Mutants of maize auxin efflux carrier gene ZmPGP1 and their applications

Abstract

The present invention belongs to the field of genetic engineering and relates to a mutant of the maize auxin efflux carrier gene ZmPGP1 and its application. By editing the maize ZmPGP1 gene, its regulatory effects on maize plant height, flowering time and disease resistance were determined, and finally a mutant BR2<supgt;CR7< / supgt; with a relatively mild dwarf phenotype, a late-flowering phenotype and no effect on yield was obtained. Compared with the wild type KN5585, the BR2<supgt;CR7< / supgt> mutant effectively reduces the maize plant height, achieves dwarfing, and allows for reasonable close planting; it can also regulate the flowering time, with a later pollen scattering time, which is beneficial to avoiding yield reduction caused by the rainy season; it can also improve the disease resistance of maize. Compared with the wild type, the BR2<supgt;CR7< / supgt> mutant can effectively resist various pathogens under natural growth conditions, reduce the occurrence probability of yellow leaves and yellow spots, and ensure the survival rate and yield of maize. Therefore, the BR2<supgt;CR7< / supgt> mutant described in the present invention can be widely used for cultivating new maize varieties.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a mutant of a corn auxin export carrier gene ZmPGP1 and an application thereof. Background Art

[0002] The statements in this section merely provide background information related to the present invention and do not necessarily constitute prior art.

[0003] Corn is one of the three major crops in the world. It is an important food and feed crop and an important raw material plant for energy products. Plant height is an important agronomic trait of corn. It is closely related to lodging resistance, dense planting and final yield. It is one of the important indicators for measuring excellent varieties. The famous "Green Revolution" is that scientists used dwarfing genes to reduce plant height and thus improve crop resistance to lodging, which ultimately led to a significant increase in world grain production. Since 1930, corn planting density has been positively correlated with yield. Therefore, increasing planting density is the main and effective way to increase corn yield. However, an increase in planting density will also cause lodging and lead to a reduction in yield. Therefore, this requires materials with suitable plant height reduction, which can not only improve lodging resistance but also increase planting density and thus increase yield. Finding and constructing mutant materials with moderate plant height reduction is a crucial part that scientists have to do.

[0004] Brachytic2 (also known as BR2 / ZmPGP1 / ZmABCB1) is a classic gene that controls corn plant height. After mutation, corn stem nodes become shorter, resulting in a low ear position and a semi-dwarf phenotype. Due to its dwarfing phenotype, BR2 is called the "Green Revolution" gene by many scientists. Scientists have made a lot of efforts to use BR2 in actual breeding. However, almost all BR2 mutants cause severe phenotypes, and no relatively mild or minor traits have been found, making it difficult for breeders to use it. Summary of the invention

[0005] In order to overcome the deficiencies of the above-mentioned prior art, the present invention provides a mutant of a maize auxin efflux carrier gene ZmPGP1 and its application. By performing a series of editing on the maize ZmPGP1 gene, a mutant with a relatively mild dwarfing phenotype, a late flowering phenotype, and no effect on yield is finally obtained. It can be used to construct model plants and cultivate new germplasm resources.

[0006] BR2 / ZmPGP1 / ZmABCB1 (gene number: GRMZM2G315375) is an auxin efflux carrier gene with unclear polarity, which is related to plant height, leaf angle, yield, lodging resistance, root development, corresponding abiotic stress, gravity response, etc. With the in-depth study of the BR2 gene, scientists have used gene editing, genome selection and other means to modify and screen the function of BR2, and a series of new natural and artificially modified variant materials of the BR2 gene have emerged, which have gradually been applied to breeding in terms of reducing plant height, and played an important role in the breeding process of short-stem dense planting and high-yield.

[0007] To achieve the above objectives, one or more embodiments of the present invention provide the following technical solutions:

[0008] In a first aspect, a mutant of the maize ZmPGP1 gene is provided.

[0009] In one or more embodiments of the present invention, the nucleotide sequence of the mutant is:

[0010] (I) as shown in SEQ ID NO.1; or

[0011] (II) A nucleotide sequence that encodes the same protein as the nucleotide sequence of (I), but is different from the nucleotide sequence of (I) due to the degeneracy of genetic coding.

[0012] In a second aspect, a biological material is provided, comprising the mutant according to the first aspect.

[0013] In one or more embodiments of the present invention, the biological material is one or more of a recombinant expression vector, a plasmid, an expression cassette or a recombinant bacterium.

[0014] In a third aspect, a gene knockout vector is provided, wherein the vector uses the pCXB053 plasmid as a backbone and comprises sgRNAs as shown in SEQ ID NO.2 and SEQ ID NO.3.

[0015] Preferably, the vector is a dual-target expression vector;

[0016] Further preferably, the vector is expressed in plant cells and Escherichia coli.

[0017] In a fourth aspect, a host is provided, wherein the host comprises the vector according to the third aspect;

[0018] The host cell may be a prokaryotic cell or a eukaryotic cell;

[0019] Specifically, the host cell is any one or more of a bacterial cell, a fungal cell or a plant cell.

[0020] Wherein, the bacterial cell is any species within the genus Escherichia, Agrobacterium, Bacillus, Streptomyces, Pseudomonas or Staphylococcus, and the bacterial cell is Escherichia coli (such as Escherichia coli DH5α), Agrobacterium tumefaciens (such as EHA105), Agrobacterium rhizogenes, Lactococcus lactis, Bacillus subtilis, Bacillus cereus or Pseudomonas fluorescens.

[0021] The fungal cells include yeast.

[0022] Preferably, the host comprises Escherichia coli, Agrobacterium tumefaciens or a non-regenerable plant part.

[0023] In a fifth aspect, a corn ZmPGP1 gene mutation kit based on CRISPR-Cas9 gene knockout technology is provided, comprising:

[0024] (1) sgRNA molecules, whose sequences are shown in SEQ ID NO. 2 and SEQ ID NO. 3;

[0025] (2) a DNA molecule encoding the sgRNA;

[0026] (3) A vector for expressing the sgRNA molecule.

[0027] The vector is constructed by the following steps: using pCXB053 plasmid as the starting vector, digesting with BsaI and recovering the backbone, connecting the linearized plasmid with BsaI sticky ends, gRNA-U6 and dual targets to obtain a dual-target knockout vector;

[0028] The kit also includes matching detection reagents for detecting the splicing effect of the BR2 gene and evaluating the gene knockout efficiency.

[0029] In a sixth aspect, use of the mutant described in the first aspect, the biological material described in the second aspect, the vector described in the third aspect, the host described in the fourth aspect, or the kit described in the fifth aspect in any one or more of the following is provided:

[0030] (A1) Application in corn breeding or developing new corn germplasm; and / or

[0031] (A2), application to reduce the height of corn plants; and / or

[0032] (A3), application for regulating flowering time of corn; and / or

[0033] (A4) Application to improve disease resistance of corn.

[0034] In the seventh aspect, a method is provided for reducing corn plant height, regulating corn flowering time, improving corn disease resistance or increasing corn yield, comprising using gene editing technology to modify ZmPGP1; or, expressing the nucleotide sequence of the mutant described in the first aspect in wild-type corn, and the sgRNA sequence used in the gene editing technology is shown in SEQ ID NO.2 and SEQID NO.3.

[0035] In an eighth aspect, a corn breeding method is provided, comprising modifying ZmPGP1 using gene editing technology; or, expressing the nucleotide sequence of the mutant described in the first aspect in wild-type corn.

[0036] Preferably, the method comprises the step of introducing the mutant of the first aspect into a plant cell, a plant seed, a plant tissue, a plant part or a plant, and the plant is corn.

[0037] Preferably, the corn is the inbred line KN5585, and the nucleotide sequence of the BR2 gene thereof is shown in SEQ ID NO.4 (including promoter and coding region sequences).

[0038] One or more of the above technical solutions have the following beneficial effects:

[0039] The present invention discloses a CRISPR / Cas9 knockout target sequence of the ZmPGP1 gene and a mutation type BR2 after editing thereof CR7 In the present invention, the ZmPGP1 gene of maize was knocked out to determine its regulatory effect on maize plant height, flowering time and disease resistance. Compared with the wild type KN5585, BR2 CR7 The mutant effectively reduces the height of corn plants, achieving dwarfing, and can be planted reasonably densely; it can also regulate the flowering time, and the pollen shedding time becomes later, which is beneficial to avoid the reduction in yield caused by the rainy season; it can also improve the disease resistance of corn. Compared with the wild type, under natural growth conditions, it can effectively resist a variety of pathogens, reduce the probability of yellow leaves and yellow spots, and ensure the survival rate and yield of corn. Therefore, the BR2 of the present invention CR7 Mutants can be widely used to breed new corn varieties.

[0040] Advantages of additional aspects of the present invention will be given in part in the following description, and in part will become obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0042] Figure 1This is a schematic diagram of a dual-target combination design according to Example 1 of the present invention.

[0043] Figure 2 Schematic diagram of the construction of a dual-target vector according to Example 1 of the present invention, A: schematic diagram of the construction idea, B: schematic diagram of the knockout vector.

[0044] Figure 3 This is a schematic diagram of the editing types of gene editing materials in Example 1 of the present invention.

[0045] Figure 4 The plant height and yield of the gene-edited mutants of Example 2 of the present invention, A: plant height phenotype diagram, B: plant height statistical diagram, C: yield statistical diagram, * indicates P < 0.05, ** indicates P < 0.01.

[0046] Figure 5 This is a statistical diagram of flowering phenotype and flowering time of Example 2 of the present invention, with the upper part showing flowering phenotype and the lower part showing flowering time statistics, * indicates P<0.05, and ** indicates P<0.01.

[0047] Figure 6 This is the second embodiment of the present invention BR2 CR7 It has comprehensive high disease resistance. DETAILED DESCRIPTION

[0048] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0049] It should be noted that the details of the present invention are known to those skilled in the art. The experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions or according to the conditions recommended by the manufacturer. The experimental steps that are not recorded in detail refer to "Molecular Cloning Laboratory Manual" (Edited by (US) MR Green (Michael R. Green), (US) J. Sambrook (Joseph. Sambrook), fourth edition), pathophysiological experiments, online databases, etc.

[0050] In the following examples, the materials and reagents used were obtained from commercial sources unless otherwise specified.

[0051] In the present invention, the names and functional information of the carrier elements used are as follows;

[0052]

[0053]

[0054] The specific sequence and usage of plasmid pCXB053 are as follows: Liu HJ, Jian L, Xu J, Zhang Q, Zhang M, Jin M, Peng Y, Yan J, Han B, Liu J, Gao F, Liu X, Huang L, Wei W, Ding Y, Yang X, Li Z, Zhang M, Sun J, Bai M, Song W, Chen H, Sun X, Li W, Lu Y, Liu Y, Zhao J, Qian Y, Jackson D, Fernie AR, Yan J. High-Throughput CRISPR / Cas9 Mutagenesis Streamlines Trait Gene Identification in Maize. Plant Cell. 2020 May; 32(5): 1397-1413. doi: 10.1105 / tpc.19.00934. Epub 2020 Feb 25.PMID:32102844; PMCID:PMC7203946.

[0055] gRNA-ZmU6 is a synthetic sequence, the nucleotide sequence is: (SEQ ID NO.5)

[0056] The maize inbred line KN5585 is from the inbred line bred by Weimi Biotechnology (Jiangsu) Co., Ltd.

[0057] The present invention will be further described in detail below in conjunction with specific embodiments. It should be noted that the specific embodiments are intended to explain the present invention rather than to limit it.

[0058] Embodiment 1

[0059] This example discloses the construction of a ZmPGP1 gene mutant (hereinafter referred to as BR2 CR7 mutant) method.

[0060] This method mainly includes the following steps:

[0061] 1. Construct a gene knockout dual-target vector targeting BR2;

[0062] 2. Transform the above vectors into corn KN5585;

[0063] 3. After the positive seedlings are obtained through genetic transformation, they are planted in the field and harvested with meticulous management;

[0064] 4. Detect the gene editing type of T1 seedling DNA. More than 10 transgenic events were obtained for each vector, and more than 40 transgenic events were obtained in total. Primers 5'-ACCGTATCTCAACAAACACCTT-3' (SEQ ID NO.6) and 5'-GTGTGGTGGGCCTTACAGT-3' (SEQ ID NO.7) were designed to amplify and sequence the target editing segment. The resulting PCR product was submitted to Sangon Biotech (Shanghai) Co., Ltd. for Sanger sequencing. The results were compared with the genome of the wild-type KN5585 to screen out the expected pure and gene-edited mutants.

[0065] The above steps are described in detail below.

[0066] 1. Construction of a gene knockout vector targeting BR2

[0067] (1) Design of sgRNA targeting sequence for BR2 gene

[0068] The BR2 gene sequence (gene number: GRMZM2G315375) in the KN5585 receptor inbred line was compared and downloaded from the website https: / / db.cngb.org / zeamap / tools / blast. Targets were designed based on the BR2 gene. The schematic diagram of the target and gene location is shown in Figure 1 Each knockout vector is designed with dual targets, using the online sgRNA target sequence design tool CRISPR-P v2.0(hzau.edu.cn) The obtained sgRNA sequence is shown in Table 1. When synthesizing the double-stranded DNA, BsaI restriction sites are added at both ends of the sequence. The specific target sequence is shown in Table 1.

[0069] Table 1: BR2 gene knockout target information

[0070]

[0071]

[0072] (2) CRISPR / Cas9 plasmid construction

[0073] Schematic diagram of knockout plasmid construction is shown in Figure 2 , Figure 2 The A in the figure represents the construction idea. Figure 2 B in the figure represents a schematic diagram of the knockout vector after the target site is inserted.

[0074] Synthesize sgRNA target primers (as shown in Table 1). Dilute the primers in Table 1 to 10 μM, anneal to obtain targets with BsaI sticky ends, and the annealing system is Anneal Buffer (50 μL), SG1 (2.5 μL), SG2 (2.5 μL); the annealing program is 95°C for 3 min, the temperature is uniformly decreased (0.1°C / s) to 20°C, and stored at -20°C for future use.

[0075] The company synthesized the gRNA-ZmU6 fragment, and the nucleotide sequence is shown in SEQ ID NO.5. In a 10μL system, use T4 ligase to connect 6μL gRNA-ZmU6 fragment (1μM) and 2μLT vector at 25℃ for 1h, take 2μL of the ligation product and transform it into competent DH5α, culture it at 37℃ for 16h, pick monoclonal colonies, extract plasmids by alkaline lysis small amount method, and perform PCR identification. After correct identification, send it to the company for sequencing. Store monoclonal colonies containing the correct inserted fragment gRNA-ZmU6 plasmid at -80℃. The above T vector was amplified with primers Bsa-sg-ZmU6F1: GGGGTCTCTTAGAGCTAGAAATAGCAAG (SEQ ID NO.8) and Bsa-sg-ZmU6R1: GGGGTCTCTCGGTGCTTGCGGCTCGGTTTAT (SEQ ID NO.9) to obtain the gRNA-U6 fragment. According to the instructions for use of BsaI enzyme digestion, the gRNA-U6 fragment was digested with a 50 μL system. The enzyme digestion system: purified PCR product (0.5 μL), ddH2O (40.5 μL), Buffer (5 μL), BsaI (4 μL); digestion was performed at 37°C for 5 h, and the gRNA-U6 fragment with BsaI sticky ends was recovered by gel (full gold recovery kit), diluted with water to 25 ng / uL, and then an equal volume of T4 Buffer was added to make a storage solution, which was stored at -20°C for later use.

[0076] According to the instructions for use of BsaI enzyme digestion, the plasmid pCXB053 was digested with 50μL of enzyme digestion system: plasmid (5ug), Buffer 5uL, BsaI enzyme 4uL, H2O to 50uL. Incubate at 37℃ for 4h, gel recovery (full gold recovery kit) plasmid fragments, add water to dilute to 50ng / uL, and then add an equal amount of T4 Buffer to dilute to obtain a linearized plasmid stock solution with the ccdb gene removed and BsaI sticky ends, and store at -20℃ for later use.

[0077] First, connect the gRNA-ZmU6 fragment to the dual target, 4uL connection system, gRNA-ZmU6 storage solution 1uL, dual target 0.5uL, T4 ligase 0.3uL, add H2O to make up to 4uL. Connect at 25℃ for 1h, take out the connection product, then add pCXB053 linearized vector storage solution 1uL, T4 ligase 0.5uL, ddH2O4.5uL, connect at 25℃ for 1h, take 3uL to transform Escherichia coli DH5α; pick positive clones for sequencing and extract plasmids, sequencing verification primers are: BGK055F: CTGGCGAAAGGGGGATGTGCTGCAA and BGK053R: TCAAACAAgTgTgACAAAAA. Obtain dual-target knockout vectors BR2-a, BR2-b, BR2-c, and BR2-d.

[0078] The main elements of the knockout vector were connected in the following order: ZmU6 promoter-sgRNA1-gRNA scaffold-ZmU6 promoter-sgRNA2-gRNA scaffold-UBI promoter-cas9-screening marker Bar. The ZmU6 promoter and UBI promoter were consistent with those in the literature (Liu et al., 2020).

[0079] 2. Transform the knockout vector into corn KN5585

[0080] (1) Plasmid vector transformation of Agrobacterium

[0081] The double-target knockout vectors BR2-a, BR2-b, BR2-c, and BR2-d were transformed into Agrobacterium EHA105 by electroporation, and single clones were picked out for culture in bacterial liquid and PCR identification and stored in a -20°C refrigerator for future use.

[0082] (2) Bacterial Activation

[0083] Take out Agrobacterium from the refrigerator and streak culture on YEP solid medium.

[0084] (3) Prepare Agrobacterium infection solution

[0085] Scrape fresh bacteria from the newly activated bacterial plate and resuspend them in the infection solution.

[0086] (4) Taking corn embryos

[0087] The immature embryos of the maize inbred line KN5585 of about 1 mm were peeled off, and about 150 peeled maize immature embryos were placed in a 2 mL plastic centrifuge tube containing 1.8 mL of a suspension (infection medium containing AS, without Agrobacterium) and treated for 30 min.

[0088] (5) Infection

[0089] Remove the suspension in (4) and leave the remaining corn embryos in the tube. Then add 1.0 mL of Agrobacterium infection solution, gently invert for 10-15 times, and let stand for 5-10 minutes. Take a clean culture dish and place 3 sterilized filter papers. After the infection is complete, invert it several times and quickly pour the bacterial solution onto the filter paper. Hold the culture dish and change the direction so that the bacterial solution carrying the young embryos is evenly distributed on the filter paper.

[0090] (6) Co-culture

[0091] When the bacterial liquid can no longer be seen on the top layer of filter paper, use tweezers to pick up the upper layer of filter paper, and stick the side stained with immature embryos on the co-culture medium. Use tweezers to drive out the bubbles between the filter paper and the culture medium, then use tweezers to pinch a corner of the filter paper and quickly peel it off. Use an embryo peeling knife to transfer the immature embryos remaining on the filter paper to the culture medium, with the shield side of the immature embryo facing up, and culture in the dark at 23°C for 3 days.

[0092] (7) Recovery culture

[0093] After 3 days of co-cultivation, the young embryos were transferred to a resting medium and cultured in the dark at 28°C for 6 days. They were then placed on a screening medium containing 5 mg / L Bialaphos for a 2-week screening culture and then transferred to a screening medium containing 8 mg / L Bialaphos for a 2-week screening culture.

[0094] (8) Differentiation culture

[0095] The resistant callus was transferred to differentiation medium 1 and cultured at 25°C, 5000lx, and light for 1 week. The callus was then transferred to differentiation medium 2 and cultured at light for 2 weeks. The differentiated seedlings were transferred to rooting medium and cultured at 25°C, 5000lx, and light until roots were formed. The seedlings were transferred to small pots for growth, and transplanted to a greenhouse after a certain growth stage. The offspring seeds were harvested after 3-4 months.

[0096] 3. After screening the transformation positive seedlings, plant them in the field for harvest

[0097] The transgenic positive seedlings obtained by genetic transformation of KN5585 were planted in the field, carefully cared for and harvested, and the editing type of each plant was identified after herbicide screening and amplification and sequencing of the edited region.

[0098] For positive seedlings, a small amount of leaves were taken to extract genomic DNA using the TPS method.

[0099] For positive seedlings, the target edited region was amplified and sequenced using the primer pair 5'-ACCGTATCTCAACAAACACCTT-3' (SEQ ID NO. 6) and 5'-GTGTGGTGGGCCTTACAGT-3' (SEQ ID NO. 7).

[0100] The amplification system was: DNA template: 1 μL, 2×TaqMix: 10 μL, double primers 1 μL each, ddH2O: 8 μL, total volume 20 μL. PCR reaction procedure: (1) 94°C for 5 minutes, (2) 94°C for 15 seconds, (3) 58°C for 15 seconds, (4) 72°C for 2 minutes (universal), (5) (2)-(4) steps for 35 cycles, (6) 72°C for 5 minutes, (7) stored at 4°C. The PCR product was sequenced by Bioengineering Co., Ltd., and the results were compared with the wild-type KN5585 genome. It was found that BR2-a, BR2-b, BR2-c, and BR2-d corresponded to the homozygous mutant BR2 CR7 BR2 CR1 BR2 CR8 and BR2 CR10 , and the editing efficiency is above 90%, and the editing types are shown in Table 2 and Figure 3 shown.

[0101] Table 2 Dual-target vector editing types

[0102]

[0103] Embodiment 2

[0104] This example provides the application of BR2 homozygous mutants in corn breeding.

[0105] The pure corn mutants obtained in Example 1 were planted in the Huanghuaihai Transgenic Corn Pilot and Industrialization Base of Shandong Academy of Agricultural Sciences (36°46′49″N, 117°23′05″E) in June 2020 and managed normally. During the period, the disease resistance was observed, the pollen shedding time was recorded, and the plant height was measured after pollination. The results showed that compared with the wild type, the plant height of all mutants was reduced ( Figure 4 A, B), among which BR2 CR7 The mutant plant height was 29% lower than that of the wild type. The yield was statistically analyzed and found that at a density of 4500 plants per mu, BR2 CR7 The average yield per plant of the mutant was 194 g, which was not significantly different from the wild type (202 g) (T-TEST test P>0.05, the difference was not significant); however, BR2 CR-8 BR2 CR-10 The yield of Figure 4 C) In the general direction of corn breeding to reduce height, increase density and increase yield, BR2 CR7 It has high potential for breeding applications, so BR2 is selected. CR7 As germplasm.

[0106] In the summer of 2020, the flowering time and disease resistance of 4 planting sites in Huanghuaihai were observed and recorded, with more than 200 seeds at each site. It was found that the wild type had already lost pollen 57 days after planting, but BR2 CR7 The powder does not start to shed until 61 days after planting, so BR2 CR7 The late-flowering phenotype was observed, with an average pollen shedding period of 4 days later than that of the wild-type control (WT). Figure 5 ). At the same time, it was found during the planting period that BR2 CR7 With comprehensive high disease resistance ( Figure 6 ), showing high resistance to mosaic virus, moderate resistance to rust, and high resistance to hypersensitivity reactions.

[0107] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A mutant of the maize ZmPGP1 gene, characterized in that: The nucleotide sequence of the mutant is shown in SEQ ID NO.1, which has a 725-base deletion relative to the nucleotide sequence of the parent ZmPGP1 gene, and the nucleotide sequence of the parent ZmPGP1 gene is shown in SEQ ID NO.4; the parent ZmPGP1 gene is derived from the maize inbred line KN5585.

2. Biomaterial, characterized in that Including the mutant as claimed in claim 1, the biological material is one or more of a recombinant expression vector, a plasmid, an expression cassette or a recombinant bacterium.

3. Use of the mutant according to claim 1 or the biological material according to claim 2 in corn breeding.

4. The use according to claim 3, characterized in that The corn breeding is: (A1), reducing corn plant height; (A2), regulating the flowering time of corn; (A3) Improve disease resistance of corn; Among them, regulating the flowering time of corn specifically means making the corn have a late flowering phenotype.

Images