaccaccacacctacgtgttcctgggcgatggctgcatgatggaaggcatttcccatgaagtcg

[0139] cgtccctggccggcaccctgggcctgggcaagctgatcgccttctacgatgacaacggcatctccatcgacggcgaagtcgaaggctggttcaccgacgacacgccaaagcg

[0140] tttcgaagcctacaactggcaggtgatccgcaacgtcgacggtcacgaccctgaagagatcaagaccgcgatcgacaccgcgcgcaaaagcgagcagccgaccctgatctgc

[0141] tgcaagaccaccatcggtttcggttcgccgaacaagcaaggcaaggaagactgccacggcgcgccactgggtgctgaggaaatcgccctgacccgcgccgcgctgaagtgg

[0142] aaccacggcccgttcgaaatcccggccgacatctacgccgagtgggatgccaaggaaaccggtcgcgccgtcgaagccgagtgggaccagcgtttctccgcctactccgccg

[0143] aattccctgagctggccaacgagctggtgcgtcgcctgagcggtgacctgccggccgacttctccgagaaggccgatgcctacatcgccgaagtcgcggccaagggcgaaac

[0144] catcgccagccgtaaagccagccagaacgccctgaacgcgttcggcccgctgctgccggaattcctcggcggttcggccgacctggccggttccaacctgaccctgtggaaa

[0145] ggctgcaagggcgtcagcgccgaagacgccagcggcaactacatgtactacggcgttcgcgagttcggcatgaccgccatcatgaacggcgtggccctgcacggtggcctg

[0146] gtgccttacggcgcgaccttcctgatgttcatggaatacgcgcgcaacgcggtacgcatgtcggccctgatgaagcagcgcgtgatccacgtctacacccacgactccatcggtc

[0147] tgggcgaagacggcccgacgcaccagccgatcgagcagatcgccagcctgcgctgcaccccgaacctcgacacctggcgtccagccgatgccgtggaatcggcggtggcc

[0148] tggaagaacgcgatcgagcgcaaggacggtccttcggcgctgatcttctcccgccagaacctgcagcatcagacccgcgatgccgtgcagatcgccgcaatcagccgcggcg

[0149] gctacgtgctcaaggactgcgcaggcgagcctgagctgatcctgatcgccaccggttccgaagtcggcctggcggtgcaggccttcgacaaactgaccgagcagggccgcaa

[0150] ggtgcgcgtggtgtccatgccatgcaccagcgtgttcgatgctcaggacgccggttacaagcagtcggtcctgccgctgcaggtcagcgcccgtatcgccatcgaggccgctc

[0151] acgcggactactggtacaagtacgtcggcctggaaggtcgcgtcatcggcatgaccacctacggcgagtcggcgcctgcgccggccttgttcgaagagttcggtttcaccctgg

[0152] agaacatcctgggtcaggctgaagagctgctggaagactaaacctgattgccgtgtaggcgccgcgcaacccttcattcgtgccgactgaactcggcacgaatgaagggttgtc

[0153] cgcctccggcccctggcatcccgtaagtttccaaccttcaacggtagtacaccgccccattagcatccaaatgaatacagcaggagcccgttacagcgctggcgctggatgcctg

[0154] gctacgcttgcatgggatctcggtccgagacgagccaggtttaccggccccccctttgttcgagccatgccacttggcaggctcgttcagtcgtagcggtcagcctgtcgccggtt

[0155] ggcttgccacccgccacctccaggccagcgtctggcatcgggccttgcccggaagcgccagccatatcggcaccgtagcgatcaacgaaaggctcagcatgggcccgttcac

[0156] tgctgtacattcctccccacggacgacacatcatttacccagtgaacggagttcaacgcgtgttctcgaccctcaatccgcgtcaccgccggcttgccagtttctcgctgatagccgt

[0157] cgccctcagcctcgccgcctgcaacgcttccgccccctcccacaccgccctgccccccgccccggaaatcgcttcgggttatcgcaccgacctgcaagtgcagcgcgccgac

[0158] cagcatatggcggccgcggccaacccgttggcggccgaagccgggcgcgagatgttgcgcaagggcggttcggccatcgaggatcctctagagtcgacctgcaggcatgca

[0159] agcttggcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggc

[0160] ccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgataagctagcttcacgc;

[0161] The recombinant plasmid pk18 - tktA - phzO - UD was introduced into Escherichia coli S17 - 1(λpir) by heat shock transformation and then co - cultivated with Pseudomonas chlororaphis Qlu - 1 through biparental mating, so as to introduce the recombinant plasmid pk18 - tktA - phzO - UD into Pseudomonas chlororaphis Qlu - 1;

[0162] The gene - introduced strains were obtained through sucrose plate screening and replica screening, and strain QPCA - T was obtained through PCR verification. The verification results are as Figure 2 shown.

[0163] The nucleotide sequences of phzO - F1 and phzO - R1 are shown in SEQ ID NO:8 and SEQ ID NO:9 respectively; the nucleotide sequences of phzO - F2 and phzO - R2 are shown in SEQ ID NO:10 and SEQ ID NO:11 respectively; the nucleotide sequences of tktA - F3 and tktA - R3 are shown in SEQ ID NO:12 and SEQ ID NO:13 respectively.

[0164] (3) Search for the upstream and downstream sequences of the ppsA gene and the pykF gene in the sequenced genome data of Pseudomonas chlororaphis Qlu-1. Using the genome of Pseudomonas chlororaphis Qlu-1 as a template, and with pykF-F1 / pykF-R1, pykF-F2 / pykF-R2, and ppsA-F3 / ppsA-R3 as primers, amplify the upstream and downstream homologous arms of the pykF gene fragment and the ppsA gene fragment; obtain pykF-U, pykF-D, and the ppsA fragment respectively; using pykF-F1 / ppsA-R3 as primers, connect the ppsA fragment with pykF-U and pykF-D by fusion PCR to obtain the fusion fragment ppsA-pykF-UD;

[0165] Insert the fusion fragment ppsA-pykF-UD into the pk18moBsacB plasmid by restriction enzyme digestion and ligation (the restriction enzyme sites are EcoRI and HindIII) to obtain the recombinant plasmid pk18-ppsA-pykF-UD (the map is as Figure 3 shown);

[0166] The nucleotide sequence of the recombinant plasmid pk18-ppsA-pykF-UD is as follows:

[0167] tgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctat

[0168] ctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgcca

[0169] gctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatga

[0170] ggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccg

[0171] ccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactccaagacgaggcagcgcggctatcgtggctggccacga

[0172] cgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccga

[0173] gaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatgga

[0174] agccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcggatgcccgacggcgaggatctcgtcgtg

[0175] acccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctac

[0176] ccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttct

[0177] gagcgggactctggggttcgctagaggatcgatcctttttaacccatcacatatacctgccgttcactattatttagtgaaatgagatattatgatattttctgaattgtgattaaaaaggc

[0178] aactttatgcccatgcaacagaaactataaaaaatacagagaatgaaaagaaacagatagattttttagttctttaggcccgtagtctgcaaatccttttatgattttctatcaaacaaaa

[0179] gaggaaaatagaccagttgcaatccaaacgagagtctaatagaatgaggtcgaaaagtaaatcgcgcgggtttgttactgataaagcaggcaagacctaaaatgtgtaaagggc

[0180] aaagtgtatactttggcgtcaccccttacatattttaggtctttttttattgtgcgtaactaacttgccatcttcaaacaggagggctggaagaagcagaccgctaacacagtacataaa

[0181] aaaggagacatgaacgatgaacatcaaaaagtttgcaaaacaagcaacagtattaacctttactaccgcactgctggcaggaggcgcaactcaagcgtttgcgaaagaaacgaa

[0182] ccaaaagccatataaggaaacatacggcatttcccatattacacgccatgatatgctgcaaatccctgaacagcaaaaaaatgaaaaatatcaagtttctgaatttgattcgtccaca

[0183] attaaaaatatctcttctgcaaaaggcctggacgtttgggacagctggccattacaaaacgctgacggcactgtcgcaaactatcacggctaccacatcgtctttgcattagccgga

[0184] gatcctaaaaatgcggatgacacatcgatttacatgttctatcaaaaagtcggcgaaacttctattgacagctggaaaaacgctggccgcgtctttaaagacagcgacaaattcgat

[0185] gcaaatgattctatcctaaaagaccaaacacaagaatggtcaggttcagccacatttacatctgacggaaaaatccgtttattctacactgatttctccggtaaacattacggcaaaca

[0186] aacactgacaactgcacaagttaacgtatcagcatcagacagctctttgaacatcaacggtgtagaggattataaatcaatctttgacggtgacggaaaaacgtatcaaaatgtaca

[0187] gcagttcatcgatgaaggcaactacagctcaggcgacaaccatacgctgagagatcctcactacgtagaagataaaggccacaaatacttagtatttgaagcaaacactggaact

[0188] gaagatggctaccaaggcgaagaatctttatttaacaaagcatactatggcaaaagcacatcattcttccgtcaagaaagtcaaaaacttctgcaaagcgataaaaaacgcacggc

[0189] tgagttagcaaacggcgctctcggtatgattgagctaaacgatgattacacactgaaaaaagtgatgaaaccgctgattgcatctaacacagtaacagatgaaattgaacgcgcga

[0190] acgtctttaaaatgaacggcaaatggtacctgttcactgactcccgcggatcaaaaatgacgattgacggcattacgtctaacgatatttacatgcttggttatgtttctaattctttaact

[0191] ggcccatacaagccgctgaacaaaactggccttgtgttaaaaatggatcttgatcctaacgatgtaacctttacttactcacacttcgctgtacctcaagcgaaaggaaacaatgtcg

[0192] tgattacaagctatatgacaaacagaggattctacgcagacaaacaatcaacgtttgcgccgagcttcctgctgaacatcaaaggcaagaaaacatctgttgtcaaagacagcatc

[0193] cttgaacaaggacaattaacagttaacaaataaaaacgcaaaagaaaatgccgatgggtaccgagcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcga

[0194] ttccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggccagc

[0195] aggtaggccgacaggctcatgccggccgccgccgccttttcctcaatcgctcttcgttcgtctggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcat

[0196] cagccatccgcttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaaca

[0197] cccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggat

[0198] ggatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaagcgctgcttccctgctgttttgtggaatatctaccgactggaaacaggcaaatgcagga

[0199] aattactgaactgaggggacaggcgagagacgatgccaaagagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacc

[0200] tcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattc

[0201] ggcgcaaagtgcgtcgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggcttctgtttctatcagctcctgaaaatctcgataactcaaaaaata

[0202] cgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccagg

[0203] atttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggctt

[0204] ctgtttctatcagggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatccctt

[0205] aacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctacca

[0206] gcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccactt

[0207] caagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccgga

[0208] taaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccac

[0209] gcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgt

[0210] cgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggcct

[0211] tttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtga

[0212] gcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagc

[0213] gcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagc

[0214] tatgacatgattacgaattcttcggagacgttgcccagataaccgatgggtcgatcggtcagccgattgaacactttcaaaaaacacggcaactggtgccgctcgatccgccggtc

[0215] cgtgaacatgtcatgcatcgctattcaagaaggtcattcaacatcgtcgcgccgaggactgtcggccccggtcggcccattttagaaacaatactctaaaacaggctcacagatgtt

[0216] agctcaaggctcatgcgggatcagcaatagcctgatgacgattgttacaacgcggtcggacgcgcttgagcgctgccgcgcgaagggaaatgccccagttgctgcagggtttc

[0217] caggcgcgcgcgggcgcggtaggcgtattcgctgttggggtgctcggtgatgatgtactgataggtctgcgccgcatcgaggaacagcttctgccgctccaggcactgtccgc

[0218] gcagcatcgatacctcgggctggatataagggcgcgagcgactcgtgcggtcgacctggctcagttcgagtatcacccgttcgcagttgccggcgtcataggcgcggtaggcg

[0219] gtattcagatgatggtccatcgaccagcgggtacagccgacaacactgacggccagggcagcaatgagcacgaatcgcatgggggttctcctgtcttgtgcacgttatcgaccc

[0220] gcgttggaaaatcttcaggaatgttcgtttaaagaaacaaacgaataagtagtgcaaacgaacaatgactacagctgcggaccatagtagcctctcgttgcgcttgaactcaggag

[0221] tctttgcatgaaccaggccgccgcgaacaccattcgtttcgggaccaagtccgaaaccctggagcgcctgcagccgcgggtcatccgctcgcggatcctgccgctgtacttcttc

[0222] accgcgcggcagtggcttgatgcccccgcgaacgtgctgcagaacatcgccaggatggagcatggcggttgcgtgatcgtgcgcagcagcgcgcagaacgaagacagcgt

[0223] caacagttccatggccggcctgttcaccagttgcctgaatgtcagtatcaccgaccctcaggccctgagcgtcgccatcgaacaggtgatcgcgtcctttgccgagcaccgctgc

[0224] gaggacaaccagatcctgatccagccaatgctgacctcgatccagatgagcggcgtggtgatgacccacgacctggagcatggcgccccttactacgtggtgaactacgacga

[0225] cgagagcggcctgaccgataccatcaccggcggccagggcatccagaaaaccgtgctggtctaccgcgacaccgagagtgcccagttgcgctccccacgcctgcaggcagt

[0226] gatcgacgcctgcagggagctggaaacgctctgtggcaacgtgccgctggacatcgaattcgccgtcgaccaccaccagcaggtgtatgtgttgcaggtacggcgcatcaccc

[0227] tgtgcaacacctggcatccggtcaccgaacggcgggtggcgcgccagcttgagcacatccagcgcttcctgggcaaacgcctggcgccccaggccggcctgtatggcgaca

[0228] gcaccctgctgggggtgatgcccgactggaacccggcggaaatcatcggcaccactccgcgcccgctggcggcctcgttgtatcggcgcctggtgaccgattcgacctggcg

[0229] cgaagcgcgcgccctgatgggctatcaccacccgcggcaccaggcgctgatggtgatgctaggccatcacccgtatatcgacgtgcgctgcagcttcaactcgttcctgccggc

[0230] gggcctggaaccggggttgtgcaccaggctggtcaacgcctggctacagcgactgcaagcccacccgcaatggcacgacaaggtcgagttcgaagtcgtccagacctgcatg

[0231] gacttcaccttcgacgccgacttcgccgagcgttatggcgacagcctcagcgccgccgagcaacgggcctatcgctcggccctcgaccaactgacgctgcgcgcgctgagcg

[0232] gtaacggcgccggcgctctgccgcccttgctggaccaggtgcgcgtccacgagcgccagcagcaacgccggcgtctcgatgccattccagccgacctcgacagcatccacc

[0233] gcctgctgctggactgccgcgagcaaggcacgctgccgttcgccatgctcgcccggcatgcattcatcgccgaagccctgctgcgctcggcctgccgccgtggcgccctgag

[0234] caacgagcgcctgctgtcctggaagcagtcgatccacaccgtcaccaccgaactgacgcgcgaatacgcccaggtctgcgccgacgtccggacactgccggcctttgtcgcc

[0235] aagttcggccacttgcgccccggcacctacgacatcacctcattgcgttatgacgaacgccatgacctgtttgctgccgcgaccgtcgagctgggtcatggcgagagttcgcaag

[0236] caaccttccaactgcaacccgaagaacgccaggccctgcagcagttgatcgacgaacaaggctggccgctgtcgaccgaatacctgctggactatgccagccaggccatcca

[0237] ggccagggaatacgccaagctggtgttcacccgggacctgtccgacgccctgcaactgctggtgagttggggcgccgacgttggcctggccagggaagacctgtcctttctcg

[0238] atatccacccgctgctcgacagcctcaccacgccgctgatggacgacaccgaccgggtcctgctggagtcggccagccaggcgcgccgcagttatgaacagggcatctcgct

[0239] gaagctcgggcacctgatcagcgccgtcgacgatgtgttcgtggcgccgctgcatcgcagcctgcccaacttcatcacccggcagaacgtcgaagccgtcggcatggaactgc

[0240] gccaggacaccccggcctcggcgccgctcaagggcaagatcgtctgcatcgaaaatgccgaccccggctatgactgggtcttcacccgcggcatcgccgggctggtcaccca

[0241] atacggcggggccaactcgcacatggccatccgctgcgccgaattcggcattccggcggccatcggttgtggcgaacagctgttcaaccggatcctgcgcagcccgcgcatcg

[0242] ccctcaattgtcgcgacaagaccctgaacccggtgcagccatgagtccccctgatgcaacaataaaaagccccgcagtgaagactgcggggcttttttatggatcctgcgaacct

[0243] gtaggagcaagcgggcggcgatccgacttgcccgcgatagctacaccgcggtccaccagaaacaacgcgttgcccgcgatcgcgagcaagcttcgttcctacaaggctggaa

[0244] tcagcccttggcaagaaaccccgacaaggcagccagtgcttccggcgaatgcaggcgctgggtgaacagggtgccctcctcctcgatcaccttgcgcagttgttcgcgatcgg

[0245] gcgtgcgcatcagctgcttgctgatctgcaccgcctgcggcgccagcttctcgaaacgcagcgccatctcccgggccttgtccagggtcgccacgccatcggccaaggccagg

[0246] ttggcaatgccccactgcgccgcctgttcaccgctgaaaccttcgcccagcagcaacagctccgcggctctggccggcccgagcaggcgcggcaggatcaggctggaaccg

[0247] aactccgggcacaagccgagattgacaaaaggcatgcgcaagcgggcatcgcggctgacgtacaccaggtcgcaatgcagcaacagggtggtgccgatccccacggccgg

[0248] gcccgcgaccgcggcgaccaccggcttgcggcattcgaacaggctgcgcatgaactggaagaccgggctgtcgagcccgctgggcggctgctggaggaagtcggcaatgt

[0249] cgttgccggcggtaaagcagtcgctgctgccgctgagcagaaccgcaaagcttggcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatc

[0250] gccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgataagctagcttca

[0251] cgc;

[0252] The recombinant plasmid pk18-ppsA-pykF-UD was introduced into Escherichia coli S17-1(λpir) by heat shock transformation and then subjected to biparental hybridization culture with strain QPCA-T, so as to be introduced into strain QPCA-T by heat shock transformation;

[0253] The gene-introduced strains were obtained by sucrose plate screening and replica screening, and strain QPCA-TP was obtained by PCR verification. The verification results are as Figure 4 shown.

[0254] The nucleotide sequences of pykF-F1 and pykF-R1 are shown in SEQ ID NO:14 and SEQ ID NO:15 respectively; the nucleotide sequences of pykF-F2 and pykF-R2 are shown in SEQ ID NO:16 and SEQ ID NO:17 respectively; the nucleotide sequences of ppsA-F3 and ppsA-R3 are shown in SEQ ID NO:18 and SEQ ID NO:19 respectively.

[0255] (4) Using the enzyme digestion and ligation (the enzyme digestion sites are EcoRI and BamHI) technique, the phzH fragment was ligated with plasmid PBV220K (starting expression vector, nucleotide sequence as shown in SEQ ID NO:7) to obtain the recombinant plasmid PBV220K-phzH (control expression vector, nucleotide sequence as shown in SEQ ID NO:6, and the map is as Figure 5 shown).

[0256] The recombinant plasmid PSV220K-phzH was introduced into Pseudomonas chlororaphis QPCA-TP by electroporation to obtain the engineered bacterial strain QPCAN-TP that can thermally control the production of phenazine-1-carboxylic acid and phenazine-1-carboxamide.

[0257] Example 2

[0258] Strains QPCA-T, QPCA-TP, and QPCAN-TP were respectively inoculated into KB medium, the culture temperature was set at 30 °C, and they were cultured on a shaker for 2 - 4 days. The fermentation broth was extracted with ethyl acetate. After HPLC detection, the strain product was phenazine-1-carboxylic acid, and its yield was as Figure 6 shown.

[0259] Strains QPCA-T, QPCA-TP, and QPCAN-TP were respectively inoculated into KB medium, the culture temperature was set at 42 °C, and they were cultured on a shaker for 2 - 4 days. The fermentation broth was extracted with ethyl acetate. After HPLC detection, the strain product was phenazine-1-carboxamide, and its yield was as Figure 7 shown.

[0260] It can be seen from Figure 6 that when the culture temperature of the strain is 30 °C, strains QPCA-T, QPCA-TP, and QPCAN-TP produce phenazine-1-carboxylic acid; it can be seen from Figure 7 that when the culture temperature of the strain is set at 42 °C, no phenazine-1-carboxamide is produced in strains QPCA-T and QPCA-TP, while phenazine-1-carboxamide is produced in strain QPCAN-TP.

[0261] Example 3

[0262] The production situation of the strain is one of the important indicators of the fermentation performance of the fermentation strain. Figure 8 Shown are the growth curves of wild strain Qlu-1, phenazine-1-carboxamide-producing QPCN-8 of Chinese Patent CN112111440A, and strain QPCAN-TP at 42 °C. It can be seen from Figure 8It can be seen that compared with the wild strain Qlu-1, the growth rate of the phenazine-1-carboxamide-producing strain QPCN-8 is slower and weaker. Although the strain QPCAN-TP in the present invention has undergone a series of genetic engineering operations, its growth performance has hardly weakened compared with the wild strain, which is beneficial to subsequent fermentation as a strain for producing phenazine-1-carboxamide.

[0263] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. An engineered bacterium for producing phenazine-1-carboxylic acid and phenazine-1-carboxamide under temperature control, characterized in that: The method uses Pseudomonas chlororaphis Qlu-1 as a starting bacterium, replaces the phzO gene in its genome with the tktA gene, and replaces the pykF gene with the ppsA gene; and introduces a control expression vector; The control expression vector is a recombinant expression vector obtained by inserting the phzH gene into the starting expression vector; The starting expression vector comprises: promoter pR, promoter pL and temperature-sensitive repressor protein cI857 gene; The expression of the phzH gene is controlled by promoters pR and pL; promoters pR and pL are regulated by the temperature-sensitive repressor protein cI857.

2. The engineered bacteria according to claim 1, characterized in that The starting expression vector is pBV220K plasmid, and the nucleotide sequence of the starting expression vector is shown in SEQ ID NO:

7.

3. The engineered bacteria according to claim 1, characterized in that The nucleotide sequence of the phzO gene is shown in SEQ ID NO: 1; The nucleotide sequence of the tktA gene is shown in SEQ ID NO: 2; The nucleotide sequence of the pykF gene is shown in SEQ ID NO: 3; The nucleotide sequence of the ppsA gene is shown in SEQ ID NO:4; The nucleotide sequence of the phzH gene is shown in SEQ ID NO:5; The nucleotide sequence controlling the expression vector is shown in SEQ ID NO:

6.

4. The method for constructing an engineered bacterium according to any one of claims 1 to 3, characterized in that: The steps include: Pseudomonas chlororaphis Qlu-1 was used as the starting bacterium, the phzO gene in its genome was replaced by the tktA gene, and the pykF gene was replaced by the ppsA gene; and a control expression vector was introduced.

5. The construction method according to claim 4, characterized in that: Methods for replacing the phzO gene with the tktA gene include: Amplify the upstream and downstream homologous arms of the phzO gene fragment and the tktA gene fragment to obtain phzO-U, phzO-D and tktA fragments respectively; connect the tktA fragment with phzO-U and phzO-D by fusion PCR to obtain the fusion fragment tktA-phzO-UD; The fusion fragment tktA-phzO-UD was inserted into the pk18moBsacB plasmid to obtain the recombinant plasmid pk18-tktA-phzO-UD; The recombinant plasmid pk18-tktA-phzO-UD was introduced into Escherichia coli S17-1 (λpir) and then cultured with Pseudomonas chlororaphis Qlu-1 by biparental hybridization, thereby introducing the recombinant plasmid into Pseudomonas chlororaphis Qlu-1; The positive clones were screened to obtain strain QPCA-T.

6. The construction method according to claim 5, characterized in that: The primers for amplifying the upstream homology arm of the phzO gene fragment include phzO-F1 and phzO-R1, the nucleotide sequences of which are shown in SEQ ID NO:8 and SEQ ID NO:9, respectively; Primers for amplifying the downstream homology arm of the phzO gene fragment include phzO-F2 and phzO-R2, and the nucleotide sequences are shown in SEQ ID NO: 10 and SEQ ID NO: 11, respectively; Primers for amplifying the tktA gene include tktA-F3 and tktA-R3, whose nucleotide sequences are shown in SEQ ID NO: 12 and SEQ ID NO: 13, respectively; The primers used to connect the tktA fragment with phzO-U and phzO-D by fusion PCR were phzO-F1 and tktA-R3; Alternatively, methods for screening positive clones specifically include sucrose plate screening, replica screening and PCR screening.

7. The construction method according to claim 4, characterized in that: Methods for replacing the pykF gene with the ppsA gene include: Amplify the upstream and downstream homologous arms of the pykF gene fragment and the ppsA gene fragment to obtain pykF-U, pykF-D and ppsA fragments respectively; connect the ppsA fragment with pykF-U and pykF-D by fusion PCR to obtain the fusion fragment ppsA-pykF-UD; The fusion fragment ppsA-pykF-UD was inserted into the pk18moBsacB plasmid to obtain the recombinant plasmid pk18-ppsA-pykF-UD; The recombinant plasmid pk18-ppsA-pykF-UD was introduced into Escherichia coli S17-1 (λpir) and then cultured with the strain QPCA-T by biparental hybridization, thereby introducing the recombinant plasmid into the strain QPCA-T; The positive clones were screened to obtain strain QPCA-TP.

8. The construction method according to claim 7, characterized in that: Primers for amplifying the upstream homology arms of the pykF gene fragment include pykF-F1 and pykF-R1, and the nucleotide sequences are shown in SEQ ID NO: 14 and SEQ ID NO: 15, respectively; Primers for amplifying the downstream homology arms of the pykF gene fragment include pykF-F2 and pykF-R2, and the nucleotide sequences are shown in SEQ ID NO: 16 and SEQ ID NO: 17, respectively; Primers for amplifying the ppsA gene include ppsA-F3 and ppsA-R3, the nucleotide sequences of which are shown in SEQ ID NO: 18 and SEQ ID NO: 19, respectively; The primers used to connect the ppsA fragment to pykF-U and pykF-D were pykF-F1 and ppsA-R3; Alternatively, methods for screening positive clones specifically include sucrose plate screening, replica screening and PCR screening.

9. Use of the engineered bacteria according to any one of claims 1 to 3 in the production of phenazine-1-carboxylic acid and phenazine-1-carboxamide; Preferably, the application includes: The temperature-controlled engineered bacteria for producing phenazine-1-carboxylic acid and phenazine-1-formamide are inoculated into a fermentation medium for cultivation. When the fermentation temperature is between 30 and 32° C., the engineered bacteria ferment to produce phenazine-1-carboxylic acid; when the fermentation temperature is at or above 42° C., the engineered bacteria ferment to produce phenazine-1-formamide.

10. A method for producing phenazine-1-carboxylic acid and phenazine-1-carboxamide by temperature control, characterized in that: include: The engineered bacteria for producing phenazine-1-carboxylic acid and phenazine-1-carboxamide under temperature control as shown in any one of claims 1 to 3 are inoculated into a fermentation medium for cultivation; when the fermentation temperature is 30 to 32° C., the engineered bacteria ferment to produce phenazine-1-carboxylic acid; when the fermentation temperature is 42° C. or above, the engineered bacteria ferment to produce phenazine-1-carboxamide; Preferably, the fermentation medium is selected from KB medium.

Citation Information

Patent Citations

  • Genetically engineered bacterium for producing phenazine-1-carboxamide as well as preparation method and application of genetically engineered bacterium

    CN112111440A