Tobacco bacterial wilt resistance gene NtRRS4 and application thereof in tobacco bacterial wilt resistance

Abstract

The invention discloses a tobacco bacterial wilt resistance gene NtRRS4 and application thereof in tobacco bacterial wilt resistance, the scheme is that NBS-LRR disease-resistant genes NtRRS4 which are subjected to up-regulation expression induced by ralstonia solanacearum and screened based on tobacco gene chip data in the early stage are subjected to PCR (Polymerase Chain Reaction) cloning to obtain a cDNA (Complementary Deoxyribose Nucleic Acid) sequence for coding the protein; a CaMV 35S promoter is constructed based on BP and LR reactions of a Gateway system to drive an NtRRS4 gene plant expression vector p35S:: NtRRS4-TAP, GV3101 agrobacterium is transformed, the GV3101 agrobacterium is introduced into an infected tobacco variety Honghua Dajinyuan through a leaf disc method, transgenic tobacco is subjected to molecular identification and ralstonia solanacearum inoculation resistance identification, and results prove that the NtRRS4 can positively regulate the resistance of the tobacco to ralstonia solanacearum. The invention provides a gene resource for cultivating a new variety of bacterial wilt resistant tobacco by utilizing a gene engineering means, and has important application value.

Description

Technical Field

[0001] The invention relates to the technical field of plant gene engineering, and in particular to a tobacco bacterial wilt resistance gene NtRRS4 and an application thereof in tobacco bacterial wilt resistance. Background Art

[0002] Tobacco is an important economic crop that plays an important role in economic development and is also a model plant for molecular biology research. Bacterial wilt caused by Ralstonia solanacearum is an important soil-borne disease, and there is still no documented effective prevention and control method. Discovering bacterial wilt resistance genes and clarifying the disease resistance mechanism can lay a theoretical foundation for breeding tobacco varieties resistant to bacterial wilt using genetic engineering.

[0003] When plants are infected by pathogens, they will trigger a defense response. Plant defense responses can be divided into two types: one is the nonspecific immune response (PTI) caused by pathogen-associated molecular patterns (PAMPs); the other is the specific defense response (ETI) triggered by the host's disease resistance proteins recognizing the effectors produced by pathogens. Based on Flor's "gene-to-gene" model, the R gene products in the host can specifically recognize the non-toxic gene products of pathogens and produce specific resistance responses. The interaction between these two interacting genes is the key first step in triggering a series of plant defense mechanisms. Most R genes encode proteins that belong to a superfamily with an NBS-LRR domain. In the plant genome, NBS-LRR is the largest disease resistance gene family and one of the largest gene families in the plant genome.

[0004] A study has overexpressed the tobacco N gene encoding TIR-NBS-LRR proteins in Nicotiana benthamiana. The transgenic plants showed a hypersensitive response (HR) to tobacco mosaic virus (TMV) and inhibited the proliferation of the virus in Nicotiana benthamiana, indicating that the N gene can enhance the resistance of heterologous Nicotiana benthamiana. The TIR-NBS-LRR gene EstTTR1 is involved in the SGT1-mediated defense response and jointly responds to the resistance of Arabidopsis to tobacco ringspot virus. The NBS-LRR gene GbaNA1 in sea island cotton was heterologously expressed in Arabidopsis, and the resistance of Arabidopsis to Verticillium wilt was significantly enhanced through ROS (reactive oxygen species) and ethylene signal transduction pathways. Research on the mechanism of plant resistance to bacterial wilt has been reported in tobacco, pepper, tomato and potato. In particular, the most reports are in Arabidopsis. RRS1 is the first bacterial wilt resistance gene discovered in Arabidopsis thaliana. It can mediate a broad-spectrum resistance response to multiple physiological subspecies of Ralstonia solanacearum. It is also the first TIR-NBS-LRR-type R gene that depends on the NDR1 protein. The rapid development of high-throughput sequencing technology in recent years has created good conditions for cloning a large number of tobacco bacterial wilt resistance genes and conducting functional analysis. However, to date, there are still few reports on tobacco NBS-LRR-type genes that resist bacterial wilt.

[0005] Based on the laboratory's previous tobacco gene chip data analysis results, this study obtained an NBS-LRR gene NtRRS4 that was induced by Ralstonia solanacearum. The construction of an overexpression vector and Agrobacterium-mediated transformation of tobacco can significantly enhance resistance to Ralstonia solanacearum. It is speculated that the NtRRS4 gene may be involved in the defense response of tobacco against Ralstonia solanacearum and can provide genetic resources for the genetic improvement of plant resistance to Ralstonia solanacearum. Summary of the invention

[0006] In view of this, the purpose of the present invention is to propose a tobacco bacterial wilt resistance gene NtRRS4 and its application in tobacco bacterial wilt resistance, which will provide gene resources for plant bacterial wilt resistance genetic engineering and has important application prospects.

[0007] In order to achieve the above technical objectives, the technical solution adopted by the present invention is:

[0008] The invention is based on the gene induced by Ralstonia solanacearum that was screened out based on the previous tobacco gene chip data. Blast analysis shows that the gene is a tobacco NBS-LRR disease resistance gene, named NtRRS4. Primers are designed according to the predicted CDS sequence, and the gene is amplified by polymerase chain reaction. The results show that the NtRRS4 sequence contains 1920 base pairs, encoding 639 amino acids, and its nucleotide sequence is shown in SEQ ID NO.1. The N-terminus of the protein encoded by NtRRS4 has a NB-ARC conservative motif encoding 225 amino acids, and there are multiple LRR conservative motifs at the 345-618 position of the amino acid sequence, which conforms to the structural characteristics of the NBS-LRR gene family. The amino acid sequence encoded by it is shown in SEQ ID NO.2.

[0009] On the basis of the above, this scheme provides a tobacco NBS-LRR disease resistance gene NtRRS4, whose nucleotide sequence is shown in SEQ ID No.1.

[0010] Based on the above, this solution provides a protein encoded by the tobacco NBS-LRR disease resistance gene NtRRS4, whose amino acid sequence is shown in SEQ ID NO.2.

[0011] Based on the above, this scheme also provides an overexpression vector, characterized in that it includes the tobacco NBS-LRR disease resistance gene NtRRS4. Overexpression of the tobacco NtRRS4 gene in this scheme can significantly improve tobacco's resistance to bacterial wilt, which provides a theoretical basis for the molecular mechanism of tobacco's resistance to bacterial wilt.

[0012] Based on the above, the present scheme also provides a method for constructing an overexpression vector of the tobacco NBS-LRR disease resistance gene NtRRS4, characterized in that it includes: constructing an entry vector pDONR207-NtRRS4 through a BP reaction based on the Gateway system, and then constructing a CaMV 35S promoter-driven plant expression vector p35S::NtRRS4-TAP through an LR reaction.

[0013] In this study, transgenic tobacco plants overexpressing NtRRS4 were obtained through Agrobacterium-mediated genetic transformation, and resistance was identified. The results showed that NtRRS4 can positively regulate tobacco resistance to Ralstonia solanacearum.

[0014] Based on the above, this solution also provides the use of the above-mentioned tobacco NBS-LRR disease resistance gene NtRRS4 or its encoded protein in tobacco bacterial wilt resistance genetic engineering.

[0015] Based on the above, this scheme also provides the use of the above-mentioned overexpression vector in tobacco bacterial wilt resistance genetic engineering.

[0016] Based on the above, this scheme also provides the application of the overexpression vector constructed by the above construction method in tobacco bacterial wilt resistance genetic engineering

[0017] By adopting the above technical scheme, the present invention has the following beneficial effects compared with the prior art: based on the NBS-LRR disease resistance gene NtRRS4 induced and upregulated by Ralstonia solanacearum screened out by the previous tobacco gene chip data, the cDNA sequence encoding the protein is obtained by PCR cloning, and the CaMV 35S promoter-driven NtRRS4 gene plant expression vector p35S::NtRRS4-TAP is constructed by BP and LR reactions based on the Gateway system, which is transformed into GV3101 Agrobacterium, and introduced into the susceptible tobacco variety Honghua Dajinyuan by the leaf disc method, and the transgenic tobacco is subjected to molecular identification and Ralstonia solanacearum inoculation resistance identification, and the results show that NtRRS4 can positively regulate tobacco resistance to Ralstonia solanacearum. The present invention provides gene resources for cultivating new tobacco varieties resistant to Ralstonia solanacearum by genetic engineering means, and has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0019] Figure 1 Schematic diagram of the construction of tobacco NtRRS4 overexpression vector based on the Gateway system.

[0020] Figure 2 The expression pattern of NtRRS4 in resistant and susceptible varieties after Ralstonia solanacearum treatment. The X-axis represents the sampling time after Ralstonia solanacearum inoculation, the Y-axis represents the relative expression level of the gene, the column represents the mean + standard error, the experiment was repeated three times independently, and capital letters indicate extremely significant differences (p≤0.01).

[0021] Figure 3 The results of partial identification of the T0 generation of NtRRS4 overexpressing transgenic tobacco. a) Identification at the DNA level; b) Identification at the RNA level; M: DL2,000 DNA Marker; +: positive control; -: negative control; The remaining lanes are amplification products using DNA or sscDNA of T0 generation plants as templates.

[0022] Figure 4The phenotype of NtRRS4 overexpressing transgenic tobacco inoculated with Ralstonia solanacearum. a) The disease index of NtRRS4 overexpressing transgenic tobacco decreased; b) NtRRS4 overexpressing transgenic tobacco inoculated with Ralstonia solanacearum showed enhanced resistance compared with the control group (Bar: 2cm). DETAILED DESCRIPTION

[0023] The present invention will be further described in detail below in conjunction with the accompanying drawings and examples. It is particularly noted that the following examples are only used to illustrate the present invention, but are not intended to limit the scope of the present invention. Similarly, the following examples are only partial embodiments of the present invention rather than all embodiments, and all other embodiments obtained by those of ordinary skill in the art without creative work are within the scope of protection of the present invention.

[0024] Example 1 Acquisition of NtRRS4 gene and construction of NtRRS4 overexpression vector

[0025] Based on the laboratory's previous tobacco gene chip data analysis results, an NBS-LRR gene whose expression was upregulated by Ralstonia solanacearum was obtained and named NtRRS4 (its nucleotide sequence is shown in SEQ ID NO.1).

[0026] The CDS sequence of this gene was obtained by comparison and analysis in the Chinese Tobacco Database.

[0027] According to the CDS sequence of the full-length gene of NtRRS4, specific primers were designed:

[0028] NtRRS4-attB1-F:

[0029] GGGGACAAGTTTGTACAAAAAAGCAGGCTTC-ACCATGACTCGCGTGTTTAATGTAG, (SEQ IDNO.3)

[0030] NtRRS4-attB2-R:

[0031] GGGGACCACTTTGTACAAGAAAGCTGGGTC-GTATCAACAGAAAACTGAT TCAA, (SEQ ID NO.4)

[0032] The cDNA of the leaves of tobacco Yanyan 97 resistant to bacterial wilt was used as a template for PCR amplification, and the high-fidelity enzyme LA Amplification, PCR reaction system: 1 μL cDNA as template, 2 μL 10×LA PCR BufferⅡ (Mg 2+plus), 1.5μL of dNTP Mixture (2.5mM), 0.1μL of LA Taq, 0.5μL of each forward and reverse primer, and water to 20μL. Reaction conditions: 94℃ pre-denaturation for 5min; 94℃30s, 58℃30s, 72℃2min, 28 cycles. After agarose gel electrophoresis detection, the PCR product was cut and purified and recovered. The target gene fragment was connected with the pDONR207 empty vector for BP reaction: 1μL (80-100ng) of purified NtRRS4 product, 1μL of pDONR207 empty vector, 0.25μL of BP enzyme, connected at 25℃ overnight, the connection product was transformed into E. coli DH5α competent cells, and positive clones were screened for sequencing.

[0033] Extract plasmids from clones that have been sequenced correctly, and construct the entry vector pDONR207-NtRRS4. Perform LR reaction on the entry vector plasmid and the plant overexpression vector pEarleyGate205: 1 μL (80-100 ng) of pDONR207-NtRRS4 plasmid, 1 μL (80-100 ng) of pEarleyGate205 empty load, 0.25 μL of LR enzyme, connect overnight at 25°C, transform E. coli, verify positive clones, and construct the plant overexpression vector p35S::NtRRS4-TAP. The schematic diagram of the construction process of the p35S::NtRRS4-TAP overexpression vector is shown in the figure. Figure 1 shown.

[0034] Example 2 Analysis of the expression pattern of NtRRS4 in tobacco varieties resistant and susceptible to bacterial wilt after infection with Ralstonia solanacearum

[0035] In order to analyze the expression difference of NtRRS4 gene in tobacco varieties resistant to bacterial wilt and susceptible to bacterial wilt in response to bacterial wilt infection, the present invention inoculated with bacterial wilt bacteria to treat the second and third functional leaves of the tobacco variety Yanyan 97 (YY97) with high resistance to bacterial wilt and the tobacco variety Honghua Dajinyuan (HD) susceptible to bacterial wilt respectively, and cultured them in a 28°C greenhouse, with three biological replicates for each treatment. Samples were taken at 8 different time points (0h, 3h, 6h, 12h, 24h, 48h, 72h, 96h), and the expression of NtRRS4 induced by bacterial wilt was analyzed by real-time fluorescence quantitative PCR method.

[0036] Design of fluorescent quantitative PCR primers for this gene:

[0037] NtRRS4-qPCR-F: GTTGATGGAGTAGGACCGATGAGTAC, (SEQ ID NO.5)

[0038] NtRRS4-qPCR-R: ACAGAGCGAGGCAGCTCATCGAAAC, (SEQ ID NO. 6).

[0039] Total RNA from tobacco leaves before and after Ralstonia solanacearum infection was extracted using the CTAB method. TM Reverse Transcriptase (TAKARA) instruction manual: 1 μg of total RNA was reverse transcribed to synthesize single-stranded cDNA, the single-stranded cDNA was diluted 10 times, 2 μL was used as template, NtEF1α was used as internal reference gene (NtEF1α-F: TGCTGCTGTAACAAGATGGATGC (SEQ ID NO.7), NtEF1α-R: GAGATGGGGACAAAGGGGATT (SEQ ID NO.8)), and quantitative PCR reaction was performed using ABI7500 real-time fluorescence quantitative PCR instrument according to TAKARA company. Premix Ex Taq TM The kit protocol was used. The reaction system of 20 μL included 10 μL 2×SYBR Premix Ex-Taq buffer, 0.5 μL each of forward and reverse primers, and water was added to 20 μL. The qRT-PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 30 s, and 40 cycles. The relative expression was measured using 2 -△△Ct (Livak) method. Where △△Ct=(CT gene -CT actin ) 处理 -(CT gene -CT actin ) 对照 The results showed that the NtRRS4 gene was slightly down-regulated in the susceptible variety HD, then up-regulated at 24h, up-regulated to 2.69-fold at 72h, and down-regulated to 1.13-fold at 96h. In Yanyan 97, the expression was up-regulated as a whole, starting at 3h, slightly down-regulated at 12h, then up-regulated again, and significantly up-regulated to 5.58-fold at 24h. Then the expression was slowly down-regulated ( Figure 2 ).

[0040] Example 3 Analysis of resistance of transgenic tobacco overexpressing NtRRS4 to Ralstonia solanacearum

[0041] The overexpression vector p35S::NtRRS4-TAP in Example 1 was transformed into Agrobacterium GV3101, and then transformed into tobacco red flower Dajinyuan susceptible to bacterial wilt by the leaf disc method mediated by Agrobacterium tumefaciens. Positive transgenic lines were obtained by kanamycin screening and transgenic molecular identification. In order to verify whether the gene was recombined into the tobacco genome, the transgenic plants were DNA ( Figure 3 a) and RNA ( Figure 3 b) level verification, 52 positive plants were obtained; after statistical analysis, the positive rate of T0 generation transgenic plants was 96.3%. The wild-type and T0 generation transgenic tobacco were inoculated with Ralstonia solanacearum by vein injection, and grown under high temperature and high humidity conditions to allow Ralstonia solanacearum to develop. The disease development was observed after 18 days. The disease development of wild-type and transgenic tobacco was statistically analyzed according to the severity of tobacco bacterial wilt, and the disease index of each was calculated based on the obtained data. The results showed that the resistance of transgenic tobacco plants overexpressing the NtRRS4 gene to Ralstonia solanacearum was significantly enhanced compared with the wild-type control. The wild-type tobacco plants wilted or even died, indicating that overexpression of NtRRS4 can significantly enhance tobacco's resistance to bacterial wilt ( Figure 4 ).

[0042] The above descriptions are only some embodiments of the present invention, and are not intended to limit the protection scope of the present invention. Any equivalent device or equivalent process transformation made using the contents of the present invention specification and drawings, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A tobacco NBS-LRR disease resistance gene NtRRS4, characterized in that: Its nucleotide sequence is shown in SEQ ID No.

1.

2. The protein encoded by the tobacco NBS-LRR disease resistance gene NtRRS4 according to claim 1, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

2.

3. An overexpression vector, characterized in that: It includes the tobacco NBS-LRR disease resistance gene NtRRS4.

4. A method for constructing an overexpression vector of tobacco NBS-LRR disease resistance gene NtRRS4, characterized in that: The method comprises: constructing an entry vector pDONR207-NtRRS4 through BP reaction based on the Gateway system, and then constructing a plant expression vector p35S::NtRRS4-TAP driven by a CaMV35S promoter through LR reaction.

5. Use of the tobacco NBS-LRR disease resistance gene NtRRS4 or the protein encoded by it as claimed in claim 1 in tobacco bacterial wilt resistance genetic engineering.

6. Use of the overexpression vector as claimed in claim 3 in tobacco bacterial wilt resistance genetic engineering.

7. Use of the overexpression vector constructed by the construction method as claimed in claim 4 in tobacco bacterial wilt resistance genetic engineering.

Images