Probiotic crystal ball capable of improving shelf life stability and preparation method of probiotic crystal ball

Abstract

The invention belongs to the technical field of probiotic preparations and application, and particularly provides probiotic crystal balls capable of improving shelf life stability and a preparation method of the probiotic crystal balls. The probiotic crystal ball is of a three-layer embedding structure, and the probiotic crystal ball comprises lactobacillus plantarum (Lactobacillus plantarum) and bifidobacterium lactis (Bifidobacterium lactis), and is characterized in that the probiotic crystal ball is of a three-layer embedding structure, and the three-layer embedding structure comprises the lactobacillus plantarum (Lactobacillus plantarum) and the bifidobacterium lactis (Bifidobacterium lactis). The probiotic crystal ball can powerfully protect the viable bacteria quantity stability of probiotic original bacteria powder, and the DT value is increased by 3.5 times. Meanwhile, the crystal ball can effectively improve the endurance capacity of the original probiotic powder to the artificial gastrointestinal fluid, the initial viable count of the crystal ball is 10.35 Log CFU / g, the viable count after digestion of the artificial gastrointestinal fluid is 10.32 Log CFU / g, and the viable count is kept stable. Besides, the crystal ball is stable in structure, the form of the crystal ball is not changed after the crystal ball is preserved at 40 DEG C for 8 days, oil leakage or rubber adhesion is avoided, damage caused by various digestive enzymes, highly acidic gastric juice and gastric wall mechanical pressure can be effectively resisted, and storage and transportation of the crystal ball are facilitated.

Description

Technical Field

[0001] The invention belongs to the technical field of probiotic preparations and applications, and particularly relates to a probiotic crystal ball with improved shelf life stability and a preparation method thereof. Background Art

[0002] As the scientific community deepens its research on intestinal flora, the important role of probiotics in improving human health has gradually been recognized by the world. The World Health Organization and the Food and Agriculture Organization of the United Nations have defined probiotics as follows: Probiotics are living microorganisms that can benefit the health of the host when administered in sufficient quantities. Probiotics play a role in the gastrointestinal tract by regulating intestinal flora, releasing active substances, and inhibiting the growth of harmful bacteria. Therefore, the activity of probiotics should be stable and able to survive in large quantities in the digestive tract. During processing, transportation, and storage, probiotics are affected by temperature, humidity, and oxygen, and their activity is lost, which seriously affects their application and efficacy. After entering the human body, probiotics first undergo the test of gastric acid. The pH in the gastric environment is ≤2.5. The survival ability of probiotics under this condition is weak, and the number of live bacteria will drop significantly. In order to be able to regulate intestinal flora, probiotics should also have the characteristics of bile salt tolerance, so that they can colonize in the intestine and then exert their efficacy. In view of this, it is urgent to develop novel and effective delivery technologies to improve the survival of probiotics during storage and transportation and in the gastrointestinal tract.

[0003] Conventional formulation technologies for probiotics mainly include emulsions, powders and gels. The probiotics in the emulsion are in direct contact with water, resulting in poor long-term storage stability; the activity of the powder is affected due to high temperature or destruction of the cell structure during the production process; the gel cannot maintain a high probiotic digestive activity due to its large pores and poor physical isolation.

[0004] Probiotic crystal balls are a kind of probiotic targeted delivery technology made by further upgrading the equipment and process on the basis of compressed pill capsules through high-precision concentric dripping pill technology. High-precision concentric dripping pill technology uses double-layer or more drippers to simultaneously flow out the shell and core materials, which enter the cooling circulation system after pulse cutting, and the surface shell hardens and forms a crystal ball. Compared with traditional compressed pill capsules, the crystal balls prepared by concentric dripping pills have the characteristics of controllable structure, adjustable size, and excellent taste. At the same time, the water content in the crystal ball is extremely low, which can place the probiotics in a completely independent lipid environment, isolating the influence of factors such as oxygen and moisture on the activity of probiotics. Summary of the invention

[0005] The object of the present invention is to provide a probiotic crystal ball with improved shelf life stability and a preparation method thereof. The probiotic crystal ball has a three-layer embedding structure, contains Lactiplantibacillus plantarum and Bifidobacterium lactis, and can significantly improve the shelf life stability.

[0006] One aspect of the present invention relates to a probiotic crystal ball, which comprises Lactobacillus plantarum powder and Bifidobacterium lactis powder.

[0007] The mass ratio of Lactobacillus plantarum powder to Bifidobacterium lactis powder in the probiotic crystal ball is 1:1.

[0008] The plant lactobacillus is Lactiplantibacillus plantarum VHProbi SY, which was deposited in the China Type Culture Collection of Wuhan University, Wuhan, China on October 26, 2022, and its deposit number is CCTCC NO: M20221666.

[0009] The Bifidobacterium lactis is the VHProbi YB11 strain of Bifidobacterium lactis, which has been deposited in the China Center for Type Culture Collection on July 19, 2021, and its preservation number is CCTCCNO: M2021905.

[0010] The probiotic crystal ball is composed of three parts from the inside to the outside, namely, a core layer, a middle oil layer and a rubber layer.

[0011] The mass ratios of the core layer, the middle oil layer and the rubber layer of the probiotic crystal ball are 1:6:13 respectively.

[0012] The core layer is composed of non-hydrogenated vegetable oil, plant lactobacillus powder and lactobacillus powder, and the mass ratio thereof is 2:1:1;

[0013] The middle oil layer is composed of non-hydrogenated vegetable oil, hydroxypropyl methylcellulose and stearic acid, with a mass ratio of 18:1:1;

[0014] The rubber skin is composed of gelatin, chitosan, gum arabic, erythritol and purified water, and the mass ratio thereof is 5:3:4:3:35.

[0015] The present invention also relates to a method for preparing the probiotic crystal sphere, comprising the following steps:

[0016] (1) Preparation of core liquid

[0017] Dissolve the non-hydrogenated vegetable oil at a temperature of 30°C-35°C until it is clear, add Lactobacillus plantarum VHProbi SY powder and Bifidobacterium lactis VHProbi YB11 powder, stir with a stirrer at 200 rpm for 15 minutes to mix and disperse the powder in the non-hydrogenated vegetable oil to obtain a crystal ball core layer liquid; pour the core layer liquid into a core layer liquid storage tank of a capsule machine, and set the storage tank temperature to maintain at 30°C-35°C;

[0018] (2) Preparation of intermediate oil layer fluid

[0019] Heat the non-hydrogenated vegetable oil at a temperature of 37°C-42°C, add the sustained-release agent hydroxypropyl methylcellulose and stearic acid, mix them by a homogenizer to obtain an intermediate oil layer liquid; pour it into the intermediate oil layer liquid storage tank of the capsule machine, and set the storage tank temperature to maintain at 37-42°C;

[0020] (3) Rubber liquid preparation

[0021] Add gelatin to purified water, stir to dissolve it in a water bath at 70°C, then add chitosan, erythritol and gum arabic in proportion, continue heating in a water bath at 70°C, stir to dissolve, and obtain a gelatin solution; pour it into the gelatin solution storage tank of the capsule machine, and set the storage tank temperature to maintain at 70°C;

[0022] (4) Preparation of probiotic crystal spheres

[0023] The core layer liquid, the middle oil layer liquid and the rubber liquid are respectively added into a pill machine with three layers of concentric nozzles, wherein the innermost nozzle sprays the core layer liquid, the middle nozzle sprays the middle oil layer liquid, and the outer nozzle sprays the rubber liquid; after starting the pill machine switch, the nozzle speed is adjusted appropriately so that the three layers of nozzles spray the crystal ball components simultaneously and drip into the water cooled to 12°C, thereby producing a 3-layer crystal ball with a diameter of 1.5-2.5mm; after the crystal balls are dropped into shape, they are dried at 16°C for 20 hours, and then vacuum-freeze-dried for 36 hours to reduce the moisture content to below 1.5%, thereby obtaining a finished probiotic crystal ball.

[0024] The invention also relates to application of the probiotic crystal sphere in food production.

[0025] The probiotic crystal ball provided by the present invention can effectively protect the stability of the live bacteria amount of the probiotic original bacterial powder. T The value increased by 3.5 times. At the same time, the crystal ball can effectively improve the tolerance of the probiotic original bacterial powder to artificial gastrointestinal fluid. The initial live bacteria amount of the crystal ball is 10.35Log CFU / g, and the live bacteria amount after digestion by artificial gastrointestinal fluid is 10.32Log CFU / g, and the live bacteria amount remains stable. In addition, the crystal ball has a stable structure. After being stored at 40°C for 8 days, the morphology has not changed, and there is no oil leakage or rubber adhesion, which is conducive to its storage and transportation.

[0026] The Lactobacillus plantarum VHProbi SY in the probiotic crystal ball has a strong degradation effect on intestinal indole, can significantly degrade indole in vitro, and the degradation rate in 48 hours is 58.14%; it has strong antioxidant ability and cholesterol degradation ability, the scavenging rates of DPPH free radicals and HRS free radicals are as high as 89.02% and 90.12% respectively, and the degradation rate of cholesterol reaches 78.79%. The anti-lipid peroxidation inhibition rates of the fermentation supernatant, bacteria and intracellular extract of Lactobacillus plantarum VHProbi SY are 72.99%, 82.82% and 89.09% respectively.

[0027] The lactobacillus VHProbi YB11 has strong acid resistance and strong tolerance to simulated artificial gastrointestinal fluid. After digestion in artificial gastric fluid for 2 hours, its survival rate is as high as 100%. After digestion in artificial intestinal fluid for 3 hours, it can still retain a high amount of live bacteria, and can smoothly pass through the gastrointestinal tract and colonize in the colon to play a probiotic function. The strain has strong antioxidant ability, and the scavenging rates of DPPH free radicals and HRS free radicals are 25.94% and 66.45% respectively, and the supernatant anti-lipid peroxidation inhibition rate is 73.12%; it can effectively adsorb aflatoxin B1, and the adsorption rate is 8.29%. The strain can effectively improve the intestinal environment and prevent or relieve constipation symptoms.

[0028] The probiotic crystal sphere provided by the invention can be widely used in food production and has broad prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 is a growth curve of Lactobacillus plantarum VHProbi SY in a medium containing indole;

[0030] Figure 2 is the colony morphology of Lactobacillus plantarum VHProbi SY;

[0031] Figure 3 is the Riboprinter fingerprint of Lactobacillus plantarum VHProbi SY;

[0032] Figure 4 is the RAPD fingerprint of Lactobacillus plantarum VHProbi SY;

[0033] Figure 5 is the rep-PCR fingerprint of Lactobacillus plantarum VHProbi SY;

[0034] Figure 6 It is the MALDI-TOF-MS protein fingerprint of Lactobacillus plantarum VHProbi SY;

[0035] Figure 7The stability comparison test results of probiotics original powder and crystal spheres;

[0036] Figure 8 These are the test results of the crystal ball’s heat-resistant structural stability. DETAILED DESCRIPTION

[0037] Through multiphase taxonomic identification, the Lactobacillus plantarun VHProbi SY (Lactiplantibacillus plantarun VHProbi SY) screened and obtained in the present invention is a new strain of Lactobacillus plantarum, which was deposited in the China Type Culture Collection of Wuhan University, Wuhan, China on October 26, 2022, and its preservation number is CCTCC NO: M20221666.

[0038] The Bifidobacterium lactis described in the embodiments of the present invention is the Bifidobacterium lactis VHProbi YB11 strain, which has been deposited in the China Center for Type Culture Collection on July 19, 2021, and its deposit number is CCTCCNO: M2021905.

[0039] The bifidobacterium lactis VHProbi YB11 is a new type of bifidobacterium lactis with strong acid resistance and strong tolerance to simulated artificial gastrointestinal fluid. After digestion in artificial gastric fluid for 2 hours, its survival rate is as high as 100%. After digestion in artificial intestinal fluid for 3 hours, it can still retain a high amount of live bacteria and can smoothly pass through the gastrointestinal tract and colonize in the colon to play a probiotic function. The strain has strong antioxidant ability, and the scavenging rates of DPPH free radicals and HRS free radicals are 25.94% and 66.45% respectively, and the supernatant anti-lipid peroxidation inhibition rate is 73.12%. The strain can also effectively adsorb aflatoxin B1 with an adsorption rate of 8.29%.

[0040] The Bifidobacterium lactis can significantly increase the water content of mouse feces and improve the transport capacity of the small intestine of constipated mice, thereby promoting defecation and improving constipation symptoms; it can effectively regulate the secretion of gastrointestinal regulatory peptides, promote the secretion of excitatory transmitters motilin, gastrin and substance P, and reduce the secretion of inhibitory transmitters somatostatin-1 and vasoactive intestinal peptide to achieve effective regulation of gastrointestinal motility and gastric acid secretion, thereby alleviating constipation symptoms.

[0041] The Bifidobacterium lactis can prevent and alleviate the intestinal barrier damage caused by constipation, reduce inflammatory response, and make the intestinal mucosal barrier complete.

[0042] The Bifidobacterium lactis can significantly improve the richness and uniformity of the fecal flora of constipated mice, make the abundance of beneficial bacteria such as Lactobacillus and Bifidobacterium at the genus level tend to the flora characteristics of blank group mice, reduce the difference in flora composition, and make the community structure composition similar to that of the blank group, tending to the level of normal mice.

[0043] The Bifidobacterium lactis VHProbi YB11 can be used as a source of food raw materials, has no side effects and overdose risks when taken for a long time, has no toxic effects on the body, can be used alone, or can be used in combination with prebiotics and / or other probiotics, and is expected to be developed into a food, health product or medicine with the effect of preventing or relieving constipation, and has broad application prospects.

[0044] The present invention is described in detail below in conjunction with specific embodiments and drawings.

[0045] Example 1 Screening of strains

[0046] 1. Strain Isolation

[0047] Prepare MRS (Man Rogosa Sharpe) broth: 1L of pure water, 10g of peptone, 10g of beef extract, 5.0g of yeast extract, 5g of sodium acetate, 5g of glucose, 2g of potassium dihydrogen phosphate, 1.0mL of Tween 80, 2.0g of diammonium citrate, 20g of calcium carbonate, 0.58g of magnesium sulfate heptahydrate, 0.25g of manganese sulfate heptahydrate, and adjust the pH to 6.2-6.5.

[0048] Prepare MRS agar medium: add 15 g agar to 1 L MRS broth.

[0049] Take 1g of fresh naturally fermented kimchi fermentation liquid, dilute it with sterile physiological saline, put it into a sterile sample bag, beat it with a homogenizer, take 100μL of the mixed liquid for gradient dilution, spread it on MRS agar medium, and culture it anaerobically at 37℃ for 48h, and wait for single colonies to grow on the plate for microscopic examination. According to the results of microscopic examination, the applicant screened out 12 potential lactic acid bacteria single colonies, named A1, A2, ..., A11, A12 respectively.

[0050] 2. In vitro screening of indole-degrading strains

[0051] 2.1 Preparation

[0052] Preparation of indole solution: Use 70% ethanol to prepare 30 mg / ml indole stock solution, sterilize with 0.22 μm filter membrane and set aside for use. When using, dilute with strain culture medium to the required concentration.

[0053] Strain preparation: streak the screened or activated single colony of lactic acid bacteria, take the frozen lactic acid bacteria glycerol tube, aseptically streak it onto the MRS plate, and culture it at 37℃ for 48 to 72 hours.

[0054] Preparation of lactic acid bacteria solution: After a single colony grows on the plate, aseptically pick it into MRS broth and culture it at 37℃ for 24 hours. Inoculate it into fresh MRS broth at a 1% inoculum volume, about 6 ml for each strain.

[0055] 2.2 Tolerance test of strains to different concentrations of indole

[0056] Indole was diluted to 0, 50, 100, 200, 300, 400, 600 μg / ml with the strain culture medium, and the strain was inoculated at 1% inoculation volume, and the growth curve of the strain was monitored by an ELISA instrument. The results showed that the strain activity was not affected when the medium contained low concentrations of indole, and even slightly promoted the growth of the strain. When the indole content in the culture medium was close to 300 μg / ml, the strain activity was inhibited. At the same time, according to the data, the indole content of human intestine or feces was 0.25-2.6mM, which was about 45-468 μg / ml. Therefore, 300 μg / ml was used as the indole addition concentration to verify the indole degradation ability of the strain during screening.

[0057] 2.3 Detection of the ability of strains to metabolize indole

[0058] Add indole to the fresh medium containing 1% strain to make the final concentration of 300 μg / ml. Take 1.5 ml of the medium into a new EP tube at 0h, 24h, and 48h after adding indole, centrifuge at 10000g / min for 3min, collect the supernatant, and use the indole detection kit to detect the indole content in the supernatant. The operation method and result determination are carried out according to the Indole Assay Kit instructions.

[0059] Calculation of indole degradation rate: indole degradation rate = (initial concentration - final concentration) / initial concentration × 100%.

[0060] The results showed that among the 12 potential lactic acid bacteria isolated by the present invention, 8 strains had a 24-hour indole degradation rate of more than 30%, among which A3 had a 24-hour indole degradation rate of 34.42±3.33%; 3 strains had a 48-hour indole degradation rate of more than 50%, among which A3 had a 48-hour indole degradation rate of 58.14±1.27%, the highest among all strains. The growth curve of strain A3 in different indole concentrations is shown in FIG. Figure 1 shown.

[0061] Example 2 Strain Identification

[0062] 1. Colony morphology identification

[0063] The A3 strain was inoculated on MRS agar medium and cultured anaerobically at 37°C for 24 hours. The colony morphology of the A3 strain was as follows: Figure 2As shown, single colonies are milky white, with diameters of mostly more than 1.0 mm and a smooth surface. Under the microscope, the bacteria appear as long rods of uneven length, arranged singly or in pairs or chains.

[0064] 2. Identification of physiological and biochemical characteristics

[0065] The inoculation solution in this example was prepared as follows: Under sterile conditions, an appropriate amount of fresh bacterial solution of the A3 strain was taken, centrifuged at 5000 rpm / min for 5 min, washed twice with PBS buffer, and then resuspended with the same volume of PBS buffer and diluted 50 times to serve as the inoculation solution.

[0066] 2.1. Salinity tolerance test

[0067] Under sterile conditions, 190 μL of BSM liquid culture medium with salt concentrations of 1%, 2%, 3%, 4%, 5%, 6%, 7%, and 8% was added to the 96-well plate, and 3 parallels were made for each salt concentration. Then 10 μL of inoculation solution was added, and the wells without bacteria were used as controls. 50 μL of autoclaved paraffin oil was added to each well to prevent water evaporation during the culture process. Place it at a constant temperature of 37°C and observe whether the culture medium becomes turbid. The results showed that the maximum tolerance salt concentration of the A3 strain was 5%.

[0068] 2.3 Carbon source metabolism test

[0069] The API 50CHL reagent strip was used to conduct a carbon source metabolism experiment on the A3 strain. The experimental method and result interpretation are detailed in the API 50CHL kit manual. The identification result of the A3 strain was: %ID=99.9 and T value=0.79. The API result was Lactobacillus plantarum. The results are shown in Table 1.

[0070] Table 1: API 50CHL test results of strains

[0071]

[0072]

[0073] 2.4 Glucose acid and gas production test

[0074] The culture medium formula used in this example is as follows:

[0075] Peptone 0.5 g; yeast extract 0.3 g; Tween 80 0.1 mL; saline solution A 0.5 ml; saline solution B 0.5 ml; sodium acetate 0.5 g; glucose 2.5 g; 2% bromocresol green (w / v) 0.05 mL; distilled water 100 ml; pH 6.8-7.0.

[0076] The prepared culture medium was dispensed into a large test tube containing an inverted small test tube, 3 mL / tube, and sterilized under high pressure at 121°C for 15 min.

[0077] Salt solution A ingredients: KH2PO4 10g, K2HPO4 1.0g, dissolved in distilled water and made up to 100mL.

[0078] Salt solution B ingredients: MgSO4·7H2O 11.5g, MnSO4·2H2O 2.4g, FeSO4·7H2O 0.68g, dissolved in distilled water and fixed to 100mL.

[0079] Under sterile conditions, inoculate the culture medium with 10% of the inoculum and use the uninoculated culture medium as a control. Then seal the top with 2 mL of sterile liquid paraffin and culture at 37°C for 24 hours to observe whether the culture medium changes in color.

[0080] The results showed that after culturing at 37°C for 24 hours, the culture medium changed from green to yellow and there was no gas in the small inverted tube, indicating that the A3 strain fermented glucose to produce acid but not gas.

[0081] 3. Molecular Biology Identification

[0082] 3.1 16S rDNA gene sequence analysis

[0083] 3.1.1 Genomic DNA extraction

[0084] The operation was performed according to the Tiangen Bacteria Genomic DNA Extraction Kit (Catalog Number: DP302).

[0085] 3.1.2. 16S rDNA gene amplification

[0086] Primer sequences:

[0087] 27F: AGAGTTTGATCCTGGCTCA (SEQ ID NO: 1);

[0088] 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO: 2).

[0089] The 16s rDNA sequence SEQ ID NO: 3 of the A3 strain was obtained by sequencing, and the sequence was compared with the NCBI database, and the A3 strain was preliminarily determined to be Lactobacillus plantarum.

[0090] 3.2Riboprinter fingerprint

[0091] Use a bacterial stick to pick up a single colony of the purified A3 strain from the agar medium plate, put it into a sample tube with buffer, stir it with a handheld stirrer to suspend it in the buffer, then put the sample rack into the heater to inactivate it and put it into the Riboprinter system. After DNA preparation, membrane transfer, imaging detection and data processing, the bacterial identification results are obtained. The identification results show that the A3 strain is Lactobacillus plantarum, and its Riboprinter fingerprint results are shown in Figure 3 .

[0092] 3.3 RAPD and rep-PCR fingerprint identification

[0093] 3.3.1 RAPD fingerprint identification

[0094] Primer sequence: GAGGGTGGCGGTTCT (SEQ ID NO: 4).

[0095] Table 2: RAPD reaction system table

[0096]

[0097] Prepare a 1.5% agarose gel plate, use DL2000 DNA Marker as the result control, and keep the voltage at 100V for 80 minutes. Finally, use the gel imaging system to detect the electrophoresis pattern. Figure 4 shown.

[0098] 3.3.2 rep-PCR fingerprint

[0099] Primer sequence: CTACGGCAAGGCGACGCTGACG (SEQ ID NO: 5).

[0100] Reaction system of rep-PCR

[0101] Table 3: Rep-PCR reaction system

[0102]

[0103]

[0104] DL2000 DNA Marker was used as a control. The voltage was 100 V and the electrophoresis time was 80 min to detect the amplification results. The rep-PCR fingerprint of strain A3 is shown in Figure 5 shown.

[0105] 3.4 MALDI-TOF-MS detection of ribosomal protein expression

[0106] Inoculate fresh bacterial liquid in MRS liquid culture medium at a 0.1% inoculation rate, culture at 37°C, 150rpm for 48 hours, collect the bacteria, wash with sterile water 4 times, and dry the surface moisture. Then take a small amount of fresh bacteria and evenly apply it on the target plate in the form of a thin film, add 1μL of lysis solution to cover the sample, and after drying, add 1μL of matrix solution to cover the sample. After drying, put the sample target into the mass spectrometer for identification. Irradiate the co-crystallized film formed by the sample and the matrix with a laser to ionize the protein in the sample. The ions are accelerated to fly through the flight channel under the action of a 10-20KV electric field, and the molecular weight of the protein is detected according to the different flight times reaching the detector. The protein fingerprint map was obtained using Autofms 1000 analysis software Autof Analyzer v1.0. The ion peaks of the main ribosomal proteins of the A3 strain are: m / z4700.168, 5893.391, 9400.959. The identification results are as follows Figure 6 shown.

[0107] 3.5 Whole genome sequencing

[0108] Inoculate fresh bacterial liquid in MRS liquid medium at 0.1% inoculation volume, culture at 37℃ for 20h, centrifuge at 8000rpm for 10min, and collect the bacteria. The bacteria were sent to the sequencing center to obtain the whole genome sequence of the bacteria. The genome sequence has been uploaded to the NCBI gene database. Its genome contains 1 chromosome and 2 plasmids. The GenBank accession numbers are CP134220, CP134221, and CP134222.

[0109] Combined with the colony morphology, physiological and biochemical characteristics and molecular biological identification results of strain A3, strain A3 was determined to be a new strain of Lactobacillus plantarum and named Lactobacillus paracasei VHProbi SY.

[0110] Example 3 Antibiotic tolerance test of Lactobacillus plantarum VHProbi SY

[0111] The specific results of the minimum inhibitory concentration (MIC) values ​​of antibiotics against Lactobacillus plantarum VHProbi SY determined by the microbroth dilution method are shown in Table 4.

[0112] Table 4: Antibiotic MIC values ​​of Lactobacillus plantarum VHProbi SY

[0113]

[0114]

[0115] MIC unit: μg / mL.

[0116] From the results in Table 4, it can be seen that the Lactobacillus plantarum VHProbi SY provided by the present invention is sensitive to common antibiotics such as erythromycin, ampicillin and clindamycin, and has good biosafety.

[0117] Example 4 Determination of the antioxidant function of Lactobacillus plantarum VHProbi SY

[0118] 1. Determination of the ability of strains to remove DPPH (1,1-diphenyl-2-trinitrophenylhydrazine)

[0119] A single colony of Lactobacillus rhamnosus VHProbi M12 with good growth status was inoculated into 3 mL of MRS liquid culture medium, cultured at 37°C for 18-20 hours, and the culture solution was used as the inoculum, inoculated into 50 mL of MRS liquid culture medium at a 2% inoculum amount, and cultured for 18 hours to obtain the culture solution of the strain. After collecting the bacterial cells by absorbing 1 mL of bacterial solution, the bacterial cells were washed twice with 1 mL of PBS buffer, and then 2 mL of PBS solution was added to resuspend the bacterial cells to obtain a bacterial suspension.

[0120] Take 1mL of Lactobacillus plantarum VHProbi SY suspension, add 1mL of 0.4mM DPPH free radical solution, mix well and then place it at room temperature for 30min in the dark, then measure the absorbance of the sample at a wavelength of 517nm A sample, measure 3 times in parallel. The control group sample is zeroed with an equal volume of PBS solution and DPPH·ethanol mixture, and an equal volume of Lactobacillus plantarum VHProbi SY suspension and ethanol mixture.

[0121] The clearance rate was calculated according to the following formula:

[0122] Clearance % = [1-(A 样品 -A 空白 ) / A 对照 ]×100%.

[0123] The results are shown in Table 5.

[0124] Table 5: Scavenging effect of Lactobacillus plantarum VHProbi SY on DPPH free radicals

[0125]

[0126] 2. Determination of the ability of strains to eliminate HRS

[0127] After mixing 100 μL of 5 mM sodium salicylate-ethanol solution, 100 μL of 5 mM ferrous sulfate, 500 μL of deionized water and 200 μL of Lactobacillus plantarum VHProbi SY bacterial suspension, 100 μL of hydrogen peroxide solution (3 mM) was added, and the sample was incubated in a water bath at 37° C. for 15 min, and the absorbance of the sample was measured at a wavelength of 510 nm.

[0128] The hydroxyl radical scavenging rate was calculated according to the following formula.

[0129] Clearance % = (A 样品 -A 控制 ) / (A 空白 -A 控制 )×100%.

[0130] Among them: A 控制 Deionized water was used as a substitute for the sample. 空白 Replace sample and H2O2 with deionized water.

[0131] The specific results are shown in Table 6.

[0132] Table 6: Effect of Lactobacillus plantarum VHProbi SY on the elimination of HRS

[0133]

[0134] 3. Identification of strains against lipid peroxidation

[0135] 1) Strain culture and preparation of fermentation supernatant, bacterial cells and intracellular extracts:

[0136] The plant lactobacillus VHProbi SY strain was cultured in MRS liquid medium at 37°C for 24 hours. After three generations, the culture was centrifuged at 6000r / min and 4°C for 10 minutes, and the supernatant was collected as the fermentation supernatant. The collected cells were centrifuged at 6000r / min for 10 minutes with PBS buffer (pH 7.4) and washed three times. The cells were resuspended in PBS buffer and the cell concentration was adjusted to 1.0×10 9 cells / mL, and obtain bacterial suspension. The bacterial suspension was ultrasonically disrupted by ultrasonication for 20 minutes to obtain intracellular extract.

[0137] (2) Preparation of linoleic acid emulsion:

[0138] 0.1 mL linoleic acid, 0.2 mL Tween 20, 19.7 mL deionized water.

[0139] (2) Experimental process

[0140] To 0.5 mL of PBS solution (pH 7.4), add 1 mL of linoleic acid emulsion and 1 mL of FeSO4 (1%), then add 0.5 mL of sample and incubate in a 37°C water bath for 1.5 h. Add 0.2 mL of TCA (4%) and 2 mL of TBA (0.8%) to the mixture and incubate in a 100°C water bath for 30 min. Cool rapidly and centrifuge at 4000 rpm / min for 15 min. Collect the supernatant and measure the absorbance at 532 nm to obtain A. The control group was replaced with 0.5 mL of distilled water to obtain A0.

[0141] Inhibition rate / %=(A0-A) / A0×100%.

[0142] Note: A is the absorbance of the sample group; A0 is the absorbance of the control group.

[0143] Table 7: Anti-lipid peroxidation inhibition effect of Lactobacillus plantarum VHProbi SY

[0144]

[0145] Example 5 Surface hydrophobicity test of Lactobacillus plantarum VHProbi SY

[0146] After activating the MRS liquid culture medium of strain A3, aspirate 1 ml of bacterial solution and centrifuge at 6000 rpm for 2 minutes. Collect the bacteria and rinse them twice with PBS solution. Resuspend the bacteria with 1 ml of sterilized 0.1M KNO3 solution. Dilute the bacterial suspension three times and record OD600 as A0. Add one-third volume of xylene to the bacterial suspension, mix well and let stand at room temperature for 10 minutes (a two-phase system is formed at this time). Vortex the two-phase system for 2 minutes and then let stand for 20 minutes to re-form the aqueous phase and organic phase. Carefully aspirate the aqueous phase and measure the absorbance A1 at OD600nm. Calculate the cell hydrophobicity according to the following formula and take the average value of three experiments.

[0147] Hydrophobicity (%) = (A0-A1) / A1 x 100%.

[0148] The results showed that the surface hydrophobicity of strain A3 was 69.18%±2.45%.

[0149] Example 6 In vitro cholesterol degradation test with Lactobacillus plantarum VHProbi SY

[0150] 1. Qualitative test of bile salt enzyme activity

[0151] Preparation of bile salt-containing MRS solid plates: Add 0.2% TCA, 0.2% sodium thioglycolate, 0.37 g / L CaCl2 and 1.5% agar to freshly prepared MRS liquid medium, sterilize at 121°C for 15 min, pour into plates, and condense for later use.

[0152] Preparation of MRS solid plates: Sterilize fresh MRS medium at 121℃ for 15 min, pour into the plate and condense for later use.

[0153] Lactobacillus plantarum VHProbi SY was streaked on an MRS plate for isolation and purification. A single colony was taken for identification and then streaked on an MRS plate and an MRS plate containing bile salts. The results were observed after culturing at 37°C for 72 hours and photographed for archiving.

[0154] The results showed that there was no difference between the streaked colonies on the two plates, and no other substances were produced next to the colonies, indicating that the bile salt enzyme activity of Lactobacillus plantarum VHProbi SY was negative.

[0155] 2. Cholesterol degradation test

[0156] Preparation of cholesterol micelle solution: Accurately weigh 1 g of cholesterol, dissolve it in anhydrous ethanol, and make up to 100 mL. Filter and sterilize it with a 0.22 μm microporous filter membrane under sterile conditions.

[0157] Weigh 10.0 g of peptone, 10.0 g of beef extract, 5.0 g of yeast extract, 2.0 g of diammonium hydrogen citrate, 20.0 g of glucose, 1.0 mL of Tween 80, 5.0 g of sodium acetate, 0.1 g of magnesium sulfate, 0.05 g of manganese sulfate, 2.0 g of dipotassium hydrogen phosphate, 1 g of bile salt, and 1000 mL of distilled water, adjust the pH to 7.3, sterilize at 115°C for 30 min, and then add cholesterol solution to make the final cholesterol concentration 0.1%.

[0158] Inoculate fresh Lactobacillus plantarum VHProbi SY culture at a 0.1% inoculum volume, culture at 37°C for 48 hours, then take 0.2 mL of culture, add 1.8 mL of anhydrous ethanol, mix, let stand for 10 minutes, centrifuge at 3000 rpm for 5 minutes, and take the supernatant for cholesterol determination. The cholesterol determination method is in accordance with GB / T5009.128-2016 <Determination of cholesterol in food>.

[0159] The results showed that the degradation rate of cholesterol by Lactobacillus plantarum VHProbi SY provided by the present invention reached 78.79% (this data does not contain bile salts).

[0160] Example 7 Intestinal cell adhesion test of Lactobacillus plantarum VHProbi SY

[0161] Caco-2 cells were grown at 2×10 6 The inoculum volume of cells / well was inoculated into a six-well plate and cultured in a carbon dioxide incubator for 24 h for cell adhesion experiments. The stable phase Lactobacillus plantarum VHProbi SY strain was resuspended in MRS medium to 5×10 7CFU / mL; take 1mL of the above strain and add it to the six-well plate with cells attached to the wall, and culture it in a carbon dioxide incubator for 2h; wash it repeatedly with PBS for 3 times to remove the non-adherent bacteria; add 500μl of trypsin to digest for 3 minutes, then add 1.5mL of cell culture medium to terminate the digestion, blow it repeatedly, and collect the resulting solution into a sterile EP tube, and dilute the collected solution by 10 times, 100 times, 1000 times, and 10000 times, and count it on the plate. At the same time, count the cells in the blank group. Calculate the adhesion ability of the test strain according to the following formula:

[0162] Adhesion capacity (CFU / cells) = total number of bacteria adhered to each culture well / total number of cells in each culture well.

[0163] The results showed that the adhesion ability of Lactobacillus plantarum VHProbi SY was 55.79 and the standard deviation was 1.31.

[0164] Example 8 A composite probiotic crystal ball and its preparation method

[0165] The probiotic crystal ball prepared in this example is composed of a core layer, an intermediate oil layer and a rubber layer, and the mass ratios thereof are 1:6:13 respectively. Among them:

[0166] The core layer is composed of non-hydrogenated vegetable oil, Lactobacillus plantarum VHProbi SY powder and Bifidobacterium lactis VHProbiYB11 powder, with a mass ratio of 2:1:1, and the amount of live bacteria in the powder is not less than 10 10 CFU / g;

[0167] The middle oil layer is composed of non-hydrogenated vegetable oil, hydroxypropyl methylcellulose and stearic acid, with a mass ratio of 18:1:1;

[0168] The rubber skin is composed of gelatin, chitosan, gum arabic, erythritol and purified water, and the mass ratio thereof is 5:3:4:3:35.

[0169] (1) Preparation of core liquid

[0170] Dissolve the non-hydrogenated vegetable oil at a temperature of 30°C-35°C until it is clear, add the bacterial powders of Lactobacillus plantarum VHProbi SY and Bifidobacterium lactis VHProbi YB11, stir with a stirrer at 200 rpm for 15 minutes to mix and disperse the bacterial powders in the non-hydrogenated vegetable oil to obtain the crystal ball core layer liquid, pour it into the core layer liquid storage tank of the capsule machine, and set the storage tank temperature to maintain at 30°C-35°C.

[0171] (2) Preparation of intermediate oil layer fluid

[0172] Heat the non-hydrogenated vegetable oil at 37-42°C, add the sustained-release agent hydroxypropyl methylcellulose and stearic acid, mix them with a homogenizer to obtain the intermediate oil layer liquid, pour it into the intermediate oil layer liquid storage tank of the capsule machine, and set the storage tank temperature to maintain at 37-42°C.

[0173] (3) Rubber liquid preparation

[0174] Add gelatin to purified water, stir to dissolve it in a water bath at 70°C, then add chitosan, erythritol and gum arabic in proportion, continue heating in a water bath at 70°C, stir to dissolve, and obtain a gelatin solution. Pour it into the gelatin solution storage tank of the capsule machine, and set the storage tank temperature to maintain at 70°C.

[0175] (4) Preparation of probiotic crystal spheres

[0176] The core layer liquid, the middle oil layer liquid and the rubber liquid are added to a capsule machine with three concentric nozzles, wherein the innermost nozzle sprays the core layer liquid, the middle nozzle sprays the middle oil layer liquid, and the outer nozzle sprays the rubber liquid. After starting the capsule machine, the nozzle speed is adjusted appropriately so that the three nozzles spray the crystal ball components at the same time and drip into the water cooled to 12°C, thereby producing a 3-layer crystal ball with a diameter of 1.5-2.5mm. After the crystal ball is dried at 16°C for 20 hours, it is vacuum freeze-dried for 36 hours to reduce the moisture content to below 1.5%, and the probiotic crystal ball product is obtained.

[0177] Example 9 Accelerated stability test of live bacteria in probiotic crystal spheres

[0178] The probiotic crystal spheres prepared in Example 8 and probiotic original bacterial powder (Lactobacillus plantarum VHProbi SY bacterial powder and Bifidobacterium lactis VHProbi YB11 bacterial powder were mixed in a mass ratio of 1:1) were subjected to an accelerated stability test.

[0179] A certain amount of probiotic crystal balls or probiotic powder were weighed and placed in aluminum film bags for airtight storage, and placed in an incubator at 37°C and humidity controlled at 75%. The viable bacteria count was tested on days 0, 5, 17, 26, 34, 41, 47, 55, 61, and 68, and the sampling was repeated twice at each point. The log(N t )=Log(N0)-t / D T The formula is used to analyze the stability of the live bacteria in the original bacterial powder and probiotic crystal balls, where N t represents the number of viable bacteria on day t, N0 represents the initial number of viable bacteria, t represents the number of days of testing, and D T It represents the number of days required for the viable bacteria to decrease by one order of magnitude. Figure 7 shown.

[0180] Depend on Figure 7It can be seen from a that the initial viable bacteria amount of the probiotics in the probiotic crystal sphere prepared by the present invention is 10.28LogCFU / g, the viable bacteria amount on the 68th day is 10.08Log CFU / g, and D T The value is 341.28 days; Figure 7 b It can be seen that the initial live bacteria count of the probiotic original powder is 10.30Log CFU / g, and the live bacteria count on the 68th day is 9.60Log CFU / g. T The value is 97.48 days. It can be seen that the stability of the probiotic crystal sphere provided by the present invention is 3.5 times higher than that of the probiotic original powder, achieving an unexpected technical effect.

[0181] Example 10 Probiotic crystal ball resistance to artificial gastrointestinal fluid test

[0182] 1. Preparation of artificial gastric juice

[0183] Weigh 5g of peptone, 2.5g of yeast extract, 1g of glucose and 2g of NaCl respectively, add 1000ml of distilled water, adjust pH to 3.0 with dilute hydrochloric acid, and then sterilize at 115℃ for 20min. Then add 3.2g of porcine mucosal pepsin before use, shake well to dissolve, and place in a 37℃ water bath shaker for 1h to simulate human body temperature.

[0184] 2. Preparation of artificial intestinal fluid

[0185] Weigh 5g of peptone, 2.5g of yeast extract, 1g of glucose, 6.8g of KH2PO4 and 3.0g of ox bile salt respectively, add 77ml of 0.2mol / L NaOH solution, dilute to 1000ml, adjust pH to 6.8±0.1 with dilute hydrochloric acid or sodium hydroxide solution, sterilize at 115℃ for 20min. Then add 1g of pancreatic enzyme before use, shake well to dissolve, and place in a 37℃ water bath shaker for 1h to simulate human body temperature.

[0186] 3. Test methods

[0187] Take 2mL of fresh bacterial solution, centrifuge at 5000rpm for 5min to collect the bacteria, wash the bacteria 3 times with normal saline, and resuspend with 2mL of normal saline as inoculation solution. Take 1g of the probiotic crystal ball prepared in Example 8, add it to 9mL of artificial gastric juice that has been warmed for 1h, place it in a 37℃ water bath shaker and oscillate at 200rpm for 2h, and sample 1mL at 0h and 2h to detect the amount of viable bacteria. Then take 1mL of artificial gastric juice after digestion for 2h, add it to 24mL of artificial intestinal juice, place it in a 37℃ water bath shaker (200rpm) for 3h, and sample 1mL to detect the amount of viable bacteria.

[0188] The live bacteria counting method was carried out in accordance with the national standard GB4789.35-2016-Food Microbiology Inspection Lactic Acid Bacteria Inspection to determine the amount of bacteria. The amount of live bacteria in the crystal balls after passing through artificial gastric juice and artificial intestinal juice is shown in Table 8.

[0189] Table 8 Live bacteria count after artificial gastrointestinal digestion (Log CFU / g)

[0190]

[0191] As can be seen from Table 8, after the probiotic crystal spheres provided by the present invention are digested by artificial gastrointestinal fluid, the amount of live bacteria remains stable, indicating that the crystal spheres can improve the tolerance of Lactobacillus plantarum and Bifidobacterium lactis to artificial gastrointestinal fluid.

[0192] Example 11 Test on heat stability of probiotic crystal sphere structure

[0193] An equal amount of the probiotic crystal spheres prepared in Example 8 were weighed and placed in 8 EP test tubes, which were placed in a 40° C. incubator. One EP tube was taken out every day to observe the structural stability of the crystal spheres.

[0194] The results are as follows Figure 8 As shown, the probiotic crystal spheres have complete particle morphology within 1-8 days, and there is no oil leakage or crystal sphere adhesion, indicating that the probiotic crystal spheres provided by the present invention have a stable structure and can withstand a high temperature environment of 40° C., which is conducive to the transportation and storage of the crystal spheres.

[0195] Example 12 In vivo test of probiotic crystal sphere structure stability

[0196] The crystal spheres prepared in Example 8 were intragastrically administered to rats. After intragastrically administering the crystal spheres, the rats were allowed to eat and drink freely. After 2 hours, the rats were killed and the stomach tissues were dissected to observe the crystal sphere structure. Two hours after intragastrically administering the crystal spheres, the crystal spheres still maintained a complete spherical structure in the rat stomach, which was consistent with the in vitro simulated digestion structure. This indicates that the crystal spheres prepared in Example 8 can effectively resist damage caused by various digestive enzymes, highly acidic gastric juice, and mechanical pressure of the stomach wall.

[0197] In summary, the probiotic crystal spheres provided by the present invention can effectively protect the stability of the probiotic original bacterial powder. T The value increased by 3.5 times. At the same time, the probiotic crystal ball can effectively improve the tolerance of probiotics to artificial gastrointestinal fluid, and the amount of live bacteria remains stable after being digested by artificial gastrointestinal fluid. In addition, the structure of the probiotic crystal ball is stable. After being stored at 40°C for 8 days, the shape does not change, and there is no oil leakage or rubber adhesion, which is conducive to its storage and transportation.

Claims

1. A probiotic crystal ball, characterized in that: The probiotic crystal ball comprises Lactobacillus plantarum powder and Bifidobacterium lactis powder; the preservation number of Lactobacillus plantarum is CCTCC NO: M20221666; the preservation number of Bifidobacterium lactis is CCTCC NO: M2021905.

2. The probiotic crystal ball according to claim 1, characterized in that: The mass ratio of Lactobacillus plantarum powder to Bifidobacterium lactis powder in the probiotic crystal ball is 1:

1.

3. The probiotic crystal ball according to claim 2, characterized in that: The probiotic crystal ball is composed of three parts from the inside to the outside, namely, a core layer, a middle oil layer and a rubber layer.

4. The probiotic crystal ball according to claim 3, characterized in that: The mass ratios of the core layer, the middle oil layer and the rubber layer of the probiotic crystal ball are 1:6:13 respectively.

5. The probiotic crystal ball according to claim 4, characterized in that: The core layer is composed of non-hydrogenated vegetable oil, Lactobacillus plantarum powder and Bifidobacterium lactis powder, and the mass ratio thereof is 2:1:

1.

6. The probiotic crystal ball according to claim 5, characterized in that: The middle oil layer is composed of non-hydrogenated vegetable oil, hydroxypropyl methylcellulose and stearic acid, and the mass ratio thereof is 18:1:

1.

7. The probiotic crystal ball according to claim 6, characterized in that: The rubber skin is composed of gelatin, chitosan, gum arabic, erythritol and purified water, and the mass ratio thereof is 5:3:4:3:

35.

8. The method for preparing the probiotic crystal sphere according to any one of claims 1 to 7, characterized in that: The method comprises the following steps: (1) Preparation of core liquid Dissolve the non-hydrogenated vegetable oil at a temperature of 30°C-35°C until it is clear, add Lactobacillus plantarum powder and Bifidobacterium lactis powder, stir with a stirrer at 200 rpm for 15 minutes to mix and disperse the powder in the non-hydrogenated vegetable oil, and obtain a crystal ball core layer liquid; Pour it into the core liquid storage tank of the capsule machine and set the storage tank temperature to maintain at 30℃-35℃; (2) Preparation of intermediate oil layer fluid Heat the non-hydrogenated vegetable oil at a temperature of 37°C-42°C, add the sustained-release agent hydroxypropyl methylcellulose and stearic acid, and mix them by a homogenizer to obtain an intermediate oil layer liquid; Pour it into the middle oil layer liquid storage tank of the pill machine and set the storage tank temperature to maintain at 37-42℃; (3) Rubber liquid preparation Add gelatin to purified water, stir to dissolve in a water bath at 70°C, then add chitosan, erythritol and gum arabic in proportion, continue heating in a water bath at 70°C, stir to dissolve, and obtain a gelatin solution; Pour it into the rubber liquid storage tank of the pill machine and set the tank temperature to maintain at 70℃; (4) Preparation of probiotic crystal spheres The core layer liquid, the middle oil layer liquid and the rubber liquid are respectively added into a pill making machine with three layers of concentric nozzles, wherein the innermost nozzle sprays the core layer liquid, the middle nozzle sprays the middle oil layer liquid, and the outer nozzle sprays the rubber liquid; After starting the capsule machine, adjust the nozzle speed appropriately so that the three-layer nozzles spray out the crystal ball components simultaneously and drip into the water cooled to 12°C, thereby producing a three-layer crystal ball with a diameter of 1.5-2.5mm; after the crystal balls are dried at 16°C for 20 hours, they are vacuum freeze-dried for 36 hours to reduce the moisture content to below 1.5%, thereby obtaining the finished probiotic crystal ball.

9. Use of the probiotic crystal sphere according to any one of claims 1 to 7 in food production.

Images