STRA8 gene mutant and application thereof

Abstract

The invention discloses an STRA8 gene mutant and application thereof. Wherein compared with a wild type STRA8 gene, the nucleotide at the 245th site of the STRA8 gene mutant is mutated from T to C, and the nucleotide sequence of the STRA8 gene mutant is shown as SEQ ID NO. 1. Correspondingly, compared with the protein coded by the wild type STRA8 gene, the 82nd amino acid of the STRA8 mutant protein coded by the STRA8 gene mutant is mutated from leucine to proline, and the amino acid sequence of the STRA8 mutant protein coded by the STRA8 gene mutant is as shown in SEQ ID NO.2. The invention finds that the STRA8 gene mutant and the STRA8 mutant protein may cause premature ovarian failure (POI) and are closely related to POI pathogenesis. The STRA8 gene mutant and the STRA8 mutant protein can be used for screening POI risks and assisting in confirming pathogenic factors for POI patients, so that pathogenesis caused by genetic factors of POI can be explored, and a new detection site and a new detection method and approach are provided for diagnosis of the disease; and help is provided for clinically guiding fertility consultation and treatment of the patients.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a STRA8 gene mutant and application thereof. Background Art

[0002] Premature ovarian failure (primary ovarian insufficiency, POI) refers to the cessation of normal ovarian function in women before the age of 40, manifested by at least 4 months of primary or secondary amenorrhea in women under 40 years old, with an increase in serum FSH level (higher than 40 IU / L) and a decrease in estradiol level (lower than 50 pg / mL) at intervals greater than 1 month. About 3.7% of women under 40 years old suffer from premature ovarian failure, and the incidence rate in women under 30 years old is about 0.1%. The cause of POI remains to be studied. It can be caused by spontaneous genetic defects, autoimmune diseases, infections or iatrogenic factors. POI is one of the important causes of female infertility, but 5%-10% of POI patients still have the possibility of natural conception. From a genomic point of view, POI is mainly inherited in an autosomal recessive manner, or it can be caused by dosage-sensitive autosomal dominant gene inheritance or X-linked inheritance mode. Due to the high genetic heterogeneity of POI, different genes lead to the occurrence of POI. The number of POI pathogenic genes discovered so far is limited, which greatly restricts the early diagnosis and treatment of POI.

[0003] The current diagnostic technology for POI is based on clinical observation, blood test indicators and B-ultrasound examination. Some patients will undergo chromosome karyotype analysis and FMR1 gene examination, but it is reported that the prevalence of chromosome abnormalities as the cause of POI is 10% to 13%, and women with abnormal CGG repeat fragments in the 5' non-coding region of the FMR1 gene have a 20% chance of developing POI. In recent years, studies using whole genome sequencing and whole exome sequencing methods to explore genetic factors leading to POI have found that single gene genetic pathogenicity can explain about 23.5%-29.3% of the causes. Due to the high genetic heterogeneity of POI, the number of pathogenic genes currently discovered has greatly restricted the early diagnosis of POI, and the number of pathogenic genes that have been reported to cause POI is limited. Among them, the STRA8 gene (retinoic acid activated gene 8) is a gene with an autosomal recessive inheritance pattern.

[0004] The STRA8 gene is located on the long arm of chromosome 7 and consists of 9 exons. In mammals, the STRA8 gene is expressed in the embryonic ovary before the onset of meiosis, while expression in the testis begins after birth. In the embryonic ovarian germ cells of the Stra8 gene knockout mouse model, mitosis is normal, but DNA replication during the meiotic interphase and subsequent meiotic processes are unable to proceed. Studies have shown that this gene is required for the transition of male and female germ cells to meiosis. Previous mouse model studies have found that abnormalities in the STRA8 gene can lead to ovarian insufficiency, so the discovery of new STRA8 gene mutants in humans can be used for the early diagnosis and treatment of POI. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the present invention provides a STRA8 gene mutant and its application, aiming to provide a new STRA8 gene mutant, which provides a new detection site and a new detection method and approach for the diagnosis of premature ovarian failure.

[0006] The technical solution of the present invention is as follows:

[0007] In a first aspect of the present invention, a STRA8 gene mutant is provided. Compared with the wild-type STRA8 gene, the nucleotide at position 245 of the STRA8 gene mutant is mutated from T to C, and the nucleotide sequence thereof is shown in SEQ ID NO.1.

[0008] The second aspect of the present invention provides a STRA8 mutant protein. Compared with the protein encoded by the wild-type STRA8 gene, the 82nd amino acid of the STRA8 mutant protein is mutated from leucine to proline, and the amino acid sequence is shown in SEQ ID NO.2.

[0009] The third aspect of the present invention provides use of a reagent for detecting the STRA8 gene mutant described in the first aspect or the STRA8 mutant protein described in the second aspect in the preparation of a product for diagnosing premature ovarian failure.

[0010] In a preferred technical solution, the reagent comprises at least one of an antibody, a probe, a primer and a mass spectrometry detection reagent specific to the STRA8 gene mutant or the STRA8 mutant protein.

[0011] In a preferred technical solution, the reagent comprises a primer pair as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0012] A fourth aspect of the present invention provides a kit for diagnosing premature ovarian failure, the kit comprising a reagent for detecting the STRA8 gene mutant described in the first aspect, and / or a reagent for detecting the STRA8 mutant protein described in the second aspect.

[0013] A fifth aspect of the present invention provides an electronic device for confirming the genetic cause of premature ovarian failure, comprising:

[0014] An acquisition module, used to acquire a nucleotide sequence and / or an amino acid sequence of a biological sample;

[0015] A detection module, used for detecting the STRA8 gene and / or the encoded protein in a biological sample;

[0016] A judgment module is used to judge the genetic cause of premature ovarian failure according to the sequence information of the STRA8 gene and / or the encoded protein in the biological sample; wherein, if the c.245T>C mutation is a heterozygote, the patient is judged to be a carrier of the STRA8 gene mutation of premature ovarian failure; if the c.245T>C mutation is a homozygote, the patient is judged to be a patient with the STRA8 gene mutation of premature ovarian failure; wherein, if the p.Leu82Pro mutation is a heterozygote, the patient is judged to be a carrier of the STRA8 gene mutation of premature ovarian failure; if the p.Leu82Pro mutation is a homozygote, the patient is judged to be a patient with the STRA8 gene mutation of premature ovarian failure;

[0017] The output module is used to output the judgment result.

[0018] In a preferred technical solution, the detection module performs detection by high-throughput sequencing or Sanger sequencing.

[0019] Beneficial effects: The present invention provides a STRA8 gene mutant (c.245T>C) and a corresponding STRA8 mutant protein (p.Leu82Pro), and also provides the application of the STRA8 gene mutant and the STRA8 mutant protein. By detecting the STRA8 gene mutant and the STRA8 mutant protein, the risk of POI can be screened and the pathogenic factors of POI patients can be confirmed, providing a new detection site and a new detection method and approach for the diagnosis of the disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the genetic map of the premature ovarian failure pedigree of the sample tested in Example 1 of the present invention.

[0021] Figure 2 It is the Sanger sequencing diagram of the sample tested in Example 1 of the present invention.

[0022] Figure 3 This is a graph showing the immunoblotting results of the wild-type and mutant STRA8 proteins in Example 1 of the present invention. DETAILED DESCRIPTION

[0023] The present invention provides a STRA8 gene mutant and application thereof. To make the purpose, technical scheme and effect of the present invention clearer and more specific, the present invention is further described in detail below.

[0024] There are only 45 records of mutations in the STRA8 gene in the Human Clinical Genetic Variation Database (ClinVar), of which the mutation types include missense mutations and large insertions and deletions. These mutations include mutations that can cause abnormal function of the STRA8 protein product, as well as mutations that have no effect on the protein function. However, most of the missense mutations in the STRA8 gene are still unclear about the protein function, and further analysis and research is needed. The STRA8 gene mutant of the present invention mutates from a T base to a C base in the 245th nucleotide of the protein-coding region. The NCBI registration number of the nucleotide sequence of the human wild-type STRA8 is NM_001394401.1, and the sequence information is as follows. For detailed sequence information, please refer to https: / / www.ncbi.nlm.nih.gov / nuccore / NM_001394401.1. STRA8 gene mutant: NM_001394401.1: exon3: c.245T>C: p.Leu82Pro mutation is not recorded in the ClinVar database, and the frequency of the STRA8 gene mutant in the 800,000 healthy population mutation database gnomAD4.0 is 0.000001239, and its nucleotide sequence is shown in SEQ ID NO.1. Among 45,543 healthy people in southern Asia, only 1 person is a heterozygous carrier of the mutation, and among 590,012 healthy European people, only 1 person is a heterozygous carrier of the mutation. The mutation is an extremely rare mutation in healthy people, and has not been reported in POI patients so far.

[0025] The wild-type nucleotide sequence of the STRA8 gene is NM_001394401.1 (the bases in bold and framed are the T bases that have mutated in the STRA8 gene mutant of the present invention, and after the mutation, the T changes to a C):

[0026]

[0027] Based on this, an embodiment of the present invention provides a STRA8 gene mutant. Compared with the wild-type STRA8 gene, the STRA8 gene mutant has a c.245T>C mutation, that is, the nucleotide at position 245 mutates from T to C, and its nucleotide sequence is shown in SEQID NO.1.

[0028] Specifically, the inventors found that c.245T>C of the STRA8 gene is closely related to the onset of premature ovarian failure, so that by detecting the positive situation of this gene mutation in the biological sample, it is possible to effectively determine whether the biological sample suffers from premature ovarian failure.

[0029] Accordingly, an embodiment of the present invention provides a STRA8 mutant protein. Compared with the protein encoded by the wild-type STRA8 gene, the 82nd amino acid of the STRA8 mutant protein is mutated from leucine to proline (p.Leu82Pro), and its amino acid sequence is shown in SEQ ID NO.2.

[0030] As mentioned above, the inventors found that the protein p.Leu82Pro expressed by the STRA8 gene mutant is closely related to the onset of premature ovarian failure, so that by detecting the positive situation of the STRA8 mutant protein in the biological sample, it is possible to effectively determine whether the biological sample suffers from premature ovarian failure.

[0031] Specifically, the STRA8 mutant protein NP_001381330.1: p.Leu82Pro is caused by the above-mentioned STRA8 gene mutant. The mutant amino acid is located in the basic helix-loop-helix (bHLH) domain family, and the bHLH domain protein is a DNA binding protein that acts as a transcription factor. Spatial structure prediction analysis found that the L82P mutation affects the stability of the hydrogen bond connection between L82 and S80 amino acids. Therefore, the STRA8 mutant protein may affect the normal function of the protein and become one of the causes of premature ovarian failure.

[0032] The amino acid sequence of the protein encoded by the wild-type STRA8 is NP_001381330.1 (the amino acid in bold and framed is the 82nd amino acid that is mutated in the STRA8 mutant protein of the present invention, which changes from L to P after the mutation):

[0033]

[0034] Accordingly, the embodiment of the present invention provides the use of a reagent for detecting the STRA8 gene mutant as described above or the STRA8 mutant protein as described above in the preparation of a product for diagnosing premature ovarian failure. Preferably, the product includes: a detection reagent, a kit, a chip or a probe, but is not limited thereto, and any product that can detect mutations in the STRA8 gene is applicable.

[0035] In one embodiment, the product further comprises an instruction manual containing the following information:

[0036] (1) If the sample of the subject is detected to be a homozygous form of the above-mentioned STRA8 gene mutant (c.245T>C), the subject is determined to be a POI patient; if the sample of the subject is detected to be a heterozygous form of the above-mentioned STRA8 gene mutant (c.245T>C), the subject is determined to be a POI carrier;

[0037] (2) If the sample of the subject is detected to be a homozygous form of the above-mentioned STRA8 mutant protein (p.Leu82Pro), the subject is determined to be a POI patient; if the sample of the subject is detected to be a heterozygous form of the above-mentioned STRA8 mutant protein (p.Leu82Pro), the subject is determined to be a POI carrier.

[0038] The above-mentioned samples to be tested include: nucleic acid samples derived from at least one of human blood, skin, and subcutaneous tissue, such as peripheral blood, endometrial tissue samples, and oral mucosa samples. Nucleic acid samples can be samples that can reflect whether there is a mutation in a biological sample, such as whole genome DNA directly extracted from a biological sample, a portion of the whole genome containing the coding sequence of the gene mutant, and extracted total RNA or mRNA.

[0039] In one embodiment, the reagent includes at least one of an antibody, a probe, a primer and a mass spectrometry detection reagent specific to the STRA8 gene mutant or the STRA8 mutant protein.

[0040] In one embodiment, the reagent includes a primer pair as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0041] SEQ ID NO.3: AGCCGCCCTGTAGTCATTT;

[0042] SEQ ID NO. 4: GCAGCACTCCAGTAGGGAAC.

[0043] Accordingly, an embodiment of the present invention provides a kit for diagnosing premature ovarian failure, wherein the kit comprises a reagent for detecting the STRA8 gene mutant described in the first aspect, and / or a reagent for detecting the STRA8 mutant protein described in the second aspect.

[0044] Accordingly, an embodiment of the present invention provides an electronic device for confirming the genetic cause of premature ovarian failure, comprising:

[0045] An acquisition module, used to acquire a nucleotide sequence and / or an amino acid sequence of a biological sample;

[0046] A detection module, used for detecting the STRA8 gene and / or the encoded protein in a biological sample;

[0047] A judgment module is used to judge the genetic cause of premature ovarian failure according to the sequence information of the STRA8 gene and / or the encoded protein in the biological sample; wherein, if the c.245T>C mutation is a heterozygote, the patient is judged to be a carrier of the STRA8 gene mutation of premature ovarian failure; if the c.245T>C mutation is a homozygote, the patient is judged to be a patient with the STRA8 gene mutation of premature ovarian failure; wherein, if the p.Leu82Pro mutation is a heterozygote, the patient is judged to be a carrier of the STRA8 gene mutation of premature ovarian failure; if the p.Leu82Pro mutation is a homozygote, the patient is judged to be a patient with the STRA8 gene mutation of premature ovarian failure;

[0048] The output module is used to output the judgment result.

[0049] In one embodiment, the detection module performs detection by high-throughput sequencing or Sanger sequencing.

[0050] In one embodiment, the electronic device further comprises a storage module for storing a human wild-type STRA8 nucleotide sequence and / or amino acid sequence, which can be used as a comparison template for biological sample sequence information to determine the genotype of the biological sample.

[0051] It can be understood that when obtaining the nucleotide sequence of the biological sample, the judgment module of the electronic device uses the wild-type STRA8 nucleotide sequence in the storage module to determine whether the 245th nucleotide of the biological sample has mutated and the mutation type; when obtaining the amino acid sequence of the biological sample, the judgment module of the electronic device uses the wild-type STRA8 amino acid sequence in the storage module to determine whether the 82nd amino acid of the biological sample has mutated and the mutation type.

[0052] The present invention will be further described below by means of specific examples.

[0053] Embodiment 1:

[0054] In this example, the inventor collected a family of patients with sporadic premature ovarian failure, collected peripheral blood and family sample information from all family members, and performed clinical examinations and blood hormone level tests on the proband. The clinical information is as follows:

[0055] Table 1. Clinical information of the proband and family members with premature ovarian failure

[0056]

[0057]

[0058] After signing the informed consent, peripheral blood DNA samples of all family members were used for next-generation sequencing analysis.

[0059] 1. Exome sequencing:

[0060] DNA was extracted from peripheral blood samples using the DNeasy blood and tissue kit (QIAGEN, Germantown, MD, USA), and the DNA concentration was accurately quantified using Qubit 3.0. The subsequent library construction samples must reach a concentration of ≥20 ng / μL and a DNA content of more than 0.4 μg. The DNA was then randomly fragmented into a length of 180-280 bp using a Covaris fragmentor, and the degree of DNA degradation and RNA and protein contamination were analyzed by agarose gel electrophoresis, and purified at the same time. The library construction and capture experiments were performed using the Agilent SureSelect Human All Exon V6 kit (Agilent Technologies, Santa Clara, CA, USA), and sequencing was performed using the Illumina Novaseq 6000 platform (Illumina, San Diego, CA, USA).

[0061] Exome sequencing data analysis refers to the commonly used bioinformatics analysis process in published literature, which is briefly as follows:

[0062] First, the Burrows-Wheeler Aligner tool was used to align high-quality fragments to the human reference genome GRCh38, and then Picard v2.25.0 (http: / / broadinstitute.github.io / picard) was used to remove duplicate fragments generated by the PCR process. Mutation detection referred to the standardized analysis process recommended by Genome Analysis Tollkit (GATK v4.2.0.0), and the tools used included Base Quality Score Recalibration, HaplotypeCaller, and Variant Quality Score Recalibration.

[0063] Subsequently, ANNOVAR was used to annotate the mutations. Mutation screening was performed according to the following conditions: (1) mutations with minor allele frequency (MAF) < 0.5% in the public population database were retained; (2) non-synonymous mutations on exons, splice site variants, and protein-coding deletions and insertions (indels) were retained; (3) mutations that were considered non-benign by multiple mutation harmfulness prediction tools. At the same time, mutation harmfulness information was also annotated using ClinVar and InterVar based on the American College of Medical Genetics (ACMG) guidelines. All mutations were visually confirmed using the IGV tool. The results are shown in Tables 2 and 3.

[0064] Table 2. Sample data quality information statistics

[0065]

[0066]

[0067] Table 3. Statistics of mutation filtering

[0068]

[0069] In the final mutation list, by comparing the expression of each gene in human tissues or organs (HPA database) and the phenotypic information of the reference mouse gene mutation model (MGI database), and searching for published literature using PubMed, it was finally found that the NM_001394401.1:exon3:c.245T>C:p.Leu82Pro mutation on the STRA8 gene was a homozygous mutation in the proband and a heterozygous mutation in other healthy family members (such as Figure 1 ), which is consistent with the law of autosomal recessive inheritance, and STRA8 gene-deficient mice show meiotic disorders and a phenotype of lack of mature follicles and oocytes (https: / / www.informatics.jax.org / diseasePortal / popup?isPhenotype=true&markerID=MGI:107917&header=reproductive%20system).

[0070] 2. Sanger sequencing verification:

[0071] Further verify the significant mutations found and design primers:

[0072] Upstream primer: AGCCGCCTCTGTAGTCATTT (SEQ ID NO. 3);

[0073] Downstream primer: GCAGCACTCCAGTAGGGAAC (SEQ ID NO. 4).

[0074] DNA was extracted from peripheral blood samples of family members, and the samples were amplified by PCR using the designed primers to obtain a product size of 613 bp, which was then subjected to Sanger sequencing.

[0075] The comparison results are as follows Figure 2As shown, among the family members, the parents (I-1 and I-2) are heterozygous carriers of STRA8:NM_001394401.1:exon3:c.245T>C:p.Leu82Pro, the proband (II-3) is a homozygous mutant of the mutation, and the proband's two sisters (II-1 and II-2) and one brother (II-4) are all heterozygous carriers.

[0076] 3. In vitro experiments to verify protein expression:

[0077] 1) Plasmid construction: The CDS sequences of wild-type and L82P mutant STRA8 were constructed and provided by Guangzhou Aiki Biotechnology Co., Ltd. The wild-type and mutant sequences were then cloned into the pcDNA3.1 expression vector.

[0078] 2) Cell transfection: HeLa cells were cultured with 1×DMEM basic (Gibco, China, Cat. C11995500BT), supplemented with 10% fetal bovine serum (Biological Industries, Israel, Cat. 04-001-1A) and 1% ampicillin-streptomycin (Hyclone, South Logan, Utah). Lipofectamine TM 3000 transfection kit (Invitrogen, USA, Cat. L3000-001) according to the manufacturer's instructions.

[0079] 3) Protein extraction and Western blot:

[0080] Quantitative analysis of transfected HeLa cells was performed. Cells were first washed with PBS buffer and lysed on ice for 5 minutes using RIPA lysis buffer (ThermoFisher, Cat.89900) supplemented with 1 mM PMSF (Sevicebio, Cat.G2008). The samples were sonicated and centrifuged at 4°C, 10,000×g for 10 minutes, and the supernatant was collected. Pierce BCA protein assay was then performed. The samples were diluted with 5× loading buffer (Fdbio Science, China, Order No.: FD002) and heated at 98°C for 10 minutes. Protein samples were separated using 4% to 12% Bis-Tris gels (GenScript, China, Order No.: M00652) and a mini protein electrophoresis system (BIO-RAD, USA, Order No.: 1658034) according to the manufacturer's instructions. The protein bands were then transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, United States, Cat. IPVH00010) by Mini Trans-Blot Electrophoretic Transfer Cell (Mini Trans-Blot Electrophoretic Transfer Cell, Cat. 1703930, BIO-RAD, CA, United States). The membranes were then blocked with 5% bovine serum albumin (BSA) buffer and incubated overnight at 4°C with rabbit anti-STRA8 (Proteintech, Cat. 12332-1-AP) and rabbit anti-GAPDH (Servicebio, Cat. GB11002) at a final dilution of 1:1000 (v / v). After washing three times, the cells were incubated with HRP-conjugated goat anti-rabbit IgG (H+L) cross-adsorbed antibody (Invitrogen, USA, Cat. G-21234) at a dilution of 1:5000 (v / v) at 37°C for 1 hour, and then the immunoreactive bands were detected and analyzed using the Bio-Rad ChemiDoc MP imaging system (BIO-RAD, USA, Cat. 12003154) combined with Image Lab software. The band intensities of the relevant proteins were quantified using ImageJ software.

[0081] The experimental results are as follows Figure 3 As shown, this mutation reduces protein expression and affects protein function, further verifying the harmfulness of this mutation.

[0082] It can be seen from the above examples that by using exon sequencing to preliminarily screen candidate mutations related to premature ovarian failure and using Sanger sequencing to verify the candidate mutations, STRA8 gene mutants and protein mutants, c.245T>C and p.Leu82Pro, can be well confirmed. The new mutants are closely related to the onset of premature ovarian failure. The gene mutants can be used to screen the risk of premature ovarian failure and play a key role in assisting in confirming the pathogenic factors of patients with premature ovarian failure. It provides a new detection site, a new detection method and an approach for the diagnosis of the disease, and provides help for clinical guidance of fertility consultation and treatment for such patients.

[0083] It should be understood that the application of the present invention is not limited to the above examples. For ordinary technicians in this field, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.

Claims

1. A STRA8 gene mutant, characterized in that: Compared with the wild-type STRA8 gene, the 245th nucleotide of the STRA8 gene mutant is mutated from T to C, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. A STRA8 mutant protein, characterized in that: Compared with the protein encoded by the wild-type STRA8 gene, the 82nd amino acid of the STRA8 mutant protein is mutated from leucine to proline, and its amino acid sequence is shown in SEQ ID NO.

2.

3. Use of a reagent for detecting the STRA8 gene mutant according to claim 1 or the STRA8 mutant protein according to claim 2 in the preparation of a product for diagnosing premature ovarian failure.

4. The use according to claim 3, characterized in that: The reagents include at least one of an antibody, a probe, a primer and a mass spectrometry detection reagent specifically targeting the STRA8 gene mutant or the STRA8 mutant protein.

5. The use according to claim 3, characterized in that: The reagents include a primer pair as shown in SEQ ID NO.3 and SEQ ID NO.

4.

6. A kit for diagnosing premature ovarian failure, characterized in that: The kit comprises a reagent for detecting the STRA8 gene mutant according to claim 1 and / or a reagent for detecting the STRA8 mutant protein according to claim 2.

7. An electronic device for confirming the genetic cause of premature ovarian failure, characterized in that: include: An acquisition module, used to acquire a nucleotide sequence and / or an amino acid sequence of a biological sample; A detection module, used for detecting the STRA8 gene and / or the encoded protein in a biological sample; A judgment module is used to judge the genetic cause of premature ovarian failure according to the sequence information of the STRA8 gene and / or the encoded protein in the biological sample; wherein, if the c.245T>C mutation is a heterozygote, the patient is judged to be a carrier of the STRA8 gene mutation of premature ovarian failure; if the c.245T>C mutation is a homozygote, the patient is judged to be a patient with the STRA8 gene mutation of premature ovarian failure; wherein, if the p.Leu82Pro mutation is a heterozygote, the patient is judged to be a carrier of the STRA8 gene mutation of premature ovarian failure; if the p.Leu82Pro mutation is a homozygote, the patient is judged to be a patient with the STRA8 gene mutation of premature ovarian failure; The output module is used to output the judgment result.

8. The electronic device according to claim 7, characterized in that: The detection module performs detection by high-throughput sequencing or Sanger sequencing.

Images