Application of RNF13 in the preparation of drugs for preventing or treating stroke

By using RNF13 expression promoters to inhibit neuroinflammation and reduce the number of dead nerve cells, the problem of poor effectiveness of existing treatments for ischemic stroke is solved, and a new drug treatment strategy is provided to reduce infarct volume and protect neurological function.

CN119236061BActive Publication Date: 2025-09-19XIEHE HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI & TECH UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411420699.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2024-09-13
Filing Date
2024-10-11
Publication Date
2025-09-19
Estimated Expiration
2044-10-11

AI Technical Summary

Technical Problem

Existing methods for treating ischemic stroke are unable to effectively inhibit cerebral ischemia-reperfusion injury, resulting in unsatisfactory treatment effects for some patients and a lack of new therapeutic targets and drugs.

Method used

RNF13 or its expression promoter, including RNF13 agonists, viral vectors, plasmids and small molecule compounds, is used to protect nerve function by inhibiting neuroinflammation, reducing the number of dead nerve cells and lowering infarct volume, and thus preparing drugs for preventing or treating stroke.

Benefits of technology

RNF13 expression promoters can significantly reduce infarct volume, inhibit neuroinflammation, reduce the number of dead nerve cells, protect nerve function, and provide new drug options for the prevention and treatment of stroke.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119236061B_ABST
    Figure CN119236061B_ABST
Patent Text Reader

Abstract

The present invention discloses the use of RNF13 in the preparation of drugs for preventing or treating stroke. The expression of RNF13 has the effects of reducing infarct volume, protecting nerve function, inhibiting neuroinflammation, reducing the number of dead nerve cells, and inhibiting the occurrence of stroke. It is used to prepare drugs for preventing, alleviating and / or treating stroke.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and specifically to the use of RNF13 in preparing drugs for preventing or treating stroke. Background Art

[0002] Stroke, also known as cerebrovascular accident, is a local brain dysfunction caused by acute cerebrovascular disease. Its clinical symptoms last for more than 24 hours and are more common in people aged 50 and above. The clinical manifestations are symptoms and signs of transient or permanent brain dysfunction. Among them, ischemic stroke is the most common type of stroke. It is mainly due to cerebral blood circulation disorders, ischemia, and hypoxia, which cause ischemic necrosis or softening of localized brain tissue, and corresponding neurological deficits. At present, the treatment for ischemic stroke mainly includes intravenous thrombolysis, arterial thrombolysis or interventional thrombectomy, and early vascular recanalization to save the ischemic penumbra neurons. Although reperfusion therapy is the most effective treatment for ischemic stroke, some patients still cannot achieve the ideal effect after treatment. Ischemia-reperfusion injury is a recognized important pathological mechanism for poor prognosis. 5 Therefore, it is extremely urgent to clarify the mechanism of neuronal death in cerebral ischemia reperfusion injury (CIRI) and to find new therapeutic targets for CIRI in order to develop new and effective therapeutic drugs.

[0003] Ring finger protein 13 (RNF13) was first identified in 1996 by Tranque et al. while studying changes in gene expression in chick embryonic brains following treatment with tenascin-C. Studies have shown that RNF13 is an E3 ubiquitin ligase composed of an N-terminal protease-associated domain, a transmembrane domain, and a C-terminal RING finger functional domain. It is primarily localized to the membranes of cellular organelles, such as late endosomes, lysosomes, and the endoplasmic reticulum, and is highly expressed in the brain, cerebellum, spinal cord, and testis. RNF13 is widely involved in various biological processes, including endoplasmic reticulum stress, protein homeostasis, cell proliferation and migration, post-translational modification, and signal transduction. It has been significantly implicated in the development and progression of diseases such as pancreatic cancer, colorectal cancer, non-alcoholic fatty liver disease, and cardiac hypertrophy. Regarding neurological diseases, RNF13 has been found to promote the progression of Parkinson's disease, but its regulatory role in stroke has not been reported. Summary of the Invention

[0004] The purpose of the present invention is to provide the use of RNF13 in the preparation of drugs for preventing or treating stroke, thereby providing a new option for the prevention, relief or treatment of stroke.

[0005] In view of this, the solution of the present invention is:

[0006] The first aspect of the present invention is to propose the use of RNF13 or an RNF13 expression promoter in the preparation of a drug for preventing or treating stroke.

[0007] The second aspect of the present invention is to propose the use of RNF13 or an RNF13 expression promoter in the preparation of a drug for preventing or treating neuronal damage.

[0008] Furthermore, the drug described in the first aspect or the second aspect includes at least one of the following uses:

[0009] a) inhibit neuroinflammation;

[0010] b) Reduce the number of dead nerve cells;

[0011] c) reduce infarct volume;

[0012] d) Protect nerve function.

[0013] Furthermore, the RNF13 expression promoter includes an RNF13 agonist, and any virus, plasmid, or small molecule compound that can promote RNF13 expression.

[0014] Preferably, the viral vectors that promote RNF13 expression include adeno-associated viral vectors, lentiviral vectors, adenoviral vectors and retroviral vectors.

[0015] Preferably, the RNF13 expression promoter is an RNF13 overexpression adenoviral vector, and the construction process uses primers containing nucleotide sequences as shown in SEQ ID NO: 7-8.

[0016] Preferably, the adenovirus vector is pENTR-U6-CMV-ATG-flag-T2A-EGFP adenovirus.

[0017] Preferably, when the RNF13 expression promoter is a viral vector, it can be administered by injection.

[0018] Furthermore, the drug also includes at least one of a thrombolytic drug, an antiplatelet aggregation drug, an anticoagulant drug, a fiber-reducing drug, and a neuroprotective agent for combined use.

[0019] Furthermore, the medicine also includes pharmaceutically acceptable excipients.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention proposes a new function of RNF13, which has the advantages of reducing infarct volume, protecting nerve function, inhibiting neuroinflammation, and reducing the number of dead nerve cells. On the one hand, it can be used as a drug to prevent or treat neuronal damage; on the other hand, it has the effect of inhibiting the occurrence of stroke and is used to prepare drugs for preventing, alleviating and / or treating stroke. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Graph showing the evaluation results of the severity of brain damage in wild-type mice and RNF13 knockout mice after sham surgery or transient middle cerebral artery occlusion modeling in Example 1.

[0023] Figure 2 This is a graph showing the results of detecting the neuroinflammatory response of wild-type mice and RNF13 gene knockout mice after transient middle cerebral artery occlusion modeling in Example 2.

[0024] Figure 3 This is a graph showing the results of apoptosis detection in wild-type mice and RNF13 gene knockout mice after transient middle cerebral artery occlusion modeling in Example 2.

[0025] Figure 4 These are the results of cell damage detection in rat primary neurons infected with RNF13 knockdown adenovirus or control virus in Example 3 after oxygen-glucose deprivation / re-stimulation.

[0026] Figure 5 These are the results of testing the inflammatory response of rat primary neurons infected with RNF13 knockdown adenovirus or control virus in Example 3 after oxygen-glucose deprivation / re-stimulation.

[0027] Figure 6 These are the results of apoptosis testing of primary neurons of rats infected with RNF13 knockdown adenovirus or control virus in Example 3 after oxygen-glucose deprivation / re-stimulation.

[0028] Figure 7 These are the results of cell damage detection in rat primary neurons infected with RNF13 overexpressing adenovirus or control virus in Example 4 after oxygen-glucose deprivation / re-stimulation.

[0029] Figure 8 These are the test results of the inflammatory response of rat primary neurons infected with RNF13 overexpressing adenovirus or control virus in Example 4 after oxygen-glucose deprivation / re-stimulation.

[0030] Figure 9 This is the result of detecting apoptosis of primary neurons of rats infected with RNF13 overexpressing adenovirus or control virus after oxygen-glucose deprivation / re-stimulation in Example 4. DETAILED DESCRIPTION

[0031] The technical solutions of the present invention will be clearly and completely described below in conjunction with preferred embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0032] To make the experimental methods, technical solutions, and advantages and disadvantages of the examples of the present invention more clearly understood, the specific experimental steps in the examples of the present invention are described in detail and completely below. Where the manufacturers of reagents or instruments are not indicated in the examples, conventional products can be purchased commercially. Where specific conditions are not indicated, conventional conditions or manufacturer-recommended conditions can be followed.

[0033] In one example, a transient middle cerebral artery occlusion (t / MCAO) model was established using RNF13 knockout mice as experimental subjects. By studying the relationship between the RNF13 gene and stroke, the results showed that compared with wild-type mice (control group), the cerebral infarction volume and edema volume of RNF13 knockout mice were significantly increased, neurological function was significantly deteriorated, the inflammatory response in brain tissue was significantly enhanced, and the number of dead neurons increased. Furthermore, primary neurons of rats were infected with RNF13 knockdown or overexpression adenovirus, and then an in vitro cell model was established by oxygen-glucose deprivation / recovery (OGD / R) treatment. It was found that RNF13 deficiency can promote neuronal damage, inflammatory response, and cell apoptosis caused by OGD / R stimulation; while RNF13 overexpression inhibits these processes.

[0034] These results demonstrate that, in a stroke model caused by transient middle cerebral artery occlusion, RNF13 reduces infarct volume, protects neuronal function, inhibits neuroinflammation, reduces the number of neuronal cell deaths, and inhibits the development of stroke. RNF13 protects neuronal function, and in particular, the RNF13 gene can inhibit the development of stroke. Given its ability to inhibit stroke, RNF13 may be used in the preparation of drugs for the prevention, alleviation, and / or treatment of stroke, providing a theoretical and clinical basis for the research of new targets and strategies for the prevention, alleviation, and / or treatment of stroke.

[0035] (1) Construction of RNF13 knockout mice

[0036] CRISPR-Cas9 technology was used to construct systemic RNF13 knockout mice (RNF13-KO). First, the guide sequence of mouse RNF13 was predicted using the online CRISPR design tool (http: / / crispr.mit.edu) and two single-stranded oligos were designed:

[0037] oligo1:TAGGGGATGCTCATGCTGTCCGCCACAC (SEQ ID NO: 1)

[0038] oligo2:AAACGTGTGGCGGACAGCATGAGCATCC (SEQ ID NO: 2)

[0039] The synthesized oligo1 and oligo2 were annealed to form double-stranded DNA, which was then ligated into pUC57-sgRNA (Addgene, 51132) digested with BsaI to obtain the sgRNA expression vector.

[0040] Using the above-constructed expression vector as a template, a DNA fragment containing the T7 promoter and guide sequence was amplified by PCR using the following primers:

[0041] Forward primer: GATCCCTAATACGACTCACTATAG (SEQ ID NO: 3)

[0042] Reverse primer: AAAAAAAGCACCGACTCGGT (SEQ ID NO: 4)

[0043] The amplified PCR product was used as a template for in vitro transcription using the MEGAshortscript Kit (Ambion, AM1354); the Cas9 expression plasmid (pST1374-Cas9, Addgene, 44758) was transcribed using the T7 Ultra kit (Ambion, Am1345). The transcribed Cas9 and sgRNA mRNAs were purified using the miRNeasy Micro Kit (Qiaen, 217084) and injected into single-cell fertilized eggs of wild-type C57BL / 6j mice using the FemtoJet 5247 microinjection system. Fertilized eggs that survived microinjection were selected and transplanted into the oviducts of healthy female mice. After 21 days of gestation, genomic DNA was extracted from the toe tissue of the mice 2 weeks after birth for RT-PCR identification. The identification primers were:

[0044] Forward primer: 5'-GAAAGGTCCGGTGATTTGAA-3' (SEQ ID NO: 5)

[0045] Reverse primer: 5'-GCATTAGGGGACGTTTTCAG-3' (SEQ ID NO: 6)

[0046] Mice with a deletion in the exon region of the RNF13 gene that is not a multiple of 3 were determined to be positive F0 generation mice. These mice were used to continue breeding with wild-type mice, and eventually homozygous mutant mice with a deletion in the exon region of the RNF13 gene that is not a multiple of 3 were obtained.

[0047] (2) Establishment of transient middle cerebral artery occlusion (t / MCAO) model in mice

[0048] Male RNF13-KO mice, 10-12 weeks old and weighing 26-28 g, and their littermates (WT, C57BL / 6 background) were used for the experiment. All mice were housed at the Wuhan University SPF Animal Experimental Center. Housing conditions included a room temperature of 22-24°C, a humidity of 40-70%, a 12-hour light-dark cycle, and free access to water and food.

[0049] Modeling process:

[0050] ① Anesthetize mice with 2.0% isoflurane and oxygen / nitrous oxide mixture by inhalation. After disinfection with 75% medical alcohol, remove the hair from the neck and left skull. Make a longitudinal incision at the skull top to expose the skull, and strip away the connective tissue on the skull surface. Secure the fiber optic probe of the laser Doppler flowmeter with biological glue 1.5 mm posterior to the bregma and 3-4 mm from the midcranial suture.

[0051] ②Fix the mouse in the supine position, pass the optical fiber through the groove of the mouse plate and connect it to the laser Doppler blood flow meter to record the initial cerebral blood perfusion volume. Insert the rectal temperature probe to maintain the body temperature at 37±0.5℃.

[0052] ③ Perform a midline incision in the neck to expose the right common carotid artery, internal carotid artery, and external carotid artery. Use 8-0 silk suture to ligate the distal end of the external carotid artery. Pass another 8-0 silk suture through the external carotid artery and tie a slipknot near the common carotid bifurcation. Use artery clamps to clamp the internal carotid artery and common carotid artery separately. Make a small incision 1 mm below the external carotid artery ligature and insert a 602156 silicone suture plug through the incision.

[0053] ④ Release the internal carotid artery clamp, cut the external carotid artery at the small opening, withdraw the suture plug, reverse it to allow it to enter the internal carotid artery, and insert it inward toward the circle of Willis-middle cerebral artery segment. The suture plug should be inserted approximately 9 ± 1 mm from the common carotid bifurcation and lightly tighten the slipknot. At this point, the blood flow measured by laser Doppler flowmetry should decrease by more than 75%.

[0054] ⑤ After 45 minutes of ischemia, the suture was removed, the proximal end of the external artery was ligated, and the arterial clamp was released. Cerebral blood flow reperfusion was observed, returning to a stable level after 10 minutes, with blood flow measured by laser Doppler flowmetry returning to over 70%. The wound was sutured, and the animals were maintained in a normal manner for 24 hours before subsequent testing and sampling. The sham group did not undergo blood flow occlusion, and all other procedures were the same.

[0055] (3) Neurological function scores of mice

[0056] Neurological function scores of mice in each group were scored based on the modified Berderson scoring method (9-point system) 24 hours after reperfusion. The scoring criteria are as follows:

[0057] 0 points: no symptoms of nerve damage;

[0058] 1 point: when the tail is lifted, the contralateral forelimb is curled up, or the affected forelimb cannot be fully reached;

[0059] 2 points: The opposite shoulder is adducted when the tail is lifted;

[0060] 3 points: Pushing: resistance decreases when pushing to the opposite side;

[0061] 4 points: Can move spontaneously in all directions, but only turns to the opposite side when the tail is removed;

[0062] 5 points: Spinning in circles or only turning in opposite directions during spontaneous movement;

[0063] 6 points: no voluntary movement, movement only when stimulated;

[0064] 7 points: no voluntary movement, no movement even when stimulated;

[0065] 8 points: Death related to cerebral ischemia.

[0066] (4) TTC staining and statistics of infarct volume percentage and edema volume percentage

[0067] After neurological function assessment, mice were anesthetized with 3% sodium pentobarbital and sacrificed. The heart was pierced and exsanguinated. The skin at the back of the neck was cut open to expose the head and neck. The cervical spinal cord was severed at the cervical vertebrae. The skull, which extended from the brainstem to the cerebellum, was cut longitudinally with ophthalmic scissors. The skull was peeled open with toothed forceps, and the dura mater covering the brain was separated, avoiding scratching the brain tissue. The removed brain tissue was refrigerated at -20°C for 30 minutes and then cut into 1 mm thick serial sections (generally 7 sections, 4 sections anterior to bregma and 3 sections posterior to bregma). The sections were immediately incubated in 10 ml of 2% trimethylolpropane solution at 37°C for 10 minutes. The brain sections were rotated periodically during the process to ensure uniform staining. Normal brain tissue stains bright red, while infarcted areas appear pale. After staining, the brain tissue was fixed with 4% neutral paraformaldehyde and photographed.

[0068] Image-Pro Plus (version 6.0) software was used to calculate the infarct volume and edema volume. The specific calculation formulas were as follows: infarct volume percentage = 100*(contralateral brain volume - ipsilateral non-infarcted brain volume) / (contralateral brain volume * 2); edema volume percentage = 100*(ipsilateral brain volume - contralateral brain volume) / contralateral brain volume.

[0069] (5) Pathological analysis

[0070] After neurological function assessment, mice were anesthetized with 3% sodium pentobarbital and sacrificed. Perfusion was performed through the left ventricle with 4°C PBS buffer until clear perfusate flowed from the right atrial appendage. Perfusion was then performed with 4% paraformaldehyde for 8 minutes to fix the vascular intima. Brain tissue was removed and post-fixed with 4% paraformaldehyde for 6-8 hours at room temperature. The specimen was then placed on a shaker and rinsed three times with 4°C 0.01 M PBS buffer for 5 minutes each. The olfactory bulbs and cerebellum were removed, while the cerebrum was retained. The tissue was then cut in half along the coronal plane. The tissue was placed in 40 ml of 20% (w / v) sucrose solution and refrigerated to settle completely. The tissue was then transferred to 40 ml of 30% (w / v) sucrose solution and refrigerated to settle completely. The surface solution was wiped dry and the tissue was placed in an embedding frame to which two drops of OCT had been added. After ensuring that no bubbles were present, OCT was added until the tissue was completely submerged. The tissue was positioned so that it was centered in the embedding frame. Move the embedding frame into dry ice and keep it as horizontal as possible. After the OCT solidifies, store it in a -80℃ freezer.

[0071] Immunofluorescence staining of F4 / 80 and CD11B: OCT-embedded brain tissue was cut into 5 μM thick frozen sections using a freezing microtome and incubated with F4 / 80 antibody (Serotec, MCA497) or CD11B antibody (Boster, BM3925) at 4°C overnight. After washing with PBS, the sections were incubated with secondary antibodies (Alexa Fluor Incubate with 555 Conjugate Anti-rat IgG (H+L) (CST, 4417) at room temperature for 1 hour. DAPI (Southern Biotech, 0100-20) was used to stain cell nuclei. Images were taken and observed under a fluorescence microscope (OLYMPUS, BX51), and positive cell counts were analyzed using Image Pro Plus software.

[0072] TUNEL (Terminal deoxynucleotidyl transferase-mediated dUTP nickel end labeling) and NeuN immunofluorescence double staining: Frozen sections were incubated with NeuN antibody (Proteintech, 26975-1-AP) at 4°C overnight. After washing with PBS, sections were incubated with secondary antibody (Alexa Fluor Cells were incubated with 568 goat anti-Rabbit IgG (H+L) (Invitrogen, A11036) at room temperature for 1 hour. TUNEL staining was then performed using a TUNEL staining kit (Roche, 11684817910) according to the manufacturer's instructions. Cell nuclei were stained with DAPI, and images were obtained and observed under a fluorescence microscope (OLYMPUS, BX51). Positive cells were counted and analyzed using Image Pro Plus software.

[0073] Immunohistochemical staining for p-p65: Frozen sections were incubated with an anti-p-p65 antibody (CST, 3033) overnight at 4°C. After washing with PBS, the sections were stained using the Rabbit Enhanced Polymer Detection System (ZSGB-BIO, PV-9001) according to the manufacturer's instructions. DAB (ZSBB-BIO, ZLI-9018) was used for color development, and hematoxylin (Servicebio, G1004) was used to stain cell nuclei. Images were obtained and observed using a bright-field microscope (Nikon, ECLIPSE 80i).

[0074] (6) Isolation and culture of primary neurons from neonatal rats

[0075] The cerebral cortex was collected from Sprague-Dawley rats 1-2 days after birth, minced, and placed in 2 ml of 0.125% trypsin (GIBCO, 27250018) in a 37°C water bath for 15 min to obtain cortical cells. The digestion reaction was then terminated with DMEM-F12 (BioLight, BLCK115) medium containing 10% fetal bovine serum (Newzeru, FBS-CS500) and DNase (Roche, 10104159001). A 40 μm cell strainer (Corning, 352340) was used to remove clumped cells or incompletely digested tissue blocks. The cells were collected by centrifugation at 1500 rpm for 5 min at 4°C and resuspended in DMEM-F12 medium containing 10% fetal bovine serum and 1% penicillin / streptomycin (Biosharp, BL505A). After counting, cells were plated on poly-lysine (10 mg / ml, Sigma)-coated plates and incubated at 37°C and 5% CO₂ for 3 h. Cells were observed under a microscope. If synapses began to form and the cells began to reshape into tadpoles, the medium was changed, the old medium discarded, and cultured in Neurobasal (GIBCO, 10888022) medium containing 1% L-Glutamine (Beyotine, ST083), 1% anti-antibody, and 2% B27 (GIBCO, 17504044) in the dark. The medium was changed every 48 h, and subsequent experiments were performed after 7 days of culture.

[0076] (7) Construction and infection of RNF13 knockdown and overexpression adenovirus

[0077] ①Construct an adenovirus overexpression plasmid for AdRNF13. Use AdGFP (adenovirus containing GFP (green fluorescent protein)) as a control:

[0078] The CDS sequence of RNF13 was amplified using the rat RNF13 gene cDNA sequence as a template. The primers used were:

[0079]

[0080]

[0081] It was ligated using recombinase (Vazyme, C112-02) into the pENTR-U6-CMV-ATG-flag-T2A-EGFP adenovirus entry vector (donated by Li Hongliang's laboratory at Wuhan University) linearized with BamHI-HF (NEB, R3136V) and SpeI-HF (NEB, R3133V) to obtain the RNF13 overexpression entry plasmid.

[0082] ②Construct AdshRNF13 adenoviral knockdown plasmid and AdshRNA (adenovirus containing shRNA (silencing RNA)) as a control:

[0083] Design and synthesize oligo annealing primers targeting rat RNF13 gene, the sequence is:

[0084]

[0085] After annealing of the Oligo primer, it was ligated into the pENTR-U6-CMV-ATG-flag-T2A-EGFP adenovirus entry vector linearized with AgeI-HF (NEB, R3552S) and EcoRI-HF (NEB, R3101V) under the action of ligase (TOYOBO, LGK-101) to obtain the RNF13 knockdown entry plasmid.

[0086] ③ The above RNF13 overexpression and knockdown entry plasmids were respectively transformed into E. coli T1 competent cells (full gold, CD501-03) for amplification. The correctly sequenced overexpression entry plasmid and knockdown entry plasmid were combined with adenovirus recombinant plasmid pAd / PL-DEST TM (ThermoFisher, V49420) was used for Gateway site-specific recombination (GateWay@LR Clonase TMIIEnzyme Mix, ThermoFisher, 2484478) to obtain pAd-CMV-RNF13-flag-T2A-EGFP (overexpression) and pAd-U6-RNF13shRNA-CMV-EGFP (knockdown) plasmids.

[0087] ④ The plasmid obtained above was linearized by PacI and then transfected into HEK293A cells using PEI transfection reagent (Polysciences, 24765-100). Adenovirus was obtained using the Adeasy adenovirus packaging system (240009, Agilent Technologies). The recombinant adenovirus titer was 10 10 pfu / ml.

[0088] ⑤ The cultured primary neuronal cells were infected with adenovirus at an infection multiplicity of 100 for 12 h, and then the cells were collected for Western blot identification.

[0089] (8) Neuronal oxygen glucose deprivation / recovery (OGD / R) stimulation and cell viability detection

[0090] OGD / R stimulation: Replace the original culture medium with DMEM-F12 medium without serum, glucose, or sodium pyruvate. Incubate the cells in an incubator containing 95% N₂ and 5% CO₂ for 3 hours to induce hypoxia. Afterward, replace the culture medium with normal culture medium and continue incubation in an incubator containing 95% air and 5% CO₂ for 6 hours.

[0091] Cell viability assay: Neurons were seeded in a 96-well plate (Thermo, 167008). Three blank wells (no cells were seeded, only an equal volume of culture medium was added) were set up. After viral infection and OGD / R stimulation, CCK8 detection reagent was added using the CCK8 detection kit (Dojindo, 44786) according to the instructions and incubated at 37°C for 2 h. The absorbance of each group was then measured at 450 nm.

[0092] (9) Molecular biology testing

[0093] Western blot analysis: Brain tissue from the infarcted area was lysed with RIPA buffer containing an appropriate amount of protease inhibitors (Roche, 04693132001) and a phosphatase inhibitor (Roche, 4906837001), ultrasonically disrupted, and centrifuged. The supernatant was collected to obtain total protein. Neurons were lysed with SDS lysis buffer (50 mM Tris-HCl pH 6.8, 2% SDS, 10% glycerol) and incubated at 95°C for 15 min. The supernatant was then centrifuged to obtain total protein. Protein concentration was determined using a BCA protein assay kit (Thermo, 23225). Equal amounts of protein were added to loading buffer and separated by 10% SDS-PAGE electrophoresis. After electrophoresis, the proteins were transferred to a 0.45 μm PVDF membrane (Millipore, IPVH00010). After transfer, the PVDF membrane was blocked with 5% skim milk powder at room temperature for approximately 1 h. The PVDF membrane was washed three times with TBST (5 min each time) and then incubated with the primary antibody overnight at 4°C. After washing with TBST, the membrane was incubated with the corresponding species-specific secondary antibody (Jackson ImmunoResearch) for 1 h at room temperature. The membrane was developed using ECL substrate (Bio-Rad, 1705062), and the signal was collected using a Bio-Rad gel imaging system (ChemiDoc XRS+).

[0094] The information of primary antibodies used is shown in the table below:

[0095]

[0096]

[0097] RT-PCR Assay: Total RNA from tissues and cells was extracted using Trizol (Sigma, T9424). The RNA was reverse transcribed to cDNA using a reverse transcription kit (Vazyme, R323-01). Target gene primers were designed, and RT-PCR was performed using ChamQ SYBR Master Mix (Vazyme, Q311-03) and the LightCycler 480 qPCR System (Roche Holding AG) using cDNA as a template. Relative mRNA expression of each gene was analyzed using β-actin as an internal control.

[0098] The gene primer sequences used are shown in the table below:

[0099]

[0100]

[0101] Example 1 Effect of RNF13 knockout on stroke in mice

[0102] RNF13-KO and WT mice were divided into four groups: WT sham group, KO sham group, WT t / MCAO group, and KO t / MCAO group. The sham group underwent sham surgery, while the t / MCAO group underwent t / MCAO surgery. Neurological function scores and TTC staining were performed 24 hours later.

[0103] Figure 1 A shows the Western blot detection results of RNF13 expression in brain tissues of WT and KO mice. No RNF13 expression was detected in the brain tissues of the KO group, indicating that RNF13 expression was absent in the KO group.

[0104] Figure 1 B is the result of the neurological function score of mice, which shows that compared with the WT t / MCAO group, the scores of mice in the KO t / MCAO group were significantly increased, indicating that the animals had more severe behavioral disorders and more severe neurological dysfunction.

[0105] Figure 1 C and E are the TTC staining results of brain tissue of animals in each group and the statistical graphs of the infarct volume and edema volume ratio. C shows that no obvious brain tissue damage was observed in the sham group mice, while obvious pale areas were observed in the t / MCAO group, and the pale areas were larger in the KO t / MCAO group, indicating that the damage was more severe. D and E show that compared with the WT t / MCAO group, the infarct and edema volumes of mice in the KO t / MCAO group were significantly increased (** indicates p < 0.01 compared with the WT t / MCAO group), indicating that RNF13 knockout aggravates brain tissue necrosis caused by cerebral ischemia-reperfusion.

[0106] Example 2 Effects of RNF13 knockout on inflammatory response and neuronal apoptosis during stroke in mice

[0107] RNF13-KO and WT mice were divided into two groups: WT t / MCAO group and KO t / MCAO group. T / MCAO surgery was performed, and cells were harvested 24 hours later for pathological analysis and molecular biological testing.

[0108] Figure 2 A shows the immunofluorescence staining results for F4 / 80 and CD11B in mouse brain tissue and the statistical results of positive cells. Compared with the WT t / MCAO group, the KO t / MCAO group showed a greater number of F4 / 80 and CD11B positive cells, indicating that RNF13 deficiency can promote inflammatory cell infiltration during stroke. Figure 2 B is the result of p-p65 immunohistochemical staining of mouse brain tissue. Compared with the WT t / MCAO group, the p-p65 positive signal in the KOt / MCAO group was stronger; Figure 2 C is the Western blot detection result of the expression of NF-κB signaling pathway-related proteins (p-Ikkβ, Ikkβ, IkBα, p-p65, p65) in mouse brain tissue. The expression of p-Ikkβ and p-p65 in the KO t / MCAO group was significantly stronger than that in the WT t / MCAO group, while the expression of IkBα was weaker than that in the WT t / MCAO group. These results indicate that RNF13 deficiency can promote the activation of the NF-κB signaling pathway during stroke. Figure 2 D shows the RT-PCR results for the expression of inflammatory cytokines Tnf, Il6, and Il1b, as well as chemokines Ccl2, Ccl5, and Cxcl10 in mouse brain tissue (** indicates p < 0.01 compared to the WT t / MCAO group). The expression of these cytokines was significantly higher in the KO t / MCAO group than in the WT t / MCAO group. These results suggest that RNF13 deficiency significantly promotes the inflammatory response during stroke.

[0109] Figure 3 A shows the results of NeuN and TUNEL double immunofluorescence staining and the number of positive cells in mouse brain tissue. Compared with the WT t / MCAO group, the KO t / MCAO group showed a greater number of NeuN and TUNEL double-positive cells, indicating that RNF13 deficiency can promote neuronal apoptosis during stroke. Figure 3 B and C show the results of Western blot and RT-PCR analysis of apoptosis-related molecules in mouse brain tissue (** indicates p < 0.01 compared with the WT t / MCAO group). The expression of pro-apoptotic molecules Bad, Bax, C-Caspase3, and Fas in the KO t / MCAO group was significantly higher than that in the WT t / MCAO group, while the expression of anti-apoptotic molecules Bcl2 and Bcl-xl was significantly lower than that in the WT t / MCAO group. These results suggest that RNF13 deficiency significantly promotes apoptosis during stroke.

[0110] Example 3 Effects of RNF13 knockdown on OGD / R-stimulated primary neuronal injury, inflammatory response, and apoptosis

[0111] Neurons infected with RNF13 knockdown adenovirus (AdshRNF3) and control adenovirus (AdshRNA) were subjected to OGD / R stimulation, and then the cells were collected for cell viability, Western blot, and RT-PCR assays.

[0112] Figure 4 A is the Western blot test result of RNF13 protein expression. The expression of RNF13 in the AdshRNF3 group was significantly lower than that in the AdshRNA group, indicating that the adenovirus infection was successful and the expression of RNF13 in the AdshRNF3 group was knocked down. Figure 4 B is the result of cell viability test. The cell viability in the AdshRNF3 OGD / R group was significantly lower than that in the AdshRNA OGD / R group (** indicates p < 0.01 compared with the AdshRNA OGD / R group), indicating that RNF13 knockdown significantly promoted cell damage caused by OGD / R stimulation.

[0113] Figure 5 A is the detection result of mRNA expression levels of cytokines (Tnf, Il6, Il1b and Ccl2). The expression of these cytokines in the AdshRNF3OGD / R group was significantly higher than that in the AdshRNA OGD / R group. Figure 5 B shows the expression and protein quantification of proteins involved in the NF-κB signaling pathway (** indicates p < 0.01 compared to the AdshRNA OGD / R group). Activation of the NF-κB signaling pathway was significantly stronger in the AdshRNF3 OGD / R group than in the AdshRNA OGD / R group. These results suggest that RNF13 knockdown significantly promotes the neuronal inflammatory response induced by OGD / R stimulation.

[0114] Figure 6 Figure 3 shows the mRNA (A) and protein (B) expression levels of apoptosis-related molecules (** indicates p < 0.01 compared to the AdshRNA OGD / R group). The AdshRNF3 OGD / R group showed significantly stronger expression of pro-apoptotic molecules than the AdshRNA OGD / R group, while the expression of anti-apoptotic molecules was significantly lower than that in the AdshRNA OGD / R group. This suggests that RNF13 knockdown significantly promotes neuronal apoptosis induced by OGD / R stimulation.

[0115] Example 4 Effects of RNF13 overexpression on OGD / R-stimulated primary neuronal injury, inflammatory response, and apoptosis

[0116] Neurons infected with RNF13 overexpressing adenovirus (AdRNF3) and control adenovirus (AdGFP) were subjected to OGD / R stimulation, and then cells were collected for cell viability, Western blot, and RT-PCR assays.

[0117] Figure 7 A is the Western blot detection result of RNF13 protein expression. Obvious RNF13 overexpression signal was detected in the AdRNF3 group, indicating that adenovirus infection was successful and the expression of RNF13 in the AdRNF3 group was significantly enhanced. Figure 7 B is the cell viability test results (** indicates p < 0.01 compared with the AdGFP OGD / R group). The cell viability in the AdRNF3 OGD / R group was significantly higher than that in the AdGFP OGD / R group, indicating that RNF13 overexpression significantly inhibited the cell damage caused by OGD / R stimulation.

[0118] Figure 8 A is the detection result of mRNA expression levels of cytokines (Tnf, Il6, Il1b and Ccl2). The expression of these cytokines in the AdRNF3 OGD / R group was significantly lower than that in the AdGFP OGD / R group. Figure 8 B shows the expression and quantification of proteins related to the NF-κB signaling pathway (** indicates p < 0.01 compared with the AdGFP OGD / R group). Activation of the NF-κB signaling pathway in the AdRNF3 OGD / R group was significantly weaker than that in the AdGFP OGD / R group. These results suggest that RNF13 overexpression significantly inhibits the neuronal inflammatory response induced by OGD / R stimulation.

[0119] Figure 9 9A is the mRNA expression level detection result of apoptosis-related molecules. Figure 9 B shows the expression of apoptosis-related proteins and protein quantification results (** indicates p < 0.01 compared with the AdGFP OGD / R group). The expression of pro-apoptotic molecules in the AdRNF3 OGD / R group was significantly weaker than that in the AdGFP OGD / R group, while the expression of anti-apoptotic molecules was significantly stronger than that in the AdshRNA OGD / R group. This suggests that RNF13 overexpression significantly inhibits neuronal apoptosis induced by OGD / R stimulation.

[0120] Research results showed that in mice with RNF13 knockout after stroke caused by middle cerebral artery occlusion, infarct volume increased significantly, neurological function deteriorated significantly, inflammatory responses were enhanced, and the number of apoptotic neurons increased significantly. RNF13 knockdown promoted OGD / R-induced neuronal damage, inflammatory responses, and apoptosis; whereas RNF13 overexpression inhibited OGD / R-induced neuronal damage, inflammatory responses, and apoptosis. This suggests that RNF13 can protect neuronal function and improve stroke outcomes. RNF13 plays an important protective role in stroke models and has great potential for the development of therapeutic drugs for stroke.

[0121] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. Use of an RNF13 expression promoter in the preparation of a drug for preventing or treating stroke, wherein the RNF13 expression promoter is an adeno-associated virus vector, a lentivirus vector, an adenovirus vector or a retrovirus vector that overexpresses RNF13.

2. The use according to claim 1, characterized in that The RNF13 expression promoter is an adenoviral vector that overexpresses RNF13, and the construction process uses primers containing nucleotide sequences as shown in SEQ ID NO: 7-8.

3. The use according to claim 1, characterized in that The drug is administered by injection.

4. The use according to claim 1, characterized in that The medicine also includes at least one of a thrombolytic drug, an antiplatelet aggregation drug, an anticoagulant drug, a fiber-reducing drug, and a neuroprotective agent.

5. The use according to claim 1, characterized in that The drug also includes pharmaceutically acceptable excipients.

Citation Information

Patent Citations

  • Methods of distinguishing ischemic stroke from intracerebral hemorrhage

    US20180230538A1

  • Differential expression of molecules associated with intra-cerebral hemorrhage

    WO2008008846A2