Pericarpium arecae stem and leaf extract as well as preparation method and application thereof

Abstract

The invention provides a stem and leaf extract of pinnata pinnata as well as a preparation method and application of the stem and leaf extract. Specifically, the invention provides an application of the stem and leaf extract of the pinnata pinnata, the stem and leaf extract of the pinnata pinnata is used for preparing a preparation or a composition, the preparation or the composition is used for treating acne, and the treatment comprises the following steps: (a) inhibiting the activity of an androgen receptor; (b) inhibiting the activity of type I 5 alpha-reductase; (c) inhibiting excessive secretion of sebaceous gland lipid; and / or (d) inhibiting lipid peroxidation. The invention further provides the stem and leaf extract of the pinnata pinnata and a preparation method of the stem and leaf extract of the pinnata pinnata. The stem and leaf extract of the pinnata pinnata has good effects in the aspects of acne removal and oil control.

Description

Technical Field

[0001] The invention belongs to the field of cosmetic application development, and in particular relates to an extract of the stem and leaves of Ampelopsis pilosula and a preparation method and application thereof. Background Art

[0002] Acne is a common chronic inflammatory skin disease. Androgens play a role in the pathogenesis of acne by promoting the proliferation and abnormal differentiation of sebaceous gland cells, promoting the secretion and release of inflammatory factors, promoting abnormal keratinization of hair follicle sebaceous gland ducts, and mediating sebaceous gland cell autophagy. The combination of androgens and androgen receptors can more efficiently exert their biological functions, and the effect of androgens on sebaceous glands depends on the activity and number of androgen receptors. Therefore, the topical application of androgen receptor inhibitors can have a good effect on acne.

[0003] The androgen dihydrotestosterone that mediates acne is mainly converted from testosterone under the action of 5α-reductase. There are three main types of 5α-reductase, among which type I is mainly expressed in sebaceous glands, skin keratinocytes and dermal fibroblasts. Therefore, inhibiting type I 5α-reductase can reduce the production of dihydrotestosterone and thus play a role in treating acne.

[0004] The lipids secreted by sebaceous glands are called sebum, which are mainly composed of wax esters, triglycerides, and some free fatty acids including linoleic acid, squalene, etc. A moderate amount of sebum has a protective and moisturizing effect on the skin, but excessive sebum can induce skin inflammation. In addition, the harmful substances produced by excessive oxidation of sebum under the action of reactive oxygen will further aggravate the skin's inflammatory response and skin microecological imbalance, ultimately leading to acne.

[0005] Therefore, solving the problem of skin acne requires local inhibition of androgen receptor activity, inhibition of type I 5α-reductase activity, inhibition of excessive sebaceous gland lipid secretion, and inhibition of sebum peroxidation.

[0006] At present, anti-acne cosmetics that target the androgen receptor and inhibit lipid peroxidation need to be further developed.

[0007] Therefore, it is of great significance to develop active ingredients with androgen receptor inhibitory and anti-lipid peroxidation effects. Summary of the invention

[0008] The invention provides an active ingredient having androgen receptor inhibitory effect and lipid peroxidation resistance effect and application thereof.

[0009] In a first aspect of the present invention, there is provided a use of an extract of the stems and leaves of Ampelopsis ternata for preparing a preparation or a composition, wherein the preparation or the composition is used for treating acne, wherein the treatment comprises:

[0010] (a) Inhibit androgen receptor activity;

[0011] (b) inhibiting type I 5α-reductase activity;

[0012] (c) inhibiting excessive secretion of sebaceous gland lipids; and / or

[0013] (d) Inhibit lipid peroxidation.

[0014] In another preferred embodiment, the preparation is a laboratory preparation.

[0015] In another preferred embodiment, the composition is a cosmetic composition or a pharmaceutical composition.

[0016] In another preferred example, the content of total triterpenes in the Areca nut stem and leaf extract is ≥20wt%, preferably ≥25wt%, and more preferably ≥29wt%, based on the total dry weight of the Areca nut stem and leaf extract.

[0017] In another preferred example, the content of total triterpenes in the Areca nut stem and leaf extract is 20wt%-45wt%, preferably 25wt%-40%, and more preferably 30wt%-35wt%, based on the total dry weight of the Areca nut stem and leaf extract.

[0018] In another preferred example, in the cosmetic composition or pharmaceutical composition, the content of the extract from the stems and leaves of Ampelopsis affine is ≥ 0.1wt%, preferably ≥ 0.2wt% or ≥ 0.5wt%, such as 0.6wt%, 1wt%, 2wt%, 5wt%, 10wt% or 20wt%, based on the total weight of the cosmetic composition or pharmaceutical composition.

[0019] In another preferred example, the Ampelopsis sylvestris stem and leaf extract is from the stems and leaves of Ampelopsis sylvestris.

[0020] In another preferred example, the Ampelopsis sylvestris stem and leaf extract is from the stem of Ampelopsis sylvestris.

[0021] In another preferred embodiment, the Ampelopsis sylvestris stem and leaf extract is prepared by a method comprising the following steps:

[0022] (i) adding 20-30 times the amount of 80-85 v / v% ethanol-water mixed solution to the dried stems and leaves of the betel nut, refluxing for extraction, and filtering to obtain an extract I;

[0023] (ii) concentrating the extract I and adsorbing it with a weakly polar or non-polar resin to obtain an adsorbed resin I;

[0024] (iii) washing the resin I with water to obtain a washed resin II;

[0025] (iv) eluting the resin II with a 70%-80% ethanol-water mixed solution, and collecting the eluate; and

[0026] (v) optionally concentrating the eluate to obtain the Ampelopsis chinensis stem and leaf extract;

[0027] Wherein, the resin is a macroporous resin selected from the following group of models: AB-8, HPD-100, HPD-600, or a combination thereof.

[0028] In another preferred embodiment, the resin is HPD-100 macroporous resin.

[0029] In another preferred embodiment, step (i) comprises one or more technical features selected from the following group:

[0030] (a) the mixed solution is a mixed solution of 80-85 v / v% ethanol and water, such as 80 v / v%, 81 v / v%, 82 v / v%, 83 v / v%, 84 v / v% or 85 v / v%;

[0031] (b) the ratio of the dried safflower stems and leaves to the ethanol-water mixed solution (g / mL) is 1:2-35; preferably, 1:5-30, such as 1:10, 1:20 or 1:30;

[0032] (c) the extraction is performed 1 to 3 times, such as 1, 2 or 3 times; and / or

[0033] (d) The extraction time is independently 0.5-3 h, preferably 2-2.5 h.

[0034] In another preferred embodiment, step (ii) comprises one or more technical features selected from the following group:

[0035] (a) the resin is a macroporous resin selected from the group consisting of AB-8, HPD-100, HPD-600, or a combination thereof, preferably HPD-100;

[0036] (b) The concentration is to concentrate the filtrate to 0.05-2 g medicinal material / g, preferably 0.1-0.5 g medicinal material / g, based on the amount of feed.

[0037] In another preferred embodiment, in step (i), the ethanol-water mixed solution is an 80 v / v % ethanol-water mixed solution.

[0038] In another preferred embodiment, in step (iii), the amount of water used for washing is 2-8 BV, preferably 3-6 BV, and more preferably 2-3 BV.

[0039] In another preferred embodiment, in step (iv), the amount of ethanol used for washing is 2-10 BV, preferably, 3-5 BV.

[0040] In a second aspect of the present invention, there is provided an extract of Areca oleracea stems and leaves, wherein the extract of Areca oleracea stems and leaves is prepared by the following method:

[0041] (i) adding 20-30 times the amount of 80-85 v / v% ethanol-water mixed solution to the dried stems and leaves of the betel nut, refluxing for extraction, and filtering to obtain an extract I;

[0042] (ii) concentrating the extract I and adsorbing it with a weakly polar or non-polar resin to obtain an adsorbed resin I;

[0043] (iii) washing the resin I with water to obtain a washed resin II;

[0044] (iv) eluting the resin II with a 70%-80% ethanol-water mixed solution, and collecting the eluate; and

[0045] (v) optionally concentrating the eluate to obtain the Ampelopsis chinensis stem and leaf extract;

[0046] Wherein, the resin is a macroporous resin selected from the following group of models: AB-8, HPD-100, HPD-600, or a combination thereof.

[0047] In another preferred embodiment, the resin is HPD-100 macroporous resin.

[0048] In another preferred example, the content of total triterpenes in the Areca nut stem and leaf extract is ≥20wt%, preferably ≥25wt%, and more preferably ≥29wt%, based on the total dry weight of the Areca nut stem and leaf extract.

[0049] In another preferred example, the content of total triterpenes in the Areca nut stem and leaf extract is 20wt%-45wt%, preferably 25wt%-40%, and more preferably 30wt%-40wt%, based on the total dry weight of the Areca nut stem and leaf extract.

[0050] In a third aspect of the present invention, a cosmetic composition or a pharmaceutical composition is provided, comprising:

[0051] (a1) the extract of stems and leaves of Ampelopsis ternata as described in the second aspect of the present invention; and

[0052] (b) a cosmetically or pharmaceutically acceptable carrier.

[0053] In another preferred example, in the cosmetic composition or pharmaceutical composition, the content of the extract from the stems and leaves of Ampelopsis affine is ≥ 0.1wt%, preferably ≥ 0.2wt% or ≥ 0.5wt%, such as 0.6wt%, 1wt%, 2wt%, 5wt%, 10wt% or 20wt%, based on the total weight of the cosmetic composition or pharmaceutical composition.

[0054] In another preferred example, the content of total triterpenes in the Areca nut stem and leaf extract is 20wt%-45wt%, preferably 25wt%-40%, and more preferably 30wt%-35wt%, based on the total dry weight of the Areca nut stem and leaf extract.

[0055] In another preferred embodiment, the cosmetic composition or pharmaceutical composition further contains (a2) an additional active ingredient selected from the following uses: inhibiting androgen receptor activity, inhibiting type I 5α-reductase activity, inhibiting excessive sebaceous gland lipid secretion, inhibiting lipid peroxidation, treating acne, or a combination thereof.

[0056] In another preferred embodiment, the cosmetically acceptable carrier or excipient is selected from the following group: moisturizers, antioxidants, UV inhibitors, preservatives, film formers, oil-soluble gelling agents, organic modified clay minerals, resins, antibacterial agents, flavors, salts, pH regulators, chelating agents, cooling agents, anti-inflammatory agents, skin beautifying ingredients, vitamins, amino acids, nucleic acids, hormones, inclusion compounds or combinations thereof.

[0057] In another preferred embodiment, the dosage form of the cosmetic composition or pharmaceutical composition is selected from the following group: liquid preparation, suspension preparation, semisolid preparation or solid preparation.

[0058] In another preferred embodiment, the dosage form of the cosmetic composition or pharmaceutical composition is selected from the following group: a skin external dosage form, an oral dosage form, and an injection dosage form.

[0059] In another preferred embodiment, the dosage form of the cosmetic composition or pharmaceutical composition is selected from the following group: solution, gel, emulsion, ointment, cream, paste, cake, powder, patch and the like.

[0060] In another preferred embodiment, the cosmetically acceptable carrier or excipient is selected from the following group: moisturizers, antioxidants, anti-ultraviolet agents, preservatives, film formers, oil-soluble gelling agents, organic modified clay minerals, resins, antibacterial agents, flavors, salts, pH regulators, chelating agents, cooling agents, anti-inflammatory agents, skin beautifying ingredients, vitamins, amino acids, nucleic acids, hormones, inclusion compounds, or combinations thereof.

[0061] In a fourth aspect of the present invention, a method for preparing the extract of the stems and leaves of Ampelopsis ternata as described in the second aspect of the present invention is provided, characterized in that the method comprises the following steps:

[0062] (i) adding 20-30 times the amount of 80-85 v / v% ethanol-water mixed solution to the dried stems and leaves of the betel nut, refluxing for extraction, and filtering to obtain an extract I;

[0063] (ii) concentrating the extract I and adsorbing it with a weakly polar or non-polar resin to obtain an adsorbed resin I;

[0064] (iii) washing the resin I with water to obtain a washed resin II;

[0065] (iv) eluting the resin II with a 70%-80% ethanol-water mixed solution, and collecting the eluate; and

[0066] (v) optionally concentrating the eluate to obtain the Ampelopsis chinensis stem and leaf extract;

[0067] Wherein, the resin is a macroporous resin selected from the following group of models: AB-8, HPD-100, HPD-600, or a combination thereof.

[0068] In another preferred embodiment, the resin is HPD-100 macroporous resin.

[0069] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 AC shows the results of the AR-ARE-HEK293 cell line cytotoxicity experiment.

[0071] Figure 2 The IC values ​​of the crude extract and the purified extract of Ampelopsis ternata on androgen receptor inhibition are shown. 50 concentration.

[0072] Figure 3 The relative activities (mean+SD) of cells in each group under different concentrations of Betel nut extract (crude extract) are shown.

[0073] Figure 4 The relative activities (mean+SD) of cells in each group under different concentrations of Betel nut extract (purified) are shown.

[0074] Figure 5The figure shows the effect of the extract of Ampelopsis lanceolata (crude extract) on the level of cellular neutral lipids (mean+SD); * indicates that the difference is statistically significant (p<0.05) compared with the model control group (M); # indicates that the difference is statistically significant (p<0.05) compared with the negative control group (NT).

[0075] Figure 6 The effect of the extract of Ampelopsis lanceolata (purified) on the level of cellular neutral lipids is shown (mean+SD); * indicates that the difference is statistically significant (p<0.05) compared with the model control group (M); # indicates that the difference is statistically significant (p<0.05) compared with the negative control group (NT).

[0076] Figure 7 The neutral lipid microscopic examination of the Ampelopsis fruit extract (crude extract) is shown.

[0077] Figure 8 Shown is a microscopic image of neutral lipids of the Betel nut extract (purified).

[0078] Fig. 9 The effect of the extract of Ampelopsis lanceolata (crude extract) on the expression of SRD5A1 is shown; * indicates that the difference is statistically significant (p < 0.05) compared with the negative control group (NC), and ns indicates that the difference is not statistically significant (p > 0.05) compared with the negative control group (NC).

[0079] Fig.10 The effect of the extract of Ampelopsis lanceolata (purified) on the expression of SRD5A1 is shown; * indicates that the difference is statistically significant (p < 0.05) compared with the negative control group (NC); ns indicates that the difference is not statistically significant (p > 0.05) compared with the negative control group (NC).

[0080] Fig.11 The results show the inhibitory effects of the Ampelopsis fruit extract (crude extract) and Ampelopsis fruit extract (purified) samples on lipid peroxidation.

[0081] Fig.12 A schematic diagram of the production process of the betel nut extract of the present invention is shown. DETAILED DESCRIPTION

[0082] The inventors have conducted extensive and in-depth research, and through a large number of screenings and tests, provided a sago palm stem and leaf extract, a preparation method and an application thereof. The present invention provides a sago palm stem and leaf extract having a high content of total triterpenes, and a preparation method thereof. The experiments of the present invention show that the sago palm stem and leaf extract of the present invention can effectively inhibit androgen receptor activity, type I 5α-reductase activity, excessive sebaceous gland lipid secretion and lipid peroxidation, thereby effectively treating acne. The present invention was completed on this basis.

[0083] the term

[0084] In order to more easily understand the present disclosure, some terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms should have the meaning given below. Other definitions are set forth throughout the application.

[0085] The term "about" can refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0086] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0087] As used herein, unless otherwise indicated, any concentration range, percentage range, ratio range or integer range should be understood to include any integer value within the range and fractional values ​​thereof (e.g., one tenth and one hundredth of an integer) where appropriate.

[0088] As used herein, the term "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items.

[0089] As used herein, "Amalgam fruit extract" and "Amalgam fruit stem and leaf extract" are used interchangeably and both refer to the extract extracted from the stems and leaves of Amalgam fruit of the present invention.

[0090] As used herein, "Ampelopsis affine extract (crude extract)" and "Ampelopsis affine stem and leaf extract (crude extract)" have the same meaning and can be used interchangeably.

[0091] As used herein, "Amalgam fruit extract (purified)" and "Amalgam fruit stem and leaf extract (purified)" have the same meaning and can be used interchangeably.

[0092] Acne

[0093] Acne is a common chronic inflammatory skin disease with an incidence rate of over 80% among adolescents. Clinical manifestations include acne, papules, pustules, cysts or nodules on the face and chest and back. Repeated attacks may leave pigmentation or scars, affecting the patient's physiology, psychology and social interaction. The currently recognized pathogenesis of acne is mainly related to excessive secretion of androgens, excessive secretion of lipids by sebaceous glands, abnormal keratinization of hair follicle sebaceous gland ducts, proliferation of hair follicle microorganisms such as Propionibacterium acnes, and inflammatory and immune responses. Among them, abnormal secretion of sebaceous glands with androgens as the leading factor is considered to be the key factor in the onset of acne.

[0094] Langse fruit

[0095] Lansium domesticum, also known as Longgong fruit, Dugu, Lansa fruit, etc., belongs to the genus Lansium of the Meliaceae family. It mainly grows in Southeast Asia such as Thailand, Malaysia and Vietnam, and is also cultivated in Yunnan and Hainan, China. The fruit of this plant is a very popular fruit in Southeast Asia and tastes sweet.

[0096] Different parts of the malt fruit are used as medicine in many countries. The peel of the malt fruit is used to treat diarrhea and fever. In Thailand, the peel of the malt fruit is used in toners and facial masks. In some areas, the bark of the malt fruit is boiled in water to relieve pain and fever.

[0097] In the existing inventions, there are reports on the 5α-reductase inhibitory effect of the maltose fruit peel extract and several active ingredients therein, and the whitening and moisturizing effect of the maltose fruit leaf extract, but there are no reports on the inhibitory androgen receptor activity, oil control activity and lipid peroxidation inhibitory activity of the maltose fruit stem and leaf extract.

[0098] Preparation method

[0099] In the present invention, there is no special requirement for the preparation method of the Ampelopsis fruit stem and leaf extract, and it can be prepared by the commonly used extraction methods in the art, including but not limited to: solvent extraction, extraction, supercritical extraction and / or chromatography.

[0100] Preferably, the extractant of the extract is selected from the group consisting of water, alcohols (preferably C1-C4 alcohols, such as methanol, ethanol, propanol), or mixtures thereof.

[0101] Preferably, the present invention provides a method for preparing an extract of Ampelopsis pilosula stems and leaves, comprising the following steps:

[0102] (i) adding 20-30 times the amount of 80-85 v / v% ethanol-water mixed solution to the dried stems and leaves of the betel nut, refluxing for extraction, and filtering to obtain an extract I;

[0103] (ii) concentrating the extract I and adsorbing it with a weakly polar or non-polar resin to obtain an adsorbed resin I;

[0104] (iii) washing the resin I with water to obtain a washed resin II;

[0105] (iv) eluting the resin II with a 70%-80% ethanol-water mixed solution, and collecting the eluate; and

[0106] (v) optionally concentrating the eluate to obtain the Ampelopsis chinensis stem and leaf extract;

[0107] Wherein, the resin is a macroporous resin selected from the following group of models: AB-8, HPD-100, HPD-600, or a combination thereof.

[0108] In another preferred embodiment, the resin is HPD-100 macroporous resin.

[0109] Composition and use thereof

[0110] The composition of the present invention comprises the extract of Ampelopsis ternata stems and leaves as described above; and a cosmetically or pharmaceutically acceptable carrier.

[0111] The present invention unexpectedly found that the extract of the stem and leaves of Ampelopsis pilosula has inhibitory activity on multiple pathways of acne formation and can be used to prevent and / or treat acne. In the present invention, the treatment of acne refers to relieving acne or curing acne.

[0112] It is possible to prepare the extract of the stem and leaves of the truncatum of the present invention into a pharmaceutical composition, such as an ointment, a cream, a gel, a paste, a patch, etc. The medicine can be prepared by a generally known preparation technique, and a suitable pharmaceutical additive can be added to the medicine.

[0113] Examples of pharmaceutical additives include excipients, binders, disintegrators, lubricants, flow aids, suspending agents, emulsifiers, stabilizers, warming (wetting) agents, preservatives, solvents, solubilizers, preservatives, flavoring agents, sweeteners, dyes, fragrances, propellants, etc. These pharmaceutical additives can be selected and added in appropriate amounts within the range that does not affect the effects of the present invention.

[0114] It is possible to prepare the extract of the stems and leaves of the betel nut of the present invention into a cosmetic composition, a solid dosage form, a semisolid dosage form, or a liquid dosage form, such as a solution, a gel, a cream, an emulsion, a spray, an ointment, a cream, a paste, a cake, a powder, a patch, etc.

[0115] To the extent that the effects of the present invention are not hindered, other ingredients commonly used in cosmetics may be added to the cosmetics of the present invention, such as film formers, oil-soluble gelling agents, organically modified clay minerals, resins, moisturizers, preservatives, antibacterial agents, flavors, salts, antioxidants, pH adjusters, chelating agents, cooling agents, anti-inflammatory agents, skin beautifying ingredients (whitening agents, cell activators, rough skin improving agents, blood circulation promoters, skin astringents, anti-seborrheic agents, etc.), vitamins, amino acids, nucleic acids, hormones, inclusion compounds, etc.

[0116] The oil-soluble gelling agent is a gelling agent selected from metal soaps such as aluminum stearate, magnesium stearate, and zinc myristate; amino acid derivatives such as N-lauroyl-L-glutamic acid and α, γ-di-n-butylamine; cyclodextrin fatty acid esters such as cyclodextrin palmitate, cyclodextrin stearate, and cyclodextrin 2-ethylhexanoate palmitate; sucrose fatty acid esters such as sucrose palmitate and sucrose stearate; benzylidene sorbitol derivatives such as monobenzylidene sorbitol and dibenzylidene sorbitol; organic modified clay minerals such as dimethylbenzyldodecyl ammonium montmorillonite clay and dimethyldioctadecyl ammonium montmorillonite clay, and the like. One or two or more kinds of gelling agents can be used as needed.

[0117] Moisturizers include: glycerin, sorbitol, propylene glycol, dipropylene glycol, 1,3-butylene glycol, glucose, xylitol, maltitol, polyethylene glycol, hyaluronic acid, chondroitin sulfate, pyrrolidone carboxylate, polyoxyethylene methyl glucoside, polyoxypropylene methyl glucoside, etc.

[0118] Antibacterial preservatives include: alkyl p-hydroxybenzoates, benzoic acid, sodium benzoate, sorbic acid, potassium sorbate, phenoxyethanol, etc. Antibacterial agents include: benzoic acid, salicylic acid, carbolic acid, sorbic acid, alkyl p-hydroxybenzoates, para-chlorometacresol, hexachlorophene, benzalkonium chloride, chlorhexidine chloride, trichloro-N-carbanilide, triclosan, photosensitizer, phenoxyethanol, etc.

[0119] Antioxidants include: tocopherol, butylated hydroxyanisole, butylated hydroxytoluene, phytic acid, etc., pH adjusters include: lactic acid, citric acid, glycolic acid, succinic acid, tartaric acid, dl-malic acid, potassium carbonate, sodium bicarbonate, ammonium bicarbonate, etc., chelating agents include alanine, sodium salt of ethylenediaminetetraacetic acid, sodium polyphosphate, sodium metaphosphate, phosphoric acid, etc., coolants include: L-menthol, camphor, etc., anti-inflammatory agents include: allantoin, glycyrrhetinic acid, glycyrrhizic acid, tranexamic acid, azulene, etc.

[0120] Skin beautification ingredients include: whitening agents such as placenta extract, arbutin, glutathione, and saxifrage extract; cell activators such as royal jelly, photosensitizer, cholesterol derivatives, and calf blood extract; skin roughness improvers; blood circulation promoters such as valeric acid amide, benzyl nicotinate, nicotinate β-butoxyethyl ester, capsaicin, ginger ketone, blister beetle tincture, ichthyol, caffeine, tannic acid, α-borneol, nicotinic acid tocopherol, hexanicotinate inositol ester, cycloamycin, cinnarizine, tolazoline, acetylcholine, verapamil, cepharanthin, and γ-oryzanol; skin astringents such as zinc oxide and tannic acid; anti-seborrheic acid agents such as sulfur, etc. Vitamins include: vitamin A oil, rosin oil, rosin oil acetate, rosin oil palmitate, etc.; riboflavin, riboflavin butyrate, flavin adenine nucleotide, etc. Vitamin B2; Vitamin B6 such as pyridoxine hydrochloride, pyridoxine dioctanoate, and pyridoxine tripalmitate, vitamin B12 and its derivatives, vitamin B15 and its derivatives, vitamin C such as L-ascorbic acid, L-ascorbyl dipalmitate, sodium L-ascorbic acid-2-sulfate, and dipotassium L-ascorbyl diester phosphate; Vitamin D such as ergocalciferol and cholecalciferol; Vitamin E such as α-tocopherol, β-tocopherol, γ-tocopherol, dl-α-tocopherol acetate, dl-α-tocopherol nicotinic acid, and dl-α-tocopherol succinate; Vitamin H; Vitamin P; Nicotinic acid such as niacin, benzyl nicotinate, and niacinamide; Pantothenic acid such as calcium pantothenate, D-panthenol, pantothenic ethyl ether, and acetyl pantothenic ethyl ether; Biotin, etc.

[0121] Amino acids include: glycine, valine, leucine, isoleucine, serine, threonine, phenylalanine, arginine, lysine, aspartic acid, glutamic acid, cystine, cysteine, methionine, tryptophan, etc.; nucleic acids include deoxyribonucleic acid, etc.; hormones include estradiol, vinyl estradiol, etc.

[0122] Preferred examples of the cosmetics of the present invention include: skin care cosmetics, color cosmetics, and UV protection cosmetics, such as basic cosmetics such as lotions, creams, lotions, sunscreens, mask materials, facial cleansers, and essences; and color cosmetics such as foundations, whitening powders, and blushes.

[0123] The form of the product is not particularly limited, and may be liquid, emulsion, cream, solid, paste, gel, powder, multi-layered, mousse, spray, or the like.

[0124] The present invention also provides a skin (including scalp) care method, which comprises the steps of applying the Ampelopsis pilosula stem and leaf extract or the composition of the present invention to an individual in need.

[0125] In another preferred example, the effective concentration range of the extract from the stems and leaves of Ampelopsis pilosula is 1 μg / ml–500 mg / ml, such as 5 μg / ml, 10 μg / ml, 20 μg / ml, 50 μg / ml, 100 μg / ml or 200 μg / ml.

[0126] As used herein, the term "effective dose" refers to any amount as described below, which, when used alone or in combination with another therapeutic agent or cosmetic, can promote disease regression, which is manifested as a decrease in the severity of disease symptoms, an increase in the frequency and duration of disease-free periods, or prevention of disorders or disabilities caused by illness. The "therapeutically effective dose" of the drug of the present invention also includes a "preventive effective dose", which is any amount of the drug as described below, which, when the amount of the composition is applied alone or in combination with another therapeutic agent or cosmetic to a subject who is at risk of developing a disease or symptom or who suffers from a recurrence of a disease or symptom, can inhibit the occurrence or recurrence of a disease or symptom.

[0127] Without wishing to limit the present invention, the following effects of the extract of Ampelopsis pilosula stems and leaves may be due to the synergistic effect of a single component or the components in the extract: inhibition of androgen receptor activity; inhibition of type I 5α-reductase activity; inhibition of excessive sebaceous gland lipid secretion; inhibition of lipid peroxidation; and / or treatment of acne.

[0128] The main advantages of the present invention include:

[0129] (a) The raw materials are the stems and leaves of the taro fruit tree, which are recycled agricultural waste from fruit tree pruning. The raw material cost is low, and the development promotes the secondary income of fruit farmers.

[0130] (b) By adopting the method of the present invention, the total triterpenoid components in the betel nut are purified in a simple, environmentally friendly and recyclable manner.

[0131] (c) The extract of the malvaceae fruit of the present invention can play a good inhibitory role in several pathway mechanisms of acne formation, indicating that it has good efficacy in removing acne and controlling oil, and can be applied to cosmetics.

[0132] (d) This method has various clear process technical indicators, so it can be implemented by technical personnel and can be industrialized for production.

[0133] (e) The total triterpenoids prepared by the method have high purity and have good effects of inhibiting androgen receptor, inhibiting type I 5α-reductase, inhibiting excessive secretion of sebaceous gland lipids and inhibiting lipid peroxidation.

[0134] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0135] Example 1

[0136] The production process of the betel nut stem and leaf extract in this embodiment is as follows Fig.12 shown.

[0137] The preparation method of the extract of the stem and leaf of the tung fruit of the present invention is as follows: add 20 to 30 times the feed amount of 80% to 85% ethanol to the dried stem and leaf of the tung fruit, reflux extract twice, extract for 2 to 2.5 hours, and filter. The filtrate is concentrated under reduced pressure to an ethanol content of less than 5%, and then concentrated in an open state to 0.5 times the feed amount; after standing and cooling, filter to remove the aggregated and precipitated chlorophyll; the filtrate is adsorbed by HPD-100 macroporous resin, first eluted with water for 2 to 3 column volumes until the water washing liquid is clear; then eluted with 70% to 80% ethanol for 2 to 3 column volumes, collect the alcohol washing liquid, and concentrate under reduced pressure to 0.5 times the feed amount to obtain the extract of the stem and leaf of the tung fruit.

[0138] Through content detection, under this process, the total triterpenoid content in the extract of the stems and leaves of Ampelopsis pilosula can reach more than 20wt% (calculated based on the total solid content obtained after the extract is dried).

[0139] The specific preparation process is as follows:

[0140] Preparation Example 1

[0141] 50g of dried safflower stems and leaves were added with 1L of 80% ethanol and refluxed for two times, the first time for 2h and the second time for 1h. The extract was filtered through a 300-mesh filter. The filtrate was concentrated under reduced pressure and then concentrated in an open container to twice the amount of the feed. The filtrate was allowed to stand and cool before being filtered. 30mL of HPD-100 resin was added to the filtrate and statically adsorbed for 30min. The extract was eluted with 3BV of water until the water washing liquid was almost colorless, and then eluted with 5BV of 80% ethanol. The ethanol eluate was collected and concentrated to 100g to obtain a purified extract of safflower stems and leaves. The solid content in the extract was determined to be 1.69wt% (1.69% of 100g). The total triterpene content was 29.94wt% (based on the total solid content obtained after the extract was dried) detected by ultraviolet spectrophotometry.

[0142] Preparation Example 2

[0143] 600g of dried tamarisk stems and leaves were added with 18L of 80% ethanol and refluxed for extraction twice, the first time for 2h and the second time for 2h. The extract was filtered through a 300-mesh filter. The filtrate was concentrated under reduced pressure and then concentrated in an open container to 0.5 times the amount of feed. The filtrate was allowed to stand and cool before being filtered. The filtrate was purified on a column using an HPD-100 macroporous resin. The resin was eluted with 2BV of water until the washing liquid was almost colorless, and then eluted with 3BV of 80% ethanol. The ethanol eluate was collected and concentrated to 300g to obtain a purified extract of tamarisk stems and leaves. The solid content in the extract was determined to be 4.20wt% (4.2% of 300g). The total triterpene content in the extract was 24.10wt% (based on the total solid content after the extract was dried) detected by ultraviolet spectrophotometry.

[0144] Comparative Example 1

[0145] 100g of dried stems and leaves of Areca chinensis were added with 4L of purified water and refluxed for two times, the first time for 2h and the second time for 1.5h. The extract was filtered through a 300-mesh filter and the filtrate was concentrated to 100g in the open air to obtain a crude extract of stems and leaves of Areca chinensis. The solid content of the extract was determined to be 15.51wt% (15.51% of 100g). The total triterpene content in the extract was detected by ultraviolet spectrophotometry and was 4.47wt% (based on the total solid content of the extract after drying).

[0146] Comparative Example 2

[0147] 50 g of dried betel nut stems were added with 1 L of 80% ethanol and refluxed for two times, the first time for 2 h and the second time for 1.5 h. The extract was filtered through a 300-mesh filter. The filtrate was concentrated under reduced pressure and then concentrated in an open container to 100 g to obtain a crude extract of betel nut stems. The solid content of the extract was determined to be 4.46 wt% (4.46% of 100 g). The total triterpene content in the extract was determined to be 13.81 wt% by ultraviolet spectrophotometry (based on the total solid content of the extract after drying).

[0148] Example 2 Screening of Purification Resins for Extracts of Betel Fruit Stems and Leaves

[0149] Take 50g of the stems and leaves of the betel nut, add 1L of 80% ethanol, reflux extraction twice, the first time for 2h, the second time for 1h, the extract is filtered through a 300-mesh filter, the filtrate is concentrated under reduced pressure and then concentrated in an open container to 100g, take 3 portions of 20g of the extract and use macroporous resin to purify the total triterpenes for screening.

[0150] Triterpenoids have relatively low polarity, so weakly polar or non-polar resins should be used to purify such components. Therefore, three macroporous resins, HPD-600, HPD-100 and AB-8, were screened for their purification effects on triterpenes in the extracts from the stems and leaves of Ampelopsis ternata. The macroporous resins were selected by controlling the quantitative loading extract, resin dosage, elution solvent and elution method, and finally comparing the total triterpene content in the eluate determined by UV spectrophotometry.

[0151] The experimental results are shown in Table 1.

[0152] Table 1

[0153]

[0154]

[0155] Therefore, the enrichment and purification effects of the three screened macroporous resins on the total triterpenoid components in the extract of the stem and leaves of the maltose fruit were compared: HPD-100>AB-8>HPD-600, and HPD-100 resin was finally selected as the optimal resin for purifying the active ingredients in the extract of the stem and leaves of the maltose fruit. The maltose fruit stem and leaf extract (purified) purified by this resin also showed better or comparable biological activity to that of the maltose fruit stem and leaf extract (crude extract) without resin purification in several activity test evaluations.

[0156] Example 3 Androgen receptor inhibition experiment

[0157] Experimental Materials

[0158] The experimental materials in this embodiment include:

[0159] (1) Betel nut extract (crude) and Betel nut extract (purified), which were extracted using the method in Example 1-2.

[0160] (2) AR-ARE-HEK293 cell line: human embryonic kidney 293 cell line overexpressing androgen receptor.

[0161] 3.1 AR-ARE-HEK293 cell line cytotoxicity assay

[0162] 3.1.1 Experimental procedures

[0163] AR-ARE-HEK293 cell fluid was aspirated and cultured in a 384-well plate; positive control drug staurosporine, galangal extract (crude extract) and galangal extract (purified) were added to the cells; the maximum test concentration of the positive drug was 10000 nM, and the maximum test concentrations of galangal extract (crude extract) and galangal extract (purified) were both 400 μg / mL; incubated at 37°C and CO2 for 24 hours; CellCounting-Lite 2.0 fluorescent cell viability assay reagent was added to each well, shaken in a microplate reader for 2 minutes, and incubated at room temperature for 30 minutes; and the fluorescence data was read.

[0164] 3.1.1 Data processing

[0165] Data stability check of DMSO and culture medium controls; nonlinear regression equation fitting of IC values ​​of test samples for AR-ARE-HEK293 cells50。

[0166] 3.1.2 Experimental Results

[0167] The results of the AR-ARE-HEK293 cell line cytotoxicity experiment are as follows Figure 1 As shown in AC; the IC values ​​of the samples of the extract of the truncatum fruit (crude extract) and the extract of the truncatum fruit (purified) on AR-ARE-HEK293 cells were detected. 50 All of them are greater than the maximum test concentration of 400 μg / mL, indicating that the samples are safe for cells at this concentration; subsequent tests will select sample concentrations within this concentration range for testing.

[0168] 3.2 AR receptor inhibition experiment

[0169] 3.2.1 Cell culture

[0170] AR-ARE-HEK293 cell line was cultured in DMEM medium containing 10% fetal bovine serum; cells were cultured in an incubator at 37°C with 5% CO2; cell passage: old medium was removed and washed once with PBS, then 1 mL of TrypLE TM Express solution, incubate at 37℃ for about 2 minutes. When the cells detach from the bottom of the dish, add about 5mL of complete medium preheated at 37℃. Gently blow the cell suspension with a pipette to separate the aggregated cells. Transfer the cell suspension to a sterile centrifuge tube and centrifuge at 1000rpm for 5 minutes.

[0171] 3.2.3 Determination of the inhibitory activity of samples on AR receptors

[0172] AR-ARE-HEK293 cells were digested, resuspended in phenol red-free DMEM medium containing 5% carbon-adsorbed serum, counted, and inoculated into 384-well plates. Ten test compounds (Cereal extract (crude) and Cereal extract (purified)) of different concentrations were added, respectively. After incubation at 37°C for 30 minutes, the agonist was added, and then incubated in a 37°C incubator under 5% CO2 conditions; 22 hours after drug addition, Bright-Glo Reagent was added to the experimental wells according to the instructions of the Bright-Lite Luciferase Assay System of the kit, and the luminescent signal value was read using a Biotek multi-function microplate reader after shaking and lysis.

[0173] 3.2.4 Data processing

[0174] Data stability check of DMSO and reference control; nonlinear regression equation fitting of IC of test samples on AR inhibition 50。

[0175] 3.2.5 Experimental results

[0176] IC of the test samples of Ampelopsis ternata extract (crude) and Ampelopsis ternata extract (purified) on androgen receptor inhibition 50 The test values ​​are shown in the table; the androgen receptor inhibition test results of the samples are shown in Table 2.

[0177] Table 2

[0178]

[0179] The experimental results are as follows Figure 2 As shown. The extract of Ampelopsis ternata (crude extract) did not detect the IC50 of androgen receptor inhibition within the tested concentration range. 50 concentration, while the extract of Ampelopsis ternata (purified) showed an IC value of androgen receptor within the concentration range tested. 50 value.

[0180] It shows that the ramie fruit extract (purified) has a certain inhibitory effect on the androgen receptor, while the ramie fruit extract (crude extract) has no significant inhibitory activity on the androgen receptor. The experimental results prove that the purification process of ramie fruit extract using macroporous resin is beneficial to the enrichment of active ingredients, which is an indispensable step in the preparation and application of ramie fruit extract.

[0181] Example 4 SRD5A1 gene expression test, sebaceous gland cell oil secretion test

[0182] 4.1 Experimental Principle

[0183] In this experiment, the human sebaceous gland cell line SZ95 was selected for the construction of an in vitro acne model. The oil secretion of the cells simulated the sebum secretion of human skin. Nile red dye was used to perform fluorescent staining on neutral lipids. Fluorescence microscopy and fluorescence quantification methods were used to qualitatively and quantitatively detect the content and distribution of neutral lipids in sebaceous gland cells, thereby evaluating the oil-control and acne-removing effects of the test samples.

[0184] Increased peripheral metabolism of androgens is considered a key mechanism for the occurrence and development of acne vulgaris. 5α-reductase (SRD5A1) is a key enzyme involved in the peripheral metabolism of androgens, which can convert testosterone into dihydroxytestosterone, the latter of which has an affinity for androgen receptors that is 10 times that of the former. Testosterone that enters the sebaceous glands is converted into dihydrotestosterone (DHT) by type I 5α-reductase in the cells. DHT binds to steroid proteins in the cytoplasm and enters the cell nucleus, binding to chromatin. It affects DNA transcription by upregulating and activating the SREBP pathway, thus promoting the proliferation, differentiation and secretion of sebaceous gland cells.

[0185] The method of the present invention studies whether the sample (the extract of the present invention) can down-regulate the expression of the SRD5A1 gene by culturing SZ95 human cortical gland cells in vitro, thereby evaluating the oil control effect of the sample.

[0186] 4.2 Experimental procedures

[0187] 4.2.1 Cell activity test

[0188] The SZ95 cell suspension was inoculated into a 96-well cell culture plate and cultured for 18-24 hours until the cells were 80% confluent; the original culture medium in the wells was discarded, 100 μL of test samples of different concentrations were added to each well, and the plates were returned to the incubator for incubation for 24±1 hours; the culture plates were taken out, 20 μL of MTT solution was added to each well, and the plates were incubated in the incubator for 3-4 hours; the liquid in the wells was removed, 100 μL of DMSO was added to each well, and the plates were placed on an oscillator for 10-15 minutes before measuring the absorbance at a wavelength of 570 nm on an ELISA reader; the relative cell activity of each group was calculated with the cell activity of the negative control group as 100%.

[0189] 4.2.2 Neutral lipid fluorescence quantification experiment

[0190] SZ95 cell suspension was inoculated in a 96-well cell culture plate and cultured for 18-24 hours until the cells were 80% confluent; various concentrations of the samples to be tested and the positive control isotretinoin were added; the fluorescence quantitative model group was established by inducing cell lipid secretion with linoleic acid; after incubation for 48 hours, the supernatant was discarded, and after washing twice with PBS, Nile red dye was added to the experimental group, and FDA was added to the control group, and incubated for 5 minutes. The released fluorescence was detected on a multifunctional microplate reader: 485nm, 494nm excitation wavelengths and 565nm, 523nm absorption wavelengths were used for the detection of Nile red and FDA fluorescence intensity respectively; the results were determined by the ratio of Nile red and FDA (OD ratio): the percentage of intracellular neutral lipids (%) = OD ratio of the experimental group / OD ratio of the control group × 100%. SPSS software package was used for statistical analysis and significance test. P<0.05 was considered statistically significant.

[0191] 4.2.3 Fluorescence microscopy of neutral lipids

[0192] SZ95 cells were routinely cultured, the cells were seeded in a 35 mm culture dish, and cultured for 18-24 h until the cells were 80% confluent; various concentrations of the test samples and the positive control isotretinoin were added, and the supernatant was discarded after incubation for 48 h, and the cells were quickly washed twice with PBS, and 4% paraformaldehyde was added to fix at room temperature for 5 min, and washed twice with PBS, and Nile red dye was added to incubate at 37°C in the dark for 15 min, and washed twice with PBS. The cells were observed under a fluorescence microscope, and the excitation wavelength of the detection was 460-490 nm, and the absorption wavelength was 565 nm.

[0193] 4.2.4SRD5A1 gene expression test

[0194] SZ95 cells were routinely cultured. The cell suspension was inoculated into a 6-well plate and cultured for 18-24 hours; the original culture medium in the well was discarded, and maintenance medium containing different concentrations of the test substance and maintenance medium without sample were added according to the grouping, with 3 parallels in each group, and exposed for 24 hours; 1-5×10 cells were harvested 6 , transfer to a 1.5mL centrifuge tube, add 1mL Trizol, mix well, and let stand at room temperature for 5 minutes. Add 0.2mL chloroform, shake for 15 seconds, and let stand for 2 minutes. Centrifuge at 12000g×15 minutes at 4℃, and take the supernatant. Add 0.5mL isopropanol, gently mix the liquid in the tube, and let stand for 10 minutes. Centrifuge at 12000g×10 minutes at 4℃, and discard the supernatant. Add 1mL75% ethanol and gently wash the precipitate. 4℃, 7500g×5 minutes, discard the supernatant. Dry, add appropriate amount of DEPC H2O to dissolve; design primers as shown in Table 3; reverse transcription to synthesize cDNA; qPCR reaction; all data are expressed as mean ± standard deviation, and SPSS20.0 statistical software was used to analyze the experimental data, and p<0.05 was considered statistically significant.

[0195] Table 3

[0196] name SEQ ID NO: Sequence information (5'-3') SRD5A1-F 1 GTTGGCGCAATCAGTCTAGA SRD5A1-R 2 GTGTGGTGGTACTGTTGTTTCA 18s-F 3 CCTGGATACCGCAGCTAGGA 18s-R 4 GCGGCGCAATACGAATGCCCC

[0197] 4.3 Experimental Results

[0198] 4.3.1 Cell safety concentration screening

[0199] The relative activity of cells in each group Figure 3-4 shown.

[0200] At the tested concentration, the cell safety of the Ampelopsis lanceolata stem and leaf extract (crude extract) and Ampelopsis lanceolata stem and leaf extract (purified) samples were both good, and the subsequent experimental concentration selection can be started from 100 μg / mL.

[0201] 4.3.2 Neutral lipid fluorescence measurement results

[0202] The results of the neutral lipid fluorescence determination of the samples of the extract of the stem and leaves of Ampelopsis ternata (crude extract) and Ampelopsis ternata (purified extract) are shown in Figure 5-6 As shown: compared with the negative control group (NT), the relative content of neutral lipids in the model control group (M) was significantly increased (P<0.05); compared with the model control group (M), the relative content of neutral lipids in the positive control group (PC) was significantly decreased, indicating that the model was successfully established.

[0203] The relative content of neutral lipids in the test sample Ampelopsis affine stem and leaf extract (crude extract) at a concentration of 0.100 mg / mL (m / v) was significantly reduced compared with the model control group, indicating that the test sample Ampelopsis affine stem and leaf extract (crude extract) at a concentration of 0.100 mg / mL (m / v) has the effect of inhibiting the oil secretion of SZ95 cells.

[0204] The relative content of neutral lipids in the test sample Ampelopsis affine stem and leaf extract (purified) at concentrations of 0.100 mg / mL (m / v), 0.050 mg / mL (m / v), and 0.025 mg / mL (m / v) was significantly reduced compared with the model control group, indicating that the test sample Ampelopsis affine stem and leaf extract (purified) at concentrations of 0.100 mg / mL (m / v), 0.050 mg / mL (m / v), and 0.025 mg / mL (m / v) has the effect of inhibiting the secretion of oil by SZ95 cells.

[0205] At the same time, the neutral lipid fluorescence microscopy images of the extracts of the stems and leaves of the truncatum fruit (crude extraction) and the truncatum fruit (purified) samples, which qualitatively reflect the distribution and content of neutral lipids, are shown in FIG. Figure 7-8 shown.

[0206] 4.3.3SRD5A1 gene expression test results

[0207] The results of the effects of the extracts of the stems and leaves of Ampelopsis ternata (crude extract) and Ampelopsis ternata (purified extract) on the expression of the type I 5α-reductase gene SRD5A1 are shown in Figure 9-10 shown.

[0208] Under the experimental conditions, compared with the negative control group, the SRD5A1 expression level of the sample Areca oleifera stem and leaf extract (crude extract) at the test concentrations of 0.100 mg / mL (m / v), 0.050 mg / mL (m / v), and 0.025 mg / mL (m / v) was significantly reduced, and the difference was statistically significant (P<0.05), indicating that the sample Areca oleifera extract (crude extract) at the concentrations of 0.100 mg / mL (m / v), 0.050 mg / mL (m / v), and 0.025 mg / mL (m / v) had downregulated SRD5A1 gene expression and had a certain oil control effect.

[0209] The expression level of SRD5A1 in the sample of the extract of stem and leaf of Ampelopsis oleracea (purified) was significantly reduced at the test concentrations of 0.100 mg / mL (m / v), 0.050 mg / mL (m / v), and 0.025 mg / mL (m / v), and the difference was statistically significant (P<0.05). This suggests that the expression of SRD5A1 gene is downregulated in the extract of stem and leaf of Ampelopsis oleracea (purified) at the concentrations of 0.100 mg / mL (m / v), 0.050 mg / mL (m / v), and 0.025 mg / mL (m / v), and it has a certain oil control effect.

[0210] Example 5 Lipid peroxidation activity test

[0211] 5.1 Experimental Principle

[0212] Reactive oxygen species (ROS) are natural byproducts of normal oxygen metabolism and play an important role in cell signaling and homeostasis. When the body is exposed to certain environmental stresses (ultraviolet rays, air pollution, etc.), the level of ROS will increase dramatically. Excessive ROS will cause oxidative stress in the body and damage the skin environment. The characteristic product of lipid peroxidation (LPO), malondialdehyde (MDA), condenses with thiobarbituric acid (TBA) to produce a brown-red substance, trimethoprim (3,5,5-trimethyloxazole-2,4-dione), which has a maximum absorption wavelength at 532nm. After colorimetry, it can reflect the degree of LPO.

[0213] In this example, the Fe 2+ The inhibition of induced linoleic acid peroxidation product malondialdehyde (MDA) reflects the anti-lipid peroxidation effect of the sample.

[0214] 5.2 Experimental procedures

[0215] The experimental steps are as follows:

[0216] (1) Substrate pre-protection: Take an appropriate amount of linoleic acid, add PBS (pH 7.4) buffer, and mix by ultrasonication to form an emulsion to obtain a linoleic acid substrate; add the sample to be tested and PBS buffer to the linoleic acid substrate and let it stand at room temperature for 20 min.

[0217] (2) Inducing lipid peroxidation: Add ferrous sulfate solution, a lipid peroxidation inducer, to the mixture prepared in step (1) and place in a 40°C water bath for 1 h.

[0218] (3) Termination of lipid peroxidation: Take out (2) and add trichloroacetic acid solution, and let it stand for 10 minutes to terminate lipid peroxidation.

[0219] (4) Malondialdehyde conversion: Add thiobarbituric acid solution to (3), react in a boiling water bath for 30 min, then cool in an ice water bath for 5 min, and centrifuge at 3000 r / min for 5 min.

[0220] (5) Determination of MDA by UV spectrophotometry: The supernatant was placed in a 96-well plate and the absorbance at 532 nm was measured using an ELISA reader.

[0221] 5.3 Experimental Results

[0222] The MDA inhibition test results of the samples of the extract of the stem and leaves of the wormwood (crude extract) and the extract of the stem and leaves of the wormwood (purified) are as follows: Fig.11 shown.

[0223] The linear regression equation was fitted with the MDA inhibition rate of the positive control drug Vc, and the fitting equation was: y = 0.9086x-79.652 (R 2 =1; x is the concentration of Vc, μg / mL; y is the MDA inhibition rate of Vc, %), the MDA inhibition rate of Vc at a concentration of 133.3 μg / mL was calculated to be 41.46%; the inhibition rates of the stem and leaf extract of Areca oleracea (crude extract) and the stem and leaf extract of Areca oleracea (purified) samples on MDA were 31.65% and 30.46%, respectively, under the condition of a dosage concentration of 133.3 μg / mL.

[0224] The test results indicate that the two samples have a certain anti-lipid peroxidation effect at the action concentration, and the inhibitory effect is slightly worse than that of the positive control Vc.

[0225] discuss

[0226] The purpose of the present invention is to provide an extract of stems and leaves of Ampelopsis ternata, and a preparation method and application thereof, wherein the extract of stems and leaves of Ampelopsis ternata has the effects of inhibiting androgen receptors, inhibiting the activity of type I 5α-reductase, inhibiting excessive secretion of sebaceous gland lipids, and inhibiting lipid peroxidation, thereby effectively treating acne.

[0227] JP1992330008A introduces that the active ingredients in the extract of the ramie fruit peel have a strong 5α-reductase inhibitory effect and its application in hair loss and acne. However, there are many causes and mechanisms leading to hair loss and acne, including excessive androgen binding to androgen receptors stimulating the sebaceous glands of the hair follicles to secrete excessive lipids, excessive lipid oxidation stimulating skin inflammatory reactions, and excessive reproduction of microorganisms such as Malassezia and Propionibacterium acnes, etc., which cause skin microecological imbalance, all of which lead to the occurrence of acne and hair loss. Inhibiting 5α-reductase and thus reducing the production of active androgen dihydrotestosterone is only one pathway in the mechanism of inhibiting acne. CN110012660A introduces the application of ramie fruit plant leaf extract in beauty cosmetics for reducing skin pigmentation. CN114306148A introduces the whitening use of a whitening composition including ramie fruit wood.

[0228] The extract of the stem and leaves of the truncatula of the present invention has total triterpenoid components as main active ingredients, and the total triterpenoid content thereof can reach up to 46.08wt% (calculated based on the total solid content after the extract is dried). The total triterpenoid content in the extract obtained by the process is not less than 20wt% (calculated based on dry matter), and the total triterpenoid content in the finished cosmetic raw material is not less than 0.5%, thereby achieving product quality control.

[0229] Secondly, the present invention uses the stem of the tamarisk fruit as an extraction material for the first time and evaluates the feasibility of using the stem of the tamarisk fruit as a material for extracting triterpenoid components. The stem and leaf parts are easier to obtain than the peel, and the tamarisk fruit trees also need to be pruned regularly, so the agricultural waste generated can be redeveloped and utilized for high value, which is in line with the principle of sustainable development.

[0230] Moreover, the extraction of the stems and leaves of the betel nut in the present invention is carried out with ethanol, the solvent can be completely recycled, the purification process is carried out through macroporous resin, and does not involve any extraction or recrystallization of organic solvents, and the production process is green and environmentally friendly.

[0231] The extract of the stem and leaves of Ampelopsis lanceolata in the present invention has androgen receptor inhibitory activity, type I 5α-reductase inhibitory activity, the efficacy of inhibiting excessive sebaceous gland lipid secretion and inhibiting lipid peroxidation. The efficacy of the extract of the stem and leaves of Ampelopsis lanceolata is evaluated from multiple pathways and multiple angles of acne generation, providing effective data support for the application of the extract of the stem and leaves of Ampelopsis lanceolata in the relevant daily cosmetics industry.

[0232] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A use of an extract of the stems and leaves of Ampelopsis pilosula, characterized in that: For preparing a preparation or composition for treating acne, wherein the treatment comprises: (a) Inhibit androgen receptor activity; (b) inhibiting type I 5α-reductase activity; (c) inhibiting excessive secretion of sebaceous gland lipids; and / or (d) Inhibit lipid peroxidation.

2. The use according to claim 1, characterized in that The composition is a cosmetic composition or a pharmaceutical composition.

3. The use according to claim 1, characterized in that The content of total triterpenes in the extract of Areca oleracea stem and leaves is 20wt%-45wt%, based on the total dry weight of the extract of Areca oleracea stem and leaves.

4. The use according to claim 1, characterized in that The betel nut stem and leaf extract is from the stem and leaves of betel nut.

5. The use according to claim 1, characterized in that The extract of Areca fruit stems and leaves is prepared by a method comprising the following steps: (i) adding 20-30 times the amount of 80-85 v / v% ethanol-water mixed solution to the dried stems and leaves of the betel nut, refluxing for extraction, and filtering to obtain an extract I; (ii) concentrating the extract I and adsorbing it with a weakly polar or non-polar resin to obtain an adsorbed resin I; (iii) washing the resin I with water to obtain a washed resin II; (iv) eluting the resin II with a 70%-80% ethanol-water mixed solution, and collecting the eluate; and (v) optionally concentrating the eluate to obtain the Ampelopsis chinensis stem and leaf extract; Wherein, the resin is a macroporous resin selected from the following group of models: AB-8, HPD-100, HPD-600, or a combination thereof.

6. The use according to claim 5, characterized in that The resin is HPD-100 macroporous resin.

7. The use according to claim 5, characterized in that In step (i), the ethanol-water mixed solution is an 80 v / v % ethanol-water mixed solution.

8. A cosmetic composition or a pharmaceutical composition, characterized in that: The composition comprises: (a1) Active ingredient: an extract of the stems and leaves of Ampelopsis ternata prepared by a method comprising the following steps: (i) adding 20-30 times the amount of 80-85 v / v% ethanol-water mixed solution to the dried stems and leaves of the betel nut, refluxing for extraction, and filtering to obtain an extract I; (ii) concentrating the extract I and adsorbing it with a weakly polar or non-polar resin to obtain an adsorbed resin I; (iii) washing the resin I with water to obtain a washed resin II; (iv) eluting the resin II with a 70%-80% ethanol-water mixed solution, and collecting the eluate; and (v) optionally concentrating the eluate to obtain the Ampelopsis chinensis stem and leaf extract; Wherein, the resin is a macroporous resin selected from the following group: AB-8, HPD-100, HPD-600, or a combination thereof; and (b) a cosmetically or pharmaceutically acceptable carrier.

9. The cosmetic composition or pharmaceutical composition according to claim 8, characterized in that: The content of total triterpenes in the extract of Areca oleracea stem and leaves is 20wt%-45wt%, based on the total dry weight of the extract of Areca oleracea stem and leaves.

10. The cosmetic composition or pharmaceutical composition according to claim 8, characterized in that: The cosmetic composition or pharmaceutical composition further contains (a2) an additional active ingredient selected from the following uses: inhibiting androgen receptor activity, inhibiting type I 5α-reductase activity, inhibiting excessive sebaceous gland lipid secretion, inhibiting lipid peroxidation, treating acne, or a combination thereof.

Images