Application of Kif13b gene in treatment of atherosclerosis

Abstract

The invention discloses application of a Kif13b gene in treatment of atherosclerosis, belongs to the technical field of functions and application of genes, and provides application of the Kif13b gene as a drug target in screening of drugs for preventing, relieving and / or treating atherosclerosis. The molecular mechanism that the Kif13b gene integrates lipid metabolism and inflammatory response through macrophage phagocytosis is clarified, and a new theoretical basis and an intervention strategy are provided for prevention and treatment of atherosclerosis.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene function and application, and in particular relates to the application of Kif13b gene in treating atherosclerosis. Background Art

[0002] The incidence of atherosclerotic cardiovascular disease (ASCVD) is steadily increasing and remains the leading cause of death worldwide. Rupture of unstable atherosclerotic plaques is the main direct cause of myocardial infarction (MI) and ischemic stroke. Atherosclerosis is a chronic inflammatory disease whose pathological process usually includes endothelial damage, lipid accumulation in the arterial wall, inflammatory cell infiltration, smooth muscle cell proliferation, and extracellular matrix remodeling.

[0003] In general, abnormal lipid metabolism and inflammation are key factors in the development and progression of atherosclerosis. Excessive uptake of low-density lipoprotein (LDL) and / or insufficient high-density lipoprotein (HDL)-mediated lipid export by different types of cells in the arterial wall trigger the formation of lipid-rich plaques. At the same time, the inflammatory response activates immune cells to secrete cytokines and chemokines, which in turn promote plaque formation and instability. However, despite extensive research on these processes, their exact molecular mechanisms are still incompletely understood, and the incidence of atherosclerosis has remained high over the past few decades. Currently, lipid-lowering drugs, especially statins, are the main drugs for the treatment of atherosclerosis. However, lipid-lowering therapy has a limited effect on reducing cardiovascular risk, because patients treated with lipid-lowering drugs still have a higher residual risk of ASCVD, indicating that the exact molecular mechanisms of the pathogenesis of atherosclerosis have not been widely documented and potential therapeutic targets remain to be identified.

[0004] The kinesin-3 family is classified as an N-terminal motor protein with eight family members, which were originally discovered to facilitate rapid transport in neural cells. Independent studies have shown that defects in kinesins can lead to the development of neurological and metabolic diseases. Kinesin family member 13B (KIF13B), the largest member of the kinesin-3 family, has been reported to play a crucial role in regulating the recycling and trafficking of many important receptors that mediate signal transduction, such as vascular endothelial growth factor receptor (VEGFR) and low-density lipoprotein receptor-related protein 1 (Lrp1), implying that KIF13B may be a key regulator responsible for vascular homeostasis. However, the relationship between KIF13B and ASCVD has not been established, and information on the molecular mechanism by which KIF13B restricts the development of atherosclerosis is still lacking.

[0005] Currently, only anti-lipid drugs or anti-inflammatory drugs combined with anti-thrombotic drugs can delay the development of atherosclerosis in clinical practice, but they cannot effectively reverse atherosclerosis caused by different reasons. Summary of the invention

[0006] In order to solve the above technical problems, the present invention proposes the use of Kif13b gene in the treatment of atherosclerosis, and regulates macrophage function by targeted regulation of Kif13b gene therapy, thereby treating or delaying atherosclerosis.

[0007] To achieve the above object, the present invention provides the use of Kif13b gene as a drug target in screening drugs for preventing, alleviating and / or treating atherosclerosis.

[0008] Preferably, the nucleotide sequence of the Kif13b gene is as shown in SEQ ID NO.1.

[0009] Preferably, the drug for preventing, alleviating and / or treating atherosclerosis is a drug that promotes overexpression of the Kif13b gene.

[0010] Preferably, the drug for preventing, alleviating and / or treating atherosclerosis promotes overexpression of the Kif13b gene, enhances macrophage efferocytosis, reduces the formation of arterial necrotic cores, and treats atherosclerosis.

[0011] The present invention also provides the use of the drug for promoting the overexpression of the Kif13b gene in the preparation of a drug for preventing, alleviating and / or treating atherosclerosis.

[0012] The present invention also provides a drug for preventing, alleviating and / or treating atherosclerosis, including a drug for promoting overexpression of the Kif13b gene.

[0013] Compared with the prior art, the present invention has the following advantages and technical effects:

[0014] In view of the important role of Kif13b gene in maintaining normal vascular function, the present invention speculates that Kif13b may be involved in the pathogenesis of atherosclerosis. The present invention studies the specific role and mechanism of Kif13b gene in atherosclerosis, clarifies the molecular mechanism of Kif13b gene integrating lipid metabolism and inflammatory response through macrophage phagocytosis, and provides a new theoretical basis and intervention strategy for the prevention and treatment of atherosclerosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0016] Figure 1 Flowchart for constructing Kif13b;Ldlr double knockout mice, WT represents wild-type C57 mice, Kif13b - / - Representative Kif13b knockout mice, Ldlr - / - Representative Ldlr knockout mice, Kif13b - / - ;Ldlr - / - represents Kif13b;Ldlr double knockout mouse;

[0017] Figure 2 This is a diagram of the dietary pattern of Kif13b; Ldlr double gene knockout mice. - / - Representative Ldlr knockout mice, Kif13b - / - ;Ldlr - / - represents Kif13b;Ldlr double knockout mouse;

[0018] Figure 3 This is a statistical chart of total cholesterol and plasma triglyceride levels in Kif13b knockout mice, where A is total cholesterol content, B is plasma triglyceride content, and LDLR - / - Representative Ldlr knockout mice, LDLR - / - Kif13b - / - represents Kif13b;Ldlr double knockout mouse;

[0019] Figure 4 This is an Oil Red O staining image of blood vessels in Kif13b; Ldlr double gene knockout mice. - / - Representative Ldlr knockout mice, Kif13b - / - ;Ldlr - / - represents Kif13b;Ldlr double knockout mouse;

[0020] Figure 5 HE, Oil Red O, Bodipy, and CD68 staining of the outflow tract of Kif13b; Ldlr double gene knockout mice. The scale bar is 100 μm. - / - Representative Ldlr knockout mice, Kif13b - / - ;LDLR - / - represents Kif13b;Ldlr double knockout mouse;

[0021] Figure 6 This is the Oil Red O staining of BMDM from Kif13b knockout mice. WT represents wild-type C57 mice. Kif13b - / - represents Kif13b knockout mice, Control represents the control group (unstimulated group), and oxLDL represents oxidized low-density lipoprotein;

[0022] Figure 7 Diagram of the bone marrow transplantation construction process and diet of Kif13b knockout mice, Ldlr - / - Representative Ldlr knockout mice, Kif13b - / - ;Ldlr - / - Kif13b;Ldlr double knockout mouse, Kif13b BM△WT ;Ldlr - / - Representative Ldlr - / - Bone marrow transplanted mice derived from Kif13b BM△KO ;Ldlr - / - Represents Kif13b - / - ;Ldlr - / - Source of bone marrow transplanted mice;

[0023] Figure 8 This is an Oil Red O staining image of blood vessels in mice with myeloid-specific Kif13b deficiency. BM△WT ;Ldlr - / - Representative Ldlr - / - Bone marrow transplanted mice derived from Kif13b BM△KO ;Ldlr - / - Represents Kif13b - / - ;Ldlr - / - Source of bone marrow transplanted mice;

[0024] Fig. 9 HE, Oil Red O, and CD68 staining of the outflow tract of Kif13b myeloid-specific deletion mice. The scale bar is 100 μm. BM△WT ;Ldlr - / - Representative Ldlr - / - Bone marrow transplanted mice derived from Kif13b BM△KO ;Ldlr - / - Represents Kif13b - / - ;Ldlr - / - Source of bone marrow transplanted mice;

[0025] Fig.10 The results of transcriptomic analysis of macrophages from Kif13b knockout and WT mice are shown in Figure 2.

[0026] Fig.11 The results show that Kif13b knockout affects the expression of macrophage phagocytic function-related receptors. Represents primary macrophages from wild-type mice. KIF13b - / - Mouse primary macrophages;

[0027] Fig.12Effect of Kif13b overexpression on the expression of macrophage phagocytic function-related receptors. Representative wild-type mouse primary macrophages overexpressing control lentiviral GFP, WT represents wild-type mouse primary macrophages overexpressing control lentivirus Kif13b;

[0028] Fig.13 The effect of Kif13b overexpression on macrophages, where A is the effect on macrophage lipid phagocytosis, WT Representative wild-type mouse primary macrophages overexpressing control lentiviral GFP, KO Represents Kif13b - / - Mouse primary macrophages overexpressing control lentiviral GFP, WT Representative wild-type mouse primary macrophages overexpressing control lentivirus Kif13b, KO Represents Kif13b - / - Mouse primary macrophages overexpressed control lentivirus Kif13b, scale bar is 50μm, B is the effect on foam cell formation, WT+GFP represents wild-type mouse primary macrophages overexpressing control lentivirus GFP, KO+GFP represents Kif13b - / - Mouse primary macrophages overexpressed control lentiviral GFP, WT+Kif13b represents wild-type mouse primary macrophages overexpressing control lentiviral Kif13b, KO+Kif13b represents Kif13b - / - Mouse primary macrophages overexpressed Kif13b with control lentivirus. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] Example 1

[0035] Kif13b gene synthesis sequence (CDS sequence: the abbreviation of coding sequence. DNA is transcribed into mRNA, and mRNA is translated into protein after splicing and other processing. The so-called CDS is a DNA sequence that corresponds to the protein sequence one by one, and the sequence does not contain other sequences that do not correspond to the protein. Sequence changes during mRNA processing are not considered. In short, it is completely corresponding to the protein codon. CDS is a sequence that encodes a protein product and is a term in structural genomics.)

[0036] Nucleotide sequence of Kif13b gene (SEQ ID NO.1): ATGGGGGACTCCAAAGTGAAAGTGGCGGTGCGGATACGACCCATGAACCGGCGAGAGACTGACTTGCATACCAAATGTGTGGTGGATGTGGATGCAAACAAGGTTATTCTTAATCCTGTAAATACGAATCTTTCCAAAGGAGATGCCCGGGGCCAGCCGAAGGTGTTTGCTTATGATCATTGTTTCTGGTCTATGGATGAATCTGTCAAAGAAAAGTATGCAGGTCAAGATATTGTTTTCAAGTGCCTTGGAGAGAATATCCTGCAGAATGCTTTTGATGGCTACAATGCATGTATCTTTGCCTATGGACAGACTGGCTCTGGAAAATCTTATACCATGATGGGCACAGCTGACCAACCTGGATTAATCCCAAGACTTTGCAGTGGACTCTTTGAACGAACTCAGAAAGAGGAAAATGAAGAACAGAGTTTTAAAGTAGAAGTGTCCTACATGGAAATTTATAATGAAAAAGTTCGAGACCTTCTTGATCCCAAAGGAAGCCGTCAGACGTTGAAAGTCAGAGAGCATAGTGTGTTGGGACCTTATGTCGACGGACTTTCTAAACTGGCTGTCACAAGCTACAAGGATATTGAGTCGTTGATGTCTGAGG GTAACAAATCTCGCACAGTTGCTGCAACCA ACATGAACGAGGAGAGTAGCCGATCCCATGCAGTTTTCAAAATCACCCTCACACATACTCTCTACGATGT

[0037]

[0038] 1. Experimental Animals and Their Husbandry

[0039] Experimental animal species, sex, age and source: Ldlr gene (gene number 16835, gene function: involved in lipid transport; regulation of inflammatory response; and regulation of lipid metabolism) knockout (Ldlr - / - ) and Kif13b / Ldlr double gene knockout (Kif13b - / - ;Ldlr - / - ) mice, male, 8 weeks old, weight 19-25 g. Ldlr knockout mice (Ldlr - / - ) was purchased from GemPharmatech (Nanjing, China). Kif13b gene knockout was generated using CRISPR / Cas9 at the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences and Peking Union Medical College (Beijing, China). Figure 1 Figure 2 shows the strategy for constructing Kif13b / Ldlr double knockout mice, which shows sgRNAs targeting exon 6 flanking sites. Specifically, two loxP sites were inserted on both sides of exon 6, and a donor template was constructed based on the mouse genome sequence (GRCm39). After knocking out exon 6, the mice were hybridized with Ldlr knockout mice to obtain the Kif13b / Ldlr double knockout mice (Kif13b - / - ;Ldlr - / - ) mice.

[0040] 2. Experimental Animal Feed Formula

[0041] Western Diet (WD) was purchased from Research Diet, catalog number: D12108C.

[0042] 3. Animal breeding and environmental conditions

[0043] All experiments were conducted in accordance with the principles of laboratory animal care (NIH publication No. 85Y23, revised in 1996) and approved by the Peking University Laboratory Animal Ethics Committee (LA2023460). All animals were bred and raised in the SPF animal room of Peking University Health Science Center (license number: SYXK (Beijing) 2022-0037), with a daily 12-h light cycle, 25±2℃ and 40±5 humidity. All mice were free to eat and drink unless otherwise specified. Figure 2 Shown is a schematic diagram of the diet of Ldlr knockout mice and Kif13b / Ldlr double knockout mice. Eight-week-old mice fed a normal diet (CD) were given the above-mentioned Western diet (WD) for 22 weeks.

[0044] 4. Determination of plasma total cholesterol and triglyceride levels

[0045] Eight-week-old mice fed a normal diet (CD) were given a Western diet (WD) for 22 weeks, and the mice were fasted for 4 h, and anticoagulant or non-anticoagulant blood samples were collected from the orbital vein. Plasma or serum was separated by centrifugation at 4 °C for 10 min. Plasma total cholesterol (TC) and triglyceride (TG) concentrations were measured using commercially available kits from Biopharm (Beijing, China).

[0046] The results are as follows Figure 3 Middle A and Figure 3 As shown in B, in comparison, the levels of total cholesterol and triglyceride in the plasma of Kif13b / Ldlr double-knockout mice were increased.

[0047] 5. Oil Red O Staining of Vascular Macrostructure

[0048] Eight-week-old mice fed a normal diet (CD) were given a Western diet (WD) for 22 weeks, and the whole length of the mouse aorta was obtained, fixed with paraformaldehyde, dehydrated with 20% sucrose, and stained with Oil Red O.

[0049] The results are as follows Figure 4 As shown, Kif13b - / - ;Ldlr - / - Double knockout mice compared to Ldlr - / - Single gene knockout mice have increased aortic plaques.

[0050] VI. HE, Oil Red O, Bodipy, and CD68 staining of aortic outflow tract

[0051] Eight-week-old mice fed a normal diet (CD) were given a Western diet (WD) for 22 weeks, and frozen samples of the aortic outflow tract (aortic root) were selected and sectioned at a thickness of 7 μm for HE and Oil Red O staining as well as Bodipy and CD68 immunofluorescence staining.

[0052] The results are as follows Figure 5 As shown, Kif13b - / - ;Ldlr - / - Double knockout mice compared to Ldlr - / - In single gene knockout mice, lipid accumulation in aortic outflow tract plaques was aggravated, the area of ​​necrotic core was enlarged, inflammatory infiltration increased, and macrophages changed significantly.

[0053] VII. Oil Red O staining of primary macrophages (BMDM)

[0054] WT and Kif13b - / - Primary macrophages were extracted from 8-week-old male mice and injected with 100 ng / mL oxidized low-density lipoprotein (oxLDL), followed by Oil Red O staining.

[0055] The results are as follows Figure 6 As shown, Kif13b - / - The lipophagy of primary BMDM of mice increased and the foamy formation of macrophages increased.

[0056] 8. Construction of bone marrow transplantation in Kif13b knockout mice

[0057] Ldlr knockout recipient mice were lethally irradiated (8.5 Gy of X-ray irradiation) and then injected intravenously (tail vein) with Ldlr from donor mice ( - / - Knockout and Kif13b;Ldlr - / - Double knockout mice) 1×10 7 Myeloid Kif13b-specific deletion mice were constructed and fed a Western diet (WD) for 16 weeks (eg Figure 7 shown).

[0058] IX. Oil Red O staining of blood vessels in mice with myeloid Kif13b-specific deficiency

[0059] Myeloid Kif13b-specific deletion mice were fed a Western diet (WD) for 16 weeks, and then the whole-length aorta of the mice was obtained, fixed with paraformaldehyde, dehydrated with 20% sucrose, and stained with Oil Red O.

[0060] The results are as follows Figure 8 As shown, mice with myeloid Kif13b-specific deletion (Kif13b BM△KO ;Ldlr - / - )'s aortic plaque accumulation worsens.

[0061] 10. HE, Oil Red O, and CD68 staining of aortic outflow tract in mice with myeloid Kif13b-specific deficiency

[0062] After myeloid Kif13b-specific null mice were fed a Western diet (WD) for 16 weeks, frozen samples of the aortic outflow tract (aortic root) were selected and sectioned at a thickness of 7 μm for HE, Oil Red O staining, and Bodipy and CD68 immunofluorescence staining.

[0063] The results are as follows Fig. 9 As shown, mice with myeloid Kif13b deficiency (Kif13b BM△KO ;Ldlr - / - ) showed that lipid accumulation in the aortic outflow tract plaque was aggravated, the area of ​​necrotic core was enlarged, inflammatory infiltration increased, and macrophages changed significantly.

[0064] 11. WT and Kif13b - / - Mouse primary BMDM transcriptome sequencing

[0065] Method for primary BMDM transcriptome sequencing: Primary BMDM of mice were extracted and sent for transcriptome sequencing (BGI) analysis.

[0066] The results are as follows Fig.10 As shown, WT and Kif13b - / - Transcriptome sequencing results of mouse primary BMDM showed that Kif13b - / - The pathways related to the phagocytic function of mouse macrophages changed significantly, and the pathways related to the efferocytic function of macrophages were significantly inhibited.

[0067] 12. WT and Kif13b - / - Detection of phagocytosis and efferocytosis-related protein expression in primary mouse BMDM macrophages

[0068] Detection method: Primary BMDM of mice were extracted, cell proteins were extracted, and the expression of phagocytosis and efferocytosis related proteins was detected by Western Blot.

[0069] The results are as follows Fig.11 As shown, Kif13b - / - The expression of MerTK, a receptor related to the phagocytic function of mouse BMDM, was significantly reduced, and Kif13b knockout mainly affected the expression of MerTK, a receptor related to the phagocytic function of macrophages.

[0070] 13. Detection of phagocytic and efferocytic related protein expression after overexpression of Kif13b in primary BMDM of WT mice

[0071] The detection method is the same as that of "Twelve, WT and Kif13b - / - "Detection of phagocytosis and efferocytosis-related protein expression in primary mouse BMDM macrophages" is the same.

[0072] The results are as follows Fig.12 As shown in the figure, the expression of MerTK, a receptor related to the phagocytic function of BMDM overexpressing Kif13b, was significantly increased, and Kif13b overexpression caused the expression of MerTK, a receptor related to the phagocytic function of macrophages, to increase.

[0073] XIV. Oil Red O staining after overexpression of Kif13b in primary BMDMs from WT and Kif13b- / - mice

[0074] Specific method: BMDM of mice were extracted, infected with lentivirus to overexpress Kif13b or control GFP, stained with Oil Red O (sigmaO0625), and photographed under a microscope.

[0075] The results are as follows Fig.13 Middle A and Fig.13 As shown in B, overexpression of the Kif13b gene can reduce lipid accumulation in macrophages of WT mice and restore lipid accumulation in macrophages of KO mice to WT levels.

[0076] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of Kif13b gene as a drug target in screening drugs for preventing, alleviating and / or treating atherosclerosis.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the Kif13b gene is shown as SEQ ID NO.

1.

3. The application according to claim 1, characterized in that: The drug for preventing, alleviating and / or treating atherosclerosis is a drug that promotes overexpression of the Kif13b gene.

4. The use according to claim 1, characterized in that: The drug for preventing, alleviating and / or treating atherosclerosis promotes overexpression of the Kif13b gene, enhances macrophage efferocytosis, reduces the formation of arterial necrosis core, and treats atherosclerosis.

5. Use of the drug for promoting overexpression of the Kif13b gene according to claim 1 in the preparation of a drug for preventing, alleviating and / or treating atherosclerosis.

6. A drug for preventing, alleviating and / or treating atherosclerosis, characterized in that: The invention comprises a drug for promoting overexpression of the Kif13b gene as claimed in claim 1.

Images