PCR (Polymerase Chain Reaction) primer for identifying sex of hucho bleekeri, kit, identification method and application

Abstract

The invention discloses a PCR primer for identifying sex of hucho bleekeri, a kit, an identification method and application, and belongs to the technical field of biological detection. The invention develops a novel PCR primer for detecting sex of hucho bleekeri based on the sdy gene of hucho bleekeri. The primer provided by the invention can be used for specifically amplifying the sdy gene segment of the hucho bleekeri Kimura, a male individual has a specific amplified segment of 343bp, and a female individual does not have the specific amplified segment of 343bp, so that the sex of the hucho bleekeri Kimura can be simply and accurately distinguished. According to the identification method disclosed by the invention, under the condition that the hucho bleekeri does not need to be killed, the sex of the hucho bleekeri can be identified only by clipping the fin rays, and meanwhile, the sex of juvenile fishes with sexual glands not mature can also be identified in advance. And help is provided for sex control breeding of hucho bleekeri, wild resource protection and development of the breeding industry.

Description

Technical Field

[0001] The invention relates to the technical field of biological detection, and in particular to a PCR primer, a kit, an identification method and an application for identifying the sex of Sichuan-Shaanxi Taimen. Background Art

[0002] Sichuan-Shaanxi Tailings Hucho bleekeri Kimura ) is a member of the order Salmoniformes, family Salmonidae, genus Taimen Hucho ) fish, also known as tiger fish, Brock's Taimen, Sichuan Taimen, Bei's Taimen, cat fish, etc. Sichuan-Shaanxi Taimen is the only large indigenous salmonid fish in the Qinghai-Tibet Plateau. It is a relict species from the Quaternary glacial period and the southernmost species of Taimen fish. It has important research value in academic, ecological, humanistic and economic aspects. It is also a Chinese endemic fish species and an important cold-water fish germplasm resource in the upper reaches of the Yangtze River. Since the 1960s, affected by human activities and other factors, most of the habitats of Sichuan-Shaanxi Taimen have been destroyed, the distribution area has been significantly reduced, and the size of the wild population has sharply decreased. At present, only a certain number of them are distributed in the upper reaches of the Dadu River and some waters of the Taibai River. Due to its small population, in 2021, Sichuan-Shaanxi Taimen was listed as a national first-class key protected wild animal in the "National Key Protected Wildlife List" and was listed as critically endangered in the "Red List of the World Conservation Union".

[0003] The Taimen salmon have no secondary sexual characteristics, and their external features are not sufficient for sex identification. In addition, the Taimen salmon take a long time to reach sexual maturity, and the age of sexual maturity is generally more than 3 years. This has brought great difficulties to the protection, reproduction and release of wild Taimen salmon resources and the development of artificial breeding. Therefore, sex identification has become a hot and focal issue in the protection of wild resources and artificial breeding of Taimen salmon. At present, obtaining information related to the sex of Taimen salmon is usually done by dissection, removing the gonads for observation or tissue section identification. The accuracy of this method is affected by the size of the individual and the stage of gonad development, and it needs to be performed after live dissection. Therefore, there is an urgent need to develop a sex identification method that is fast, efficient, and less harmful to Taimen salmon. Summary of the invention

[0004] In order to solve the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a PCR primer, a kit, an identification method and an application for identifying the sex of Sichuan-Shaanxi Taimen, so as to solve the problem that the existing sex identification method has a slow detection speed and causes great harm to Sichuan-Shaanxi Taimen.

[0005] The technical solution of the present invention to solve the above technical problem is as follows: a PCR primer for sex identification of Sichuan-Shaanxi Taimen is provided, the upstream primer sequence of the PCR primer is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2.

[0006] The invention provides a kit for sex identification of Sichuan-Shaanxi Taimen, comprising the above-mentioned PCR primers.

[0007] The invention provides a method for identifying the sex of Sichuan-Shaanxi Taimen, comprising the following steps: using the total DNA of the Sichuan-Shaanxi Taimen to be tested as a template, using the above-mentioned PCR primers or the above-mentioned kit to perform PCR amplification, and detecting the PCR product.

[0008] Furthermore, the reaction system for PCR amplification was: 25 μL of 2×Es Taq Master Mix (Dye), 1.5 μL of upstream primer F, 1.5 μL of downstream primer R, 1.0 μL of template / sample, and 21.0 μL of RNase Free Water.

[0009] Furthermore, the reaction conditions for PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 54°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; and finally extension at 72°C for 8 min.

[0010] Furthermore, if the PCR primers amplify a band of 343 bp in size, the Sichuan-Shaanxi Taimen to be tested is determined to be male, and if the PCR primers do not amplify a band of 343 bp in size, the Sichuan-Shaanxi Taimen to be tested is determined to be female.

[0011] The present invention provides an application of the above identification method in identifying the sex of Sichuan-Shaanxi Taimen.

[0012] The present invention provides an application of the PCR primers in identifying the sex of Sichuan-Shaanxi Taimen.

[0013] The present invention also provides an application of the kit in identifying the sex of Sichuan-Shaanxi Taimen.

[0014] The present invention has the following beneficial effects: Based on the sdy gene of the taimen, the present invention has developed a new PCR primer for detecting the sex of the taimen. The primers of the present invention can be used to specifically amplify the sdy gene fragment of the taimen, and the male individual has a 343bp specific amplification fragment, while the female individual has no 343bp specific amplification fragment, so the sex of the taimen can be distinguished simply and accurately. The identification method of the present invention can identify the sex of the taimen without killing the taimen, only by cutting the fin rays, and the sex of young fish whose gonads are not mature can also be identified in advance. It provides assistance for the development of sex-controlled breeding, wild resource protection and aquaculture industry of the taimen. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1This is the gel electrophoresis diagram for identifying the sex of Sichuan-Shaanxi Taimen in the present invention. DETAILED DESCRIPTION

[0016] The following examples are only used to explain the present invention and are not intended to limit the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0017] Example 1 PCR primer design In order to obtain high-quality specific molecular markers for sex identification of Sichuan-Shaanxi Taimen, the present invention uses Primeri 5.0 software to design specific primers suitable for PCR amplification based on the sdy gene coding sequence of Sichuan-Shaanxi Taimen obtained by sequencing. The primers are shown in Table 1.

[0018] Table 1 Primer information

[0019] Example 2 Sex Identification of Sichuan-Shaanxi Taimen (1) Verify sample genomic DNA extraction The fin rays of the tested Sichuan-Shaanxi Taimen were cut, and the genomic DNA was extracted using a universal column-type genomic DNA extraction kit (purchased from Jiangsu Kangwei Century Technology Co., Ltd., catalog number: CW2298M). The extraction method is shown in the kit manual.

[0020] (2) PCR amplification DNA polymerase: 2× Es Taq Master Mix (Dye) (purchased from Jiangsu Kangwei Century Technology Co., Ltd., catalog number: CW0690L), PCR reaction system is shown in Table 2, and PCR reaction conditions are shown in Table 3.

[0021] Table 2 PCR reaction system

[0022] Table 3 PCR reaction conditions

[0023] The nucleotide sequence of the amplified 343 bp gene fragment is as follows: CCCAGCACTCTTTTCTTGTCTCAGTGGAGTACTGTGAAGAGGAGGTTCTTAGTCATGAGGTCATGGGGGGTGATGTCAGAATTGCCTACAAGCCCTCCCTAATGATGGATGGGATCCCCATCATCTCTCTCCCAAAGCCTCCCAACACCCTTCCCATCTCCTCTGACCGTTCA ATCCTCTCCAACCTGCTGTCCCTCATGGAGGGTGGAGTGGTTTTAAGCTCTAGGGAGGAAGGCATCTATGCTGAACAGCATAGCCAAGCCACAGTCTCCTGGATGGGTGGCACGGGGGATGAGATGCACATGATGGAGCGTGATGTGGATCCTGTGATGCTCTTCAACAG (SEQ ID NO.3).

[0024] (3) Gel electrophoresis Markers used: M is DNA Marker A (25-500bp); DNA Marker A (25-500bp) consists of 9 DNA fragments, 500bp, 400bp, 300bp, 200bp, 150bp, 100bp, 75bp, 50bp and 25bp (purchased from Shanghai Shenggong Biotechnology Technology Service Co., Ltd., catalog number #B600303). Take 5μL PCR amplification solution and directly perform electrophoresis at a voltage of 120V for 30min.

[0025] (4) Results and statistics The samples were dissected and the gonads were examined to determine their sex: samples 1-8 were female Sichuan-Shaanxi Taimen samples; samples 9-16 were male Sichuan-Shaanxi Taimen samples. The results of PCR product electrophoresis are shown in Figure 1 ; The lane numbers in the figure are consistent with the sample numbers. Figure 1 It can be seen that the male Sichuan-Shaanxi Taimen sample has a target band of 343 bp, while the female Sichuan-Shaanxi Taimen sample does not have a target band of 343 bp. It can be seen that the results of the sex identification of Sichuan-Shaanxi Taimen in the present invention are consistent with the results of the gonad identification by dissection. This shows that the 1 pair of specific PCR primers for sex identification of Sichuan-Shaanxi Taimen screened by the present invention can achieve the purpose of accurately identifying the male and female sex of Sichuan-Shaanxi Taimen.

[0026] In summary, the present invention has developed a new specific PCR primer and identification method for identifying the sex of Sichuan-Shaanxi Taimen, which lays a foundation for the future research on the sex determination gene and exploration of the sex determination mechanism of Sichuan-Shaanxi Taimen.

[0027] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A PCR primer for sex identification of Sichuan-Shaanxi Taimen, characterized in that: The upstream primer sequence of the PCR primer is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.

2.

2. A kit for sex identification of Sichuan-Shaanxi Taimen, characterized in that: Comprising the PCR primers described in claim 1.

3. A method for identifying the sex of Sichuan-Shaanxi Taimen, characterized in that: The following steps are involved: The total DNA of Sichuan-Shaanxi Taimen to be tested is used as a template, and PCR amplification is performed using the PCR primers described in claim 1 or the kit described in claim 2, and the PCR product is detected.

4. The method for identifying the sex of Sichuan-Shaanxi Taimen according to claim 3, characterized in that: The reaction system of the PCR amplification is: 25 μL of 2×Es Taq Master Mix (Dye), 1.5 μL of upstream primer F, 1.5 μL of downstream primer R, 1.0 μL of template / sample and 21.0 μL of RNase Free Water.

5. The method for identifying the sex of Sichuan-Shaanxi Taimen according to claim 3, characterized in that: The reaction conditions of the PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 54°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; and finally extension at 72°C for 8 min.

6. The method for identifying the sex of Sichuan-Shaanxi Taimen according to claim 3, characterized in that: If the PCR primers amplify a band of 343 bp in size, the Sichuan-Shaanxi Taimen to be tested is determined to be male; if the PCR primers do not amplify a band of 343 bp in size, the Sichuan-Shaanxi Taimen to be tested is determined to be female.

7. Use of the identification method according to any one of claims 3 to 6 in identifying the sex of Sichuan-Shaanxi Taimen.

8. Use of the PCR primers described in claim 1 in identifying the sex of Sichuan-Shaanxi Taimen.

9. Use of the kit according to claim 2 in identifying the sex of Sichuan-Shaanxi Taihu salmon.

Images