Plasmodiophora brassicae Pb034 gene and application thereof in prevention and control of clubroot disease of cruciferous crops

By using RNA interference technology targeting the Pb034 gene of clubroot bacteria, and employing recombinant vectors and transgenic methods to silence the Pb034 gene in cruciferous crops, the limitations of existing control methods are overcome, achieving efficient and environmentally friendly control of clubroot disease and enhancing crop resistance.

CN120608074BActive Publication Date: 2025-11-11OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511121513.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-12
Publication Date
2025-11-11
Estimated Expiration
2045-08-12

AI Technical Summary

Technical Problem

Existing methods of chemical control, biological control, and breeding of disease-resistant varieties have limitations in controlling clubroot disease in cruciferous crops. Chemical pesticides pollute the environment, biological control is limited by environmental conditions, and the effectiveness of disease-resistant varieties is limited.

Method used

RNA interference technology is used to silence the expression of the Pb034 gene in plants by targeting RNA interference fragments or double-stranded RNA of the clubroot Pb034 gene, using recombinant expression vectors and transgenic technology. This achieves host-induced gene silencing or spraying of interfering RNA, thereby blocking the infection process of clubroot.

Benefits of technology

It significantly enhances the resistance of cruciferous crops to clubroot, reduces the expression level of the Pb034 gene, reduces the use of chemical pesticides, avoids environmental pollution, and provides a long-lasting and efficient control measure.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120608074B_ABST
    Figure CN120608074B_ABST
Patent Text Reader

Abstract

This invention belongs to the fields of agricultural plant pathology and plant protection technology, and relates to a clubroot bacterium Pb034 gene and its application in the control of clubroot disease in cruciferous crops. This invention found that reducing the expression of the clubroot bacterium Pb034 gene using host-induced gene silencing (HIGS) technology or exogenous double-stranded RNA delivery technology is beneficial for enhancing the resistance of cruciferous plants to clubroot disease. This invention provides a new approach and method for the control of clubroot disease in cruciferous crops, and has broad agricultural application prospects and market value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] In the fields of agricultural plant pathology and plant protection, this research specifically relates to a clubroot gene. Pb034 Application in the control of clubroot disease in cruciferous crops. Background Technology

[0002] Cruciferous crops play a vital role in global agriculture, including rapeseed, cabbage, kale, radish, and mustard greens, and are an important component of the human food supply chain and agricultural economy. However, these crops are often borne by obligate, live parasitic protozoa such as *Plasmodiophora* (…). Plasmodiophora brassicae Woronin Clubroot, caused by septicemia, can harm almost all cruciferous crops. Clubroot causes the plant roots to swell, become deformed, and rot, severely weakening the crop's ability to absorb water and nutrients, ultimately leading to premature aging, reduced yield, or even crop failure.

[0003] Existing control methods, such as chemical control, biological control, and the breeding of disease-resistant varieties, all have significant limitations: long-term use of chemical pesticides leads to pesticide resistance and pollutes the environment; biological control methods are limited by environmental conditions; and the effectiveness of disease-resistant varieties is limited due to the rapid evolution of pathogens. Therefore, the development of new clubroot disease control technologies is imperative.

[0004] RNA interference (RNAi) is an evolutionarily conserved gene silencing mechanism mediated by double-stranded RNA (dsRNA). It specifically degrades mRNA complementary to its sequence, thereby inhibiting target gene expression. In recent years, the application of RNAi technology in plant disease control has rapidly developed, particularly strategies such as host-induced gene silencing (HIGS) and spray-induced gene silencing (SIGS). Because this method can specifically silence pathogen genes, avoiding the harm of broad-spectrum pesticides to beneficial insects or soil microorganisms; HIGS is an endogenous expression, allowing plants to continuously produce dsRNA, unaffected by ultraviolet radiation or rainfall; it eliminates the need for frequent external pesticide application, delaying the development of resistance; and RNA molecules are easily degraded by the natural environment, posing no risk of chemical residues. Due to these advantages, RNA interference has become an important direction for green pesticides and precision breeding. Summary of the Invention

[0005] In view of this, the present invention provides a key target for the control of clubroot disease in cruciferous crops, by inhibiting clubroot bacteria. Pb034 Gene expression can enhance the resistance of cruciferous crops to clubroot, providing a new technical means for improving clubroot resistance and achieving long-term and efficient control in cruciferous crops.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides, on the one hand, Pb034 Gene sequence, the gene Pb034 The nucleotide sequence is shown in SEQ ID NO.1.

[0008]

[0009] Another aspect of the present invention provides a method for silencing Pb034 Gene expression biomaterials, wherein the biomaterials contain a target including a target Pb034 The RNA interference fragment or double-stranded RNA of the gene, wherein the RNA interference fragment includes a target gene fragment and an inverse complementary fragment of the target gene fragment, the nucleotide sequences of the target gene fragment and its inverse complementary fragment are shown in SEQ ID NO. 6-7, respectively, and the nucleotide sequences of the sense strand and the antisense strand of the double-stranded RNA are shown in SEQ ID NO. 6-7, respectively.

[0010] Furthermore, the biological material includes at least one of recombinant expression vectors, transgenic cell lines, or recombinant bacteria.

[0011] The third aspect of the present invention provides the root-emergent fungus as described above. Pb034 Genes or, as described above, used for silencing Pb034 Application of gene-expressing biomaterials in the control of clubroot disease in cruciferous crops.

[0012] It should be noted that the control process of this invention includes both prevention and treatment; that is, it can be administered before clubroot infection by introducing a silencing agent. Pb034 Gene-expressing biological materials that stably express targeted clubroot bacteria within plant cells. Pb034 RNA interference fragments in genes can prevent clubroot infection; they can also be used to silence bacteria after clubroot infection. Pb034 Biological materials that express genes can promptly interfere with gene expression and block the infection process of *Plasmodiophora stylosa*.

[0013] Furthermore, the application method includes: using a device for silencing Pb034 Transforming cruciferous crops with gene-expressing biomaterials to reduce... Pb034 Gene expression levels.

[0014] Furthermore, reduce Pb034 The gene expression level includes the following steps: targeting the gene... Pb034 The RNA interference fragment of the gene is ligated into a silencing expression vector to obtain... Pb034 A gene silencing vector is used to transform cruciferous crops using Agrobacterium-mediated transformation; wherein the RNA interference fragment includes a target gene fragment and an inverse complementary fragment of the target gene fragment, and the nucleotide sequences of the target gene fragment and its inverse complementary fragment are shown in SEQ ID NO.6-7, respectively.

[0015] Furthermore, the aforementioned Pb034 Methods for constructing gene silencing vectors include: using Pb034Using the gene nucleotide sequence (as shown in SEQ ID NO.1) as a template, the target fragment S1 was amplified using primers shown in SEQ ID NO.2-3. The PBI121Bar-RNAi vector was linearized by digestion with BamHI. Homologous recombination of the target fragment S1 with the linearized vector yielded the recombinant vector PBI121Bar-RNAi-S1. Using the sequence shown in SEQ ID NO.1 as a template, the target fragment S2 was amplified using primers shown in SEQ ID NO.4-5. The recombinant vector PBI121Bar-RNAi-S1 was linearized by digestion with Sac I. Homologous recombination of the target fragment S2 with the linearized vector PBI121Bar-RNAi-S1 yielded... Pb034 Gene silencing vector.

[0016] Furthermore, reduce Pb034 Gene expression levels include the following steps:

[0017] Targeting the Pb034 The double-stranded RNA of the gene, the delivery vector, and the RNase inhibitor were mixed and prepared into a solution with RNase-free water, and the solution was used for root irrigation treatment of plants. The nucleotide sequences of the sense and antisense strands of the double-stranded RNA are shown in SEQ ID NO.6-7, respectively.

[0018] Commonly used RNA delivery vectors are all applicable to this invention, and there are no particular limitations on them. In specific embodiments, the delivery vector is, for example, amino-modified dendritic macroporous silica nanomaterials or Lipofectin. RNase inhibitors are used to inhibit the natural degradation of RNA in the environment; conventional RNase inhibitors are sufficient, such as RNaseOUT or DEPC.

[0019] Furthermore, the root-bearing bacteria Pb034 Genes or used for silencing Pb034 The application of gene-expressing biomaterials in the control of clubroot disease in cruciferous crops is characterized by the method of synthesizing the double-stranded RNA, which includes: using primer pairs as shown in SEQ ID NO. 8-9, and employing T7 RNA in vitro transcription technology to synthesize the double-stranded RNA.

[0020] Furthermore, this invention provides a method for controlling clubroot disease in cruciferous crops, used to silence... Pb034 Transformation of cruciferous crops using gene-expressing biomaterials.

[0021] The present invention has the following advantages over the prior art:

[0022] This invention provides a method for enhancing the resistance of cruciferous crops to clubroot disease by using host-induced gene silencing technology or exogenous dsRNA delivery technology to silence key target genes of clubroot bacteria. Pb034 This expression can enhance the resistance of cruciferous plants to clubroot disease; it provides a key technology for the prevention and control of clubroot disease in cruciferous crops, and has broad agricultural application prospects and market value. Attached Figure Description

[0023] Figure 1 This diagram illustrates the expression level of the Pb034 gene in root cells of Arabidopsis thaliana at different growth stages when infected with Plasmodium falciparum. RS represents dormant spores, MP represents mid-primary infection, IS represents early secondary infection, MS represents mid-secondary infection, and LS represents late secondary infection. FPKM represents the fragment read per million bases of transcription per thousand bases.

[0024] Figure 2 Here is the structure diagram of the Pb034 protein;

[0025] Figure 3 Map of the pBI121Bar-RNAi vector;

[0026] Figure 4 for Pb034 A schematic diagram illustrating the construction of a gene silencing vector;

[0027] Figure 5 To target and silence *Plasmodiophora* bacteria using host-induced gene silencing technology Pb034 Disease survey of transgenic Arabidopsis thaliana after inoculation with different physiological races of Plasmodium falciparum; Figure A shows... Pb034 Figure B shows a graph of gene expression level analysis; Figure C shows a graph of swollen roots of Arabidopsis thaliana; Figure D shows a graph of disease index.

[0028] Figure 6 To target clubroot bacteria through root irrigation Pb034 silencing genes using dsRNA technology Pb034 A survey of diseases in transgenic Arabidopsis thaliana plants; Figure A shows... Pb034 Figure B shows the gene expression level analysis; Figure C shows the disease index survey; Figure D shows the root rot bacteria biomass survey. Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0030] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0031] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used herein to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "about." The term "about" has its usual meaning as indicating that a value includes the inherent variation in error of the equipment or method used to determine that value, or contains a value close to said value, for example, within 10% of said value (or a range of values). Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought.

[0032] Furthermore, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of this invention should have the meanings commonly understood by those skilled in the art. To make the above-mentioned objects, features, and advantages of this invention more apparent and understandable, specific embodiments of the invention will be described in detail below with reference to the accompanying drawings.

[0033] Example 1: Plasmodium gene Pb034 High expression at all stages of infection

[0034] To investigate the genes of *Plasmodiophora* Pb034 This study, based on transcriptome data, systematically analyzed the expression pattern of the *Plasmodiophora* gene at different infection stages and its potential application value in disease control. The *Plasmodiophora* strain used was race 4, collected from Jishou City, Hunan Province. Two-week-old *Arabidopsis thaliana* seedlings were used as experimental material, and a concentration of 10... 6 Root inoculation was performed using a suspension of resting spores / strain of *Plasmodiophora* to ensure the uniformity and reproducibility of infection. Sample collection covered all key stages of *Plasmodiophora* infection, including resting spores (RS), mid-primary infection (MP), early-secondary infection (IS), mid-secondary infection (MS), and late-secondary infection (LS). Results showed that *Arabidopsis thaliana* root cells... Pb034 The gene expression was continuously upregulated throughout the infection process of *Plasmodiophora stylosa*, especially significantly enhanced at the end of the secondary infection stage. Figure 1 This suggests that the gene may play a crucial role in the establishment of plasmodium infection and disease progression. This finding provides a basis for further analysis. Pb034 This laid the foundation for its functional mechanism and its potential use as a target for disease control.

[0035] Further analysis based on protein sequence and structural annotation revealed that the protein is an α-1,2-mannosyltransferase with a typical Glyco_transf_15 domain, suggesting that it may participate in the pathogenic process by modifying cell wall components. Figure 2 As shown, the pLDDT (predicted Local Distance Difference Test) score represents the confidence level of each amino acid residue in the predicted protein structure, ranging from 0 to 100. A higher score indicates a more reliable structure. The score of 88.46 shown in the figure is the average confidence score for all residues.

[0036] Example 2: Targeted silencing based on host-induced gene silencing (HIGS) technology Pb034 The genetically modified plants showed significantly enhanced resistance to clubroot disease.

[0037] To verify Pb034 This embodiment constructs a targeted silencing mechanism to enhance the disease control potential. Pb034 The host-induced gene silencing vector. The original vector for the silencing expression vector was the pBI121Bar-RNAi vector preserved in our laboratory, with *E. coli* as the host bacterium. The vector map is shown below. Figure 3 As shown. See also Figure 4 , Pb034 The gene silencing vector construction process specifically includes: using the sequence shown in SEQ ID NO.1 as a template, amplifying the target fragment S1 using the primer pairs shown in SEQ ID NO.2-3; digesting the PBI121Bar-RNAi vector with BamHI to obtain a linearized vector; performing homologous recombination between the target fragment S1 and the linearized vector PBI121Bar-RNAi to obtain the recombinant vector PBI121Bar-RNAi-S1; using the sequence shown in SEQ ID NO.1 as a template, amplifying the target fragment S2 using the primer pairs shown in SEQ ID NO.4-5; digesting the recombinant vector PBI121Bar-RNAi-S1 with Sac I to obtain a linearized vector; and performing homologous recombination between the target fragment S2 and the linearized vector PBI121Bar-RNAi-S1 to obtain... Pb034 Gene silencing vector. Restriction endonuclease digestion confirmed correct vector construction. The expression of the RNA interference fragment was driven using the 35S promoter and NOS terminator carried on the vector.

[0038] The sequence information for the above design is as follows:

[0039] S1-F:

[0040] AACACGGGGGACTCTAGA GGATCC CGTGAACCTCATGCGACGTA (SEQ ID NO.2);

[0041] S1-R:

[0042] TTACCAAGCTGGGGTACC GGATCC CTGGCATCTCATCGTCCAGG (SEQ ID NO.3);

[0043] S2-F:

[0044] GCTGGGTTCGAAGTCGAC GAGCTC CTGGCATCTCATCGTCCAGG (SEQ ID NO.4);

[0045] S2-R:

[0046] GAACGATCGGGGAAATTC GAGCTC CGTGAACCTCATGCGACGTA (SEQ ID NO. 5).

[0047] In SEQ ID NO.2-5, the underlined parts are vector homologous arms, the italicized parts are enzyme restriction sites, and the bolded parts are specific amplifications. Pb034 Primers for genes.

[0048] RNA interference fragment S1:

[0049] CGTGAACCTCATGCGACGTATGGGCGATGACGAATGGAGTCGTGCGGTCACGCCGCTTCCCGTGTTGCGAACGGGACGCACGCTCTGGACCAGGATCGCTGACGCTGTTCGCAGAGCCGATCTGGAACATGTTCCCGAGTTCGAAGTTGATCTGTCAGGGGATCCAGGCTGTCAGAACGCGCACGCTCCGAACCCATGGGTGTTTGCCGTGTCGATGGCGCCGGAAGCGATCGATCGAGCGCGTTGGCAATGGCAAACCTTCATGGCGAACGTCCCGAGGACGGCACCCGAGGCGTTGCTTCATGGTGGGCGTGGCATCGTTCTGTCGGGCGGCAGGCTGTCCCATCTGCATACCGTCGTCATCACCATCACTAGGCTTCGAAATCTGGGATGCAGACTCCCTATTGAACTCTGGTTCCTGGACGATGAGATGCCA (SEQ ID NO.6);

[0050] RNA interference fragment S2:

[0051] TGGCATCTCATCGTCCAGGAACCAGAGTTCAATAGGGAGTCTGCATCCCAGATTTCGAAGCCTAGTGATGGTGATGACGACGGTATGCAGATGGGACAGCCTGCCGCCCGACAGAACGATGCCACGCCCACCATGAAGCAACGCCTCGGGTGCCGTCCTCGGGACGTTCGCCATGAAGGTTTGCCATTGCCAACGCGCTCGATCGATCGCTTCCGGCGCCATCGACACGGCAAACACCCATGGGTTCGGAGCGTGCGCGTTCTGACAGCCTGGATCCCCTGACAGATCAACTTCGAACTCGGGAACATGTTCCAGATCGGCTCTGCGAACAGCGTCAGCGATCCTGGTCCAGAGCGTGCGTCCCGTTCGCAACACGGGAAGCGGCGTGACCGCACGACTCCATTCGTCATCGCCCATACGTCGCATGAGGTTCACG (SEQ ID NO.7).

[0052] By floral dip method Pb034 A gene silencing vector was used to transform Columbia-0 Arabidopsis thaliana. Transgenic plants were screened using the herbicide resistance gene (bar) carried in the vector. Harvested Arabidopsis seeds were evenly sown in 10cm × 20cm bread boxes and grown under artificial light for one week before the first herbicide screening. 80 µL of 10% glufosinate was dissolved in 500 mL of deionized water, shaken well, and sprayed evenly onto the plant leaves, ensuring complete wetting. The spraying was repeated one week later; surviving plants were designated as T1 generation transgenic plants. The T2 generation screening method was basically the same, except that seeds were sown in small pots for cultivation. For the T3 generation screening, to more accurately observe the homozygosity of progeny, nine seeds were evenly sown in each small pot, and the spraying and screening method was repeated; plants from which all progeny survived were considered homozygous. Ultimately, two homozygous transgenic lines (L1 and L2) were successfully obtained.

[0053] After inoculating spore suspensions of six different physiological races of *Plasmodiophora stearothermiae*, root samples were collected on day 8 for qPCR experiments. The specific experimental procedure is as follows: Total RNA was extracted using Solarbio TriQuick Reagent (Catalog No.: R1100), and genomic DNA contamination was removed using Beyotime DNase I (Catalog No.: D7076). After RNA precipitation, it was dissolved in RNase-free water (Beyotime, Catalog No.: R0022). cDNA synthesis was performed using 5×TS RT-Mix (Catalog No.: RT-010-100), which was incubated at 50 ℃ for 15 minutes and then inactivated at 85 ℃ for 5 seconds. qPCR was performed using NobleRyder 2×Universal SYBR qPCR Master Mix (Catalog No.: FQ-PCR05-1). A 20 μL reaction system contained 10 μL of the premix, 0.4 μL of 10 μM forward / reverse primers (final primer concentration 0.2 μM), and 1-2 μL of cDNA template. The program running on the 7500 instrument was: 95 °C pre-denaturation for 30 seconds, followed by 40 cycles of 95 °C denaturation for 10 seconds / 60 °C annealing extension for 30 seconds, and finally, melting curves were collected; the *Plasmodium* actin gene was used as an internal control gene, and the results were obtained through 2... -ΔΔCt Method calculation Pb034 The relative expression level of the gene is used to ensure that the melting curve has a single peak and the amplification efficiency is between 90% and 110%.

[0054] Analysis confirmed that in transgenic plants Pb034 Gene expression levels were significantly downregulated ( Figure 5 (See Figure A in the image). The primers used to verify the expression are shown in SEQ ID NO.10-11.

[0055] Pb034-F: GGCAAACCTTCATGGCGAAC (SEQ ID NO. 10);

[0056] Pb034-R: GGTGATGACGACGGTATGCA (SEQ ID NO. 11).

[0057] The disease investigation was conducted as follows: Thirty days after Arabidopsis thaliana inoculation with clubroot fungus, the plants were uprooted, the roots were washed clean with running water, and a disease survey was carried out. The number of infected plants and disease severity were recorded, and the incidence rate and disease index were calculated. The disease index was calculated as follows: Disease index = ∑(Number of infected plants at each level × Corresponding level number) / (Total number of plants × 3) × 100. Clubroot disease was graded from 0 to 3: Grade 0: Normal root system, no disease symptoms; Grade 1: No clubroot on the main root; a small number of small tumors formed on the lower 1 / 3 of the lateral roots; Grade 2: Clubroot formed on the main root or tumors formed on the lower 1 / 3 to 2 / 3 of the lateral roots; Grade 3: Larger tumors formed on the main root and the upper 2 / 3 of the lateral roots.

[0058] The results showed that the roots of the transgenic lines were swollen ( Figure 5 (Figure B) and disease index (after t-test) Figure 5 The C-axis (Figure 1) showed a significant decrease compared to the control group, indicating that the target... Pb034 The HIGS technology can confer resistance to clubroot disease in plants. This result is the first to functionally validate this. Pb034 Feasibility of using it as a key target for disease control.

[0059] Example 3: External Silencing Pb034 dsRNA significantly enhances resistance to clubroot disease in plants.

[0060] To verify whether double-stranded RNA (dsRNA) targeting Pb034 has a preventive effect against clubroot disease, the study used the T7RNAi in vitro transcription system (Nanjing Novizan Biotechnology Co., Ltd.) to synthesize targeted RNA. Pb034 The dsRNA (sequence shown in SEQ ID NO. 6-7) and the primer sequences for in vitro transcription synthesis of dsRNA are shown in SEQ ID NO. 8-9. The sequences involved are as follows:

[0061] dsRNA-F: TAATACGACTCACTATAGGGCGTGAACCTCATGCGACGTA (SEQ ID NO.8);

[0062] dsRNA-R: CCCTATAGTGAGTCGTATTACTGGCATCTCATCGTCCAGG (SEQ ID NO.9);

[0063] Under artificial light conditions, 1 mL of a 1×10⁻⁶ solution was inoculated into the roots of each wild-type Arabidopsis thaliana plant. 6 The dsRNA solution was prepared with RNase-free water (RNase-free H2O) to a concentration of 40 nmol / L, and amino-modified dendritic macroporous silica nanomaterials (catalog number: 778949) to a final concentration of 0.5 mg / mL and an RNase inhibitor (RNaseOUT™, catalog number: 10777019) to a final concentration of 1 U / μL. The solution was incubated on ice for 30 minutes before use. Before application, the solution was thoroughly mixed, and 1 mL was slowly added dropwise to the root of each Arabidopsis thaliana plant using a pipette. The dsRNA solution was applied three times after inoculation with *Plasmodiophora stylosa* on days 2, 4, and 6. A blank control group was included.

[0064] The experimental results showed that 8 days after inoculation with *Plasmodiophora stylosa*, the treatment group... Pb034 The gene expression level decreased by 54.6% compared to the control group. Figure 6 (Figure A); 25 days after inoculation, the root morphology index and clubroot biomass of the treated Arabidopsis thaliana decreased by 65.7% and 53.4%, respectively. Figure 6 China B map Figure 6 (Figure C). The above results indicate that exogenous application of targeted... Pb034 The dsRNA can effectively silence key genes of pathogens, significantly inhibit the infection process of clubroot bacteria, and has good control potential.

[0065] In summary, this invention is the first to verify, from a functional perspective, that... Pb034 Feasibility of using it as a key target for disease control. This invention relates to the exogenous application of targeted therapy. Pb034 The dsRNA can effectively block the infection process of *Plasmodiophora stylosa* by specifically silencing key genes in pathogens. It demonstrates good potential for field application and provides an innovative technical pathway for developing environmentally friendly RNA biopesticides.

Claims

1. Plasmodium Pb034 Genes or used for silencing Pb034 The application of RNA interference fragments or double-stranded RNA in the control of clubroot disease in Arabidopsis thaliana; among them, The Pb034 The nucleotide sequence of the gene is shown in SEQ ID NO.1; The RNA interference fragment includes a target gene fragment and its reverse complementary fragment. The nucleotide sequences of the target gene fragment and its reverse complementary fragment are shown in SEQ ID NO. 6-7, respectively. The nucleotide sequences of the sense strand and the antisense strand of the double-stranded RNA are shown in SEQ ID NO. 6-7, respectively.

2. The clubroot fungus according to claim 1 Pb034 Genes or used for silencing Pb034 The application of RNA interference fragments or double-stranded RNA in the control of clubroot disease in Arabidopsis thaliana is characterized by, Will be used for silence Pb034 Transforming Arabidopsis thaliana with RNA interference fragments or double-stranded RNA to reduce gene expression Pb034 Gene expression levels.

3. The clubroot fungus according to claim 2 Pb034 Genes or used for silencing Pb034 The application of RNA interference fragments or double-stranded RNA in the control of clubroot disease in Arabidopsis thaliana is characterized by, reduce Pb034 Gene expression levels include the following steps: Targeting the Pb034 The RNA interference fragment of the gene is ligated into a silencing expression vector to obtain... Pb034 A gene silencing vector is used to transform Arabidopsis thaliana crops using Agrobacterium-mediated transformation; wherein the RNA interference fragment includes a target gene fragment and an inverse complementary fragment of the target gene fragment, and the nucleotide sequences of the target gene fragment and its inverse complementary fragment are shown in SEQ ID NO. 6-7, respectively.

4. The clubroot fungus according to claim 3 Pb034 Genes or used for silencing Pb034 The application of RNA interference fragments or double-stranded RNA in the control of clubroot disease in Arabidopsis thaliana is characterized by, The Pb034 Methods for constructing gene silencing vectors include: Using the sequence shown in SEQ ID NO.1 as a template, the target fragment S1 was amplified using the primer pairs shown in SEQ ID NO.2-3; Linearized vectors were obtained by digesting the PBI121Bar-RNAi vector with BamHI enzyme; The target fragment S1 and the linearized vector PBI121Bar-RNAi were homologously recombined to obtain the recombinant vector PBI121Bar-RNAi-S1. Using the sequence shown in SEQ ID NO.1 as a template, the target fragment S2 was amplified using the primer pair shown in SEQ ID NO.4-5; Linearized vectors were obtained by digesting the recombinant vector PBI121Bar-RNAi-S1 with Sac I enzyme; Homologous recombination of the target fragment S2 and the linearized vector PBI121Bar-RNAi-S1 yielded... Pb034 Gene silencing vector.

5. The clubroot fungus according to claim 2 Pb034 The application of a gene, or an RNA interference fragment or double-stranded RNA used to silence Pb034 gene expression, in the control of clubroot disease in Arabidopsis thaliana, characterized in that... reduce Pb034 Gene expression levels include the following steps: Targeting the Pb034 The double-stranded RNA of the gene, the delivery vector, and the RNase inhibitor are mixed and prepared into a solution with RNase-free water, and the solution is used for root irrigation treatment of plants. The nucleotide sequences of the sense and antisense strands of the double-stranded RNA are shown in SEQ ID NO. 6-7, respectively.

6. The clubroot fungus according to claim 5 Pb034 Genes or used for silencing Pb034 The application of RNA interference fragments or double-stranded RNA in the control of clubroot disease in Arabidopsis thaliana is characterized by, The method for synthesizing the double-stranded RNA includes: using primer pairs as shown in SEQ ID NO. 8-9, and employing T7 RNA in vitro transcription technology to synthesize the double-stranded RNA.

7. A method for controlling clubroot disease in Arabidopsis thaliana, characterized in that, Silence Pb034 Transformation of Arabidopsis thaliana with RNA interference fragments or double-stranded RNA expressing genes, the aforementioned Pb034 The gene nucleotide sequence is shown in SEQ ID NO.1.