A molecular marker related to the seed vigor of diploid and tetraploid Chinese cabbages and its application

Abstract

The present invention discloses a molecular marker related to the seed vigor of diploid and tetraploid Chinese cabbages and its application, belonging to the field of seed vigor detection of cruciferae. The present invention analyzes through three aspects: transcriptome, untargeted metabolome and whole-genome methylation sequencing, and finally obtains the molecular marker BraPYL for quickly distinguishing the seed vigor of diploid and tetraploid Chinese cabbages. Through experimental verification, by designing specific primer pairs for PCR amplification of the molecular marker, it can be judged whether the Chinese cabbage seed vigor is strong or weak according to whether the electrophoresis band appears only at 323bp. The molecular marker disclosed by the present invention can quickly, accurately and low-cost detect Chinese cabbage seeds with high vigor, providing a new method for assisting Chinese cabbage breeding.

Description

Technical Field

[0001] The present invention relates to the field of detecting the seed vigor of cruciferous plants, and particularly relates to a molecular marker related to the seed vigor of diploid and tetraploid Chinese cabbage seeds and its application. Background Art

[0002] Chinese cabbage (Brassica rapa ssp. pekinensis, AA, 2n = 2x = 20) is an important vegetable crop in the genus Brassica of the cruciferous family and is the most commonly consumed vegetable in northern China. Seed vigor is an important indicator for measuring seed quality. Seed vigor is the sum of germination rate, seedling growth potential, plant resistance, and production potential. Seeds are the most basic agricultural production materials, and improving seed quality is an important measure to ensure high-efficiency and high-yield agricultural production, which is of great significance to the development of agriculture and other related industries. High-vigor seeds are characterized by full maturity, plump grains, and good storage stability. After sowing, they have strong stress resistance, fast and uniform germination, and grow neatly and rapidly, and can cultivate high-quality seedlings and plants. Therefore, high-vigor seeds have significant advantages in terms of growth and high-yield potential and are the primary prerequisite for modern agriculture to achieve high efficiency and high yield. At present, seed vigor has become a comprehensive indicator for testing seed quality.

[0003] Seed germination tests and comprehensive analysis methods can accurately determine seed vigor, but they have a large workload and a long cycle; conductivity measurement methods and TTC quantitative methods can quickly determine seed vigor, but the results are greatly affected by the environment and can cause seed damage. The application of near-infrared spectroscopy technology for detecting seed vigor is still in the initial stage of experimentation, and the main database of seed morphological characteristics has not been established, making it impossible to quickly measure the characteristic information of seeds; laser scattering technology has low stability and shallow penetration depth, but has limitations in terms of physical properties, chemical composition, and internal sample quality, and its scope of application and effect are subject to certain limitations. Due to the wide variety of seed types, with different structures and shapes, it is difficult to evaluate all seeds based on specific seed parameters obtained in the experiment using infrared thermal imaging technology. Most traditional seed vigor determination methods rely on manual operation, with complex and time-consuming processes, which can cause damage to seeds and render the analyzed seeds unusable for production. The PCR detection technology is a method for detecting seed vigor with high sensitivity and specificity. Compared with traditional methods, it has the characteristics of fast speed, high accuracy, short detection cycle, and low cost. There is currently no reported method or molecular marker for detecting the seed vigor of Chinese cabbage seeds using PCR technology. Summary of the Invention

[0004] The object of the present invention is to provide a molecular marker related to the seed vigor of diploid and tetraploid Chinese cabbage seeds and its application to solve the problems existing in the above-mentioned prior art. This molecular marker can simply, quickly, and accurately distinguish the strength of Chinese cabbage seed vigor.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides an application of a molecular marker related to the seed vigor of diploid and tetraploid Chinese cabbages in any one of the following:

[0007] (1) Application in rapidly identifying the seed vigor of diploid and tetraploid Chinese cabbages;

[0008] (2) Application in preparing a kit for rapidly identifying the seed vigor of diploid and tetraploid Chinese cabbages;

[0009] (3) Application in assisting Chinese cabbage breeding;

[0010] Wherein the nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 1.

[0011] The present invention also provides a primer pair for rapidly identifying the seed vigor of diploid and tetraploid Chinese cabbages, and the nucleotide sequence of the primer pair is as shown in SEQ ID NOs: 2-3, and the primer pair shown in SEQ ID NOs: 2-3 is used for amplifying the molecular marker.

[0012] The present invention also provides a kit for rapidly identifying the seed vigor of diploid and tetraploid Chinese cabbages, which contains the primer pair.

[0013] The present invention also provides an application of the primer pair or the kit in any one of the following:

[0014] (1) Application in rapidly identifying the seed vigor of diploid and tetraploid Chinese cabbages;

[0015] (2) Application in preparing a kit for rapidly identifying the seed vigor of diploid and tetraploid Chinese cabbages;

[0016] (3) Application in assisting Chinese cabbage breeding.

[0017] The present invention also provides a method for rapidly identifying the seed vigor of diploid and tetraploid Chinese cabbages, including the following steps:

[0018] Obtain the genomic DNA of the Chinese cabbage seeds to be detected, perform PCR amplification using the primer pair, perform electrophoresis on the obtained amplification product, and judge the strength of the seed vigor of diploid and tetraploid Chinese cabbages according to the electrophoresis result; the nucleotide sequence of the primer pair is as shown in SEQ ID NOs: 2-3.

[0019] Preferably, the reaction system for the PCR amplification is: 5 μL of 2×Taq Master Mix, 1 μL of the primer pair, 1 μL of the genomic template DNA, and 3 μL of sterile ultrapure water.

[0020] Preferably, the reaction procedure for the PCR amplification is as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 40 cycles; 72°C for 5 min; preservation at 4°C.

[0021] Preferably, the method for judgment is as follows: when there is exactly one band at 323 bp in the electrophoresis result, the seed vigor of the Chinese cabbage to be tested is strong; when there is no band at 323 bp in the electrophoresis result, the seed vigor of the Chinese cabbage to be tested is weak.

[0022] The present invention also provides a method for detecting highly viable seeds of diploid and tetraploid Chinese cabbage seeds, including the step of amplifying the genomic DNA of the Chinese cabbage seeds to be tested using a primer pair and retaining the Chinese cabbage seeds with only one band at 323 bp when the amplification product is electrophoresed; the nucleotide sequences of the primer pair are as shown in SEQ ID NO: 2-3.

[0023] The present invention discloses the following technical effects:

[0024] The molecular marker BraPYL for identifying the seed vigor of Chinese cabbage provided by the present invention can judge the strength of the seed vigor of Chinese cabbage by observing the presence or absence of a band at 323 bp through PCR amplification. The molecular marker provided by the present invention can be applied to molecular marker-assisted breeding of Chinese cabbage seed vigor, can conveniently and efficiently screen out Chinese cabbage varieties with strong seed vigor, save costs and increase efficiency, promote the Chinese cabbage breeding process, and has important theoretical and practical significance for cultivating new Chinese cabbage varieties with strong seed vigor. Description of the Drawings

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the following-described drawings are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0026] Figure 1 It is the gel electrophoresis result of the BraPYL molecular marker for the seed vigor of diploid and tetraploid Chinese cabbage seeds; 1: Marker500, 2: Duowei 462 in 2019, 3: Duowei 462 in 2023, 4: Jibai 6 in 2019, 5: Jibai 6 in 2023, 6: Jibai 55 in 2015, 7: Jibai 55 in 2023;

[0027] Figure 2Results of fluorescence quantitative analysis of BraPYL for the seed vigor of diploid and tetraploid Chinese cabbages; JB4F in 22: Germinated seeds of Jibai 4 in 2022, JB4F in 14: Germinated seeds of Jibai 4 in 2014, JB4W in 14: Non-germinated seeds of Jibai 4 in 2014, 462F in 19: Germinated seeds of Duowei 462 in 2019, 462W in 19: Non-germinated seeds of Duowei 462 in 2019, 462F in 23: Germinated seeds of Duowei 462 in 2023, 462W in 23: Non-germinated seeds of Duowei 462 in 2023. Detailed implementation manners

[0028] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0029] It should be understood that the terms described in the present invention are only for describing particular implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0030] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0031] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the specification of the present invention, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0032] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0033] The samples used in the experiments of this invention are Duowei 462 in 2019, Duowei 462 in 2023, Jibai 6 in 2019, Jibai 6 in 2023, Jibai 55 in 2015, Jibai 55 in 2023, Jibai 4 in 2014, and Jibai 4 in 2022, which are provided by the Leafy Vegetable Research Office of the Institute of Industrial Crops, Hebei Academy of Agriculture and Forestry Sciences. The above varieties are used to determine seed vigor.

[0034] Example 1

[0035] 1. Test materials

[0036] The test materials are Duowei 462 in 2019, Duowei 462 in 2023, Jibai 6 in 2019, Jibai 6 in 2023, Jibai 55 in 2015, and Jibai 55 in 2023.

[0037] 2. Identification of seed vigor

[0038] Randomly select 200 seeds of the above Chinese cabbage seeds and place them in a petri dish with filter paper. Moisten the filter paper with water and put it in an incubator at 25°C. After 48 hours, count the germination rate. Keep the filter paper moist during this period to avoid affecting the test results.

[0039] Table 1 Statistical results of germination rates of diploid and tetraploid Chinese cabbages

[0040]

[0041] 3. Extraction of plant DNA

[0042] DNA of Chinese cabbage seedling samples of Duowei 462 in 2019, Duowei 462 in 2023, Jibai 6 in 2019, Jibai 6 in 2023, Jibai 55 in 2015, and Jibai 55 in 2023 is extracted by the CTAB method.

[0043] 4. Molecular markers for identifying seed vigor of diploid and tetraploid Chinese cabbages

[0044] Randomly select 200 seeds of the above varieties and place them in a petri dish with filter paper. Moisten the filter paper with water and put it in an incubator at 25°C. After 48 hours, count the germination rate, and classify the germinated and non-germinated seeds for second-generation sequencing. Analyze from three aspects: transcriptome, non-targeted metabolome, and whole-genome bisulfite sequencing (WGBS). In particular, in-depth research is carried out on genes related to ABA, including 7 ABF genes, 18 PYR / PYL genes, 6 SRK genes, and 2 PP2C genes. For these 33 genes, primer pairs are designed with primer 5, 6 pairs of related primers are designed for each gene, a total of 198 pairs, and finally the differential gene BraPYL (accession number: XM009103240) that can identify the seed vigor of diploid and tetraploid Chinese cabbages is screened out.

[0045] Amplified 323bp sequence (SEQ ID NO: 1):

[0046] TCGCCCAACGCATCCAGTCCCCTCCGGAGACCGTCTGGTCCGTCGTGAGACGCTTCGAC

[0047] CGTCCCCAGATTTACAAACACTTCATCAAAAGATGCTCCGTCGAAGAAGGCTTCGAGAT

[0048] GCGAGCAGGGTGCACGCGCTACGTGGACGTGATCAGCGGCCTTCCGGCGAACACGTCG

[0049] AGGGAGAGGCTCGATCTCCTCGACGACGAGCGGAGAGTGACGGGGTTTAGCATCACCG

[0050] GAGGCGAGCACAGGCTGAGGAATTACAAGTCGGTGACGACGGTTCATGGGTTCGAGAGAGATGGACGGATCTGGACCGTTGTTCTTGAA。

[0051] Then, using BraPYL as a molecular marker, the seed vigor of diploids and Chinese cabbage seeds was detected by PCR amplification as follows:

[0052] Using the DNA of Chinese cabbage seedling samples as a template, a PCR amplification reaction was carried out using the indicated specific primer pair to obtain a PCR amplification product; the sequences of the specific primer pairs are as follows:

[0053] BraPYL-1-F: 5'-TCGCCCAACGCATCCAGT-3' (SEQ ID NO: 2);

[0054] BraPYL-1-R: 5'-TTCAAGAACAACGGTCCAG-3' (SEQ ID NO: 3).

[0055] The reaction system for PCR amplification (10 μL): 5 μL of 2× Taq Master Mix, 0.5 μL of each specific primer pair, and 1 μL of Chinese cabbage genomic template DNA at 300 - 500 ng / μL, and 3 μL of sterilized ultrapure water was added;

[0056] The reaction procedure for PCR amplification was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for 40 cycles; 72°C for 5 min; store at 4°C for later use.

[0057] The specific method for determining viability was as follows: when there was only one band at 323 bp in the electrophoresis result and the band was clear, bright, and free of miscellaneous bands, the seed viability of the Chinese cabbage material was strong; when no band was shown at 323 bp in the electrophoresis result, the seed viability of the Chinese cabbage material was weak (see Figure 1 ).

[0058] The above results were consistent with the results of directly measuring the seed germination rate in Table 1, indicating that BraPYL could be used as a molecular marker for identifying the seed viability of diploid and tetraploid Chinese cabbages.

[0059] By selecting Chinese cabbage seeds that showed only one band at 323 bp during electrophoresis based on the electrophoresis results, Chinese cabbage seeds with high viability could be obtained, which was of great significance for assisting in the breeding of new varieties of Chinese cabbage.

[0060] Example 2

[0061] 1. Test materials

[0062] Duowei 462 in 2019, Duowei 462 in 2023, Jibai 4 in 2014, Jibai 4 in 2022.

[0063] 2. Seed viability identification

[0064] Randomly select 200 seeds of the above Chinese cabbages and place them in a petri dish with filter paper. Moisten the filter paper with water and count the germination rate after 48 hours. Keep the filter paper moist during this period to avoid affecting the test results.

[0065] Table 2 Statistical results of the germination rate of Duowei 462 and Jibai 4 in different years

[0066]

[0067]

[0068] 3. Plant RNA extraction

[0069] Sampling was carried out according to the Chinese cabbage sample names in Table 2 above, with 3 replicates for each sample and 3 for each replicate. RNA of Chinese cabbage seedling samples was extracted using Omega E.Z.N.A. plant RNAKit.

[0070] 4. Fluorescent quantitative PCR for identifying the seed viability of diploid and tetraploid Chinese cabbages

[0071] Fluorescent quantitative PCR specific primers of molecular marker BraPYL2 for identifying the seed vigor of diploid and tetraploid Chinese cabbage seeds. The upstream primer sequence of the specific primer pair is shown as follows:

[0072] BraPYL-2-F: 5’-GCACAGGCTGAGGAATTACAAGTC-3’ (SEQ ID NO: 4);

[0073] BraPYL-2-R: 5’-CGATTCAAGAACAACGGTCCAGATC-3’ (SEQ ID NO: 5).

[0074] RNA of diploid and tetraploid Chinese cabbage seedling samples was extracted using Omega E.Z.N.A. plant RNAKit; Using the RNA of Chinese cabbage seedling samples as a template and one-Step gDNA Removal and CDNA Synthesis Super Mix kit to reverse transcribe to obtain cDNA.

[0075] Using the cDNA of Chinese cabbage seedling samples as a template, perform fluorescent quantitative PCR amplification reaction with the shown specific primer pair to obtain PCR amplification products;

[0076] Reaction system for PCR amplification (20 μL): 2×SYBR Green qPCR Master Mix 10 μL, 1×ROX 1 μL, each specific primer pair 0.5 μL, and <100 ng / μL Chinese cabbage genomic template cDNA 1 μL, add 7 μL of sterilized ultrapure water.

[0077] The reaction program for the PCR amplification is: pre-denaturation at 95°C for 10 mim; denaturation at 95°C for 10 s, annealing at 60°C for 30 s, 40 cycles; store at 4°C for standby. Using the Chinese cabbage ACT gene as an internal reference gene, set 3 biological replicates for each sample, and use the 2 -ΔΔCt method to calculate the relative expression level of the target gene. The internal reference gene for Chinese cabbage is:

[0078] BrActin-F: 5’-CATGGAGATAGACGAGTG-3’ (SEQ ID NO: 6);

[0079] Actin-R: 5’-CCTTCTTCATCATCATCATC-3’ (SEQ ID NO: 7);

[0080] Analyze the results using Excel and Origin.

[0081] In this example, the relative expression levels of the BraPYL gene in plant lines of materials from different years were measured, including Jibai 4 (wild type) in 2022, Jibai 4 in 2014, Duowei 462 in 2019, and Duowei 462 in 2023. According to the Ct results detected by the real-time fluorescence quantitative PCR instrument, 2 -ΔΔCt values were calculated, as Figure 2 shown.

[0082] The results showed that the significance of the expression level of the BraPYL gene in JB4F in 2022, JB4F in 2014, and 462F in 2023 was a, and the significance of the expression levels of the remaining genes was b. Among Chinese cabbages from different years, the expression level of the target gene in germinated seed types was significantly higher than that in non-germinated seed types.

[0083] The embodiments described above are only descriptions of the preferred modes of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a reagent for a molecular marker related to the germination rate of diploid and tetraploid Chinese cabbage seeds in any of the following: (1) Use in the rapid identification of the germination rate of diploid and tetraploid Chinese cabbage seeds; (2) Use in the preparation of a kit for the rapid identification of the germination rate of diploid and tetraploid Chinese cabbage seeds; (3) Use in assisting the breeding of Chinese cabbage with high seed germination rate; wherein the nucleotide sequence of the molecular marker is as shown in SEQ ID NO:

1.

2. A primer pair for rapidly identifying the germination rate of diploid and tetraploid Chinese cabbage seeds, characterized in that, The nucleotide sequence of the primer pair is as shown in SEQ ID NO: 2-3, and the primer pair shown in SEQ ID NO: 2-3 is used to amplify the molecular marker described in claim 1.

3. A kit for quickly identifying the germination rate of diploid and tetraploid Chinese cabbage seeds, characterized in that, Containing the primer pair described in claim 2.

4. Use of the primer pair described in claim 2 or the kit described in claim 3 in any of the following: (1) Use in the rapid identification of the germination rate of diploid and tetraploid Chinese cabbage seeds; (2) Use in the preparation of a kit for the rapid identification of the germination rate of diploid and tetraploid Chinese cabbage seeds; (3) Use in assisting the breeding of Chinese cabbage with high seed germination rate.

5. A method for quickly identifying the germination rate of diploid and tetraploid Chinese cabbage seeds, characterized in that, Comprising the following steps: Obtain the genomic DNA of the Chinese cabbage seeds to be detected, perform PCR amplification using the primer pair, subject the obtained amplification product to electrophoresis, and judge the strength of the germination rate of diploid and tetraploid Chinese cabbage seeds according to the electrophoresis result; the nucleotide sequence of the primer pair is as shown in SEQ ID NO: 2-3.

6. The method according to claim 5, characterized in that, The reaction system for the PCR amplification is: 5 μL of 2×Taq MasterMix, 1 μL of the primer pair, 1 μL of genomic template DNA, and 3 μL of sterile ultrapure water.

7. The method according to claim 5, wherein The reaction program for the PCR amplification is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 40 cycles; 72°C for 5 min; preservation at 4°C.

8. The method according to claim 5, wherein The method for judgment is: when there is and only one band appears at 323 bp in the electrophoresis result, the germination rate of the Chinese cabbage seeds to be detected is strong; when no band appears at 323 bp in the electrophoresis result, the germination rate of the Chinese cabbage seeds to be detected is weak.

9. A method for detecting high germination rate seeds of diploid and tetraploid Chinese cabbages, characterized in that, Comprising the step of amplifying the genomic DNA of the Chinese cabbage seeds to be detected using the primer pair and retaining the Chinese cabbage seeds with only one band appearing at 323 bp during the electrophoresis of the amplification product; the nucleotide sequence of the primer pair is as shown in SEQ ID NO: 2-3.

Images