A strain producing pyrimidine benzylpenicillin A and its application

Abstract

The present invention belongs to the field of microbial technology, and particularly relates to a strain producing pyrimidine penicillium A and its application. The strain is classified and named as Penicillium oxalicum ( Penicillium oxalicum ) Tla16, which has been deposited in the China General Microbiological Culture Collection Center on October 21, 2024, with the deposit number: CGMCC No. 41547. The Penicillium oxalicum Tla16 provided by the present invention has a high fermentation pyrimidine A production capacity, strong environmental adaptability, a relatively simple supporting culture medium and culture conditions, convenient operation, and advantages in industrial application.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a strain for producing pyripyrimidine A and application thereof. Background Art

[0002] As a new type of highly effective and low-toxic insecticide, cyclohexyl pyrifos has attracted wide attention in the agricultural field for its unique insecticidal mechanism and excellent performance since it was launched on the market. Its unique chemical structure and mode of action provide new solutions for pest control, especially in the prevention and control of piercing-sucking mouthparts pests, showing significant advantages. Cyclohexyl pyrifos is synthesized by two simple and efficient chemical reactions using pyrifos A as a precursor. The preparation process of pyrifos A is the key factor in the preparation of cyclohexyl pyrifos. Pyrifos compounds are semiterpenoid compounds composed of pyridine ring and α-pyrone structure produced by fungi. They have good insecticidal activity and were first isolated from Aspergillus fumigatus FO-1289. There are four pyrifos derivatives, A, B, C, and D, among which pyrifos A has the best activity. Some researchers have studied the process of chemical synthesis of pyrifos A, which requires 17 steps of reaction, but the total yield is low, only 5.3%, so biological fermentation is still the main method for preparing pyrifos A. At present, it has been found that microorganisms such as Aspergillus fumigatus, Penicillium griseofluoridum, and Penicillium faecium have the ability to synthesize pyripyropyrine A, but the fermentation yield is low. The highest original strain reported, Penicillium griseofluoridum F1959, has a yield of about 20 mg / L. With the analysis of the synthesis pathway of pyripyropyrine A, Sun Jianpeng et al. heterologously expressed the synthetic gene cluster of Neosartorya fischeri pyripyropyrine A in Aspergillus oryzae. After optimizing the fermentation conditions, the yield reached 263.5 mg / L, which is still not high. Summary of the invention

[0003] The technical problem to be solved by the present invention is to provide a strain isolated from soil that efficiently produces pyripyropyrine A, and a method for using the strain to ferment and produce pyripyropyrine A. The pyripyropyrine A-producing strain provided by the present invention is isolated from farmland soil in Yantai, has simple cultivation and strong genetic stability.

[0004] The technical solution of the present invention is as follows:

[0005] A strain producing pyriproxyfen A was deposited in the China General Microbiological Culture Collection Center on October 21, 2024. It was classified and named Penicillium oxalicum and the collection number was CGMCC No.41547.

[0006] Furthermore, the ITS gene sequence of the strain is as shown in SEQ.NO.1.

[0007] The invention also provides application of the strain in producing pyripyromycin A by fermentation.

[0008] Further, as a preferred embodiment, the fermentation conditions for the strain to ferment and produce pyriproxyproline A are as follows: a speed of 220 r / min, a pH of 6.0 to 6.8, a fermentation temperature of 20 to 30°C, and a shaking culture on a shaking table for 5 to 10 days; the components and final concentrations of the fermentation medium are as follows: a carbon source of 20 to 50 g / L, K2HPO4 of 1.5 g / L, yeast extract powder of 1 g / L, soybean powder of 10 g / L, cottonseed protein of 5 g / L, magnesium sulfate of 0.3 g / L, KCl of 0.5 g / L, FeSO4 of 0.01 g / L, CaCl2 of 0.1 g / L, niacin of 0.5 to 2 g / L, calcium pantothenate of 2 mg / L, riboflavin of 1 mg / L, adenosine of 2 mg / L, ZnSO4 of 1 mg / L, CuSO4 of 0.4 mg / L, and sodium molybdate of 0.05 mg / L.

[0009] Furthermore, the carbon source in the fermentation medium is one or more of soluble starch, glucose, dextrin and sucrose.

[0010] As one of the preferred implementations, the application further includes the step of strain activation: picking strains and streaking them onto solid preservation medium, and culturing them in a constant temperature incubator at 20 to 30° C. for 5 to 7 days.

[0011] As one of the preferred embodiments, the application also includes liquid seed preparation: picking activated strains and inoculating them into a container filled with seed culture medium, sealing it with gauze, and shaking and culturing it on a shaker at 20-30°C and 180-220 r / min for 1-3 days to obtain liquid seeds.

[0012] As one of the preferred implementations, the application also includes liquid fermentation: the prepared liquid seeds are inoculated into the fermentation medium at a volume ratio of 5-15%, and the liquid volume is 1 / 5 of the container volume.

[0013] As one of the preferred embodiments, the components and final concentrations of the solid preservation medium are: glucose 20 g / L, peptone 20 g / L, yeast extract powder 10 g / L, agar 20 g / L, pH 6.5, and high-pressure steam sterilization at 121°C for 20 min.

[0014] As one of the preferred embodiments, the liquid seed culture medium comprises: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder, 20 g / L glucose, pH 6.5, and is sterilized by high pressure steam at 121°C for 20 min.

[0015] The invention also provides a biological preparation, which contains the fermentation product of the strain.

[0016] The beneficial effects of the present invention compared with the prior art are as follows: bifenthrin is an important high-efficiency and low-toxic insecticide with broad application prospects, and its important precursor compound pyriproxyfen A is produced by microbial fermentation, and the fermentation yield of pyriproxyfen A is crucial to the manufacture of bifenthrin, and the production strain is a key factor in the synthesis of pyriproxyfen A. The Penicillium oxalicum Tla16 provided by the present invention has a high fermentation pyriproxyfen A production capacity, strong environmental adaptability, a relatively simple supporting culture medium and culture conditions, convenient operation, and advantages in industrial application. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Colony morphology of Tla16 on YPD medium;

[0018] Figure 2 Microscopic morphology of Tla16 bacteria;

[0019] Figure 3 HR-ESI-MS spectra of pyriproxyfen A standard and Tla16 fermentation broth, where (a) is the standard spectra and (b) is the fermentation broth spectra. DETAILED DESCRIPTION

[0020] In order to clarify the understanding of the features of the present invention, the present invention is further described below in conjunction with some non-limiting implementation examples.

[0021] Example 1: Strain identification and product characterization

[0022] 1) Strain identification: The colony of strain Tla16 is generally flat, with obvious raised rings in the middle of the colony. The colony grows flat like a carpet. There is a circle of white hyphae around the colony, with a velvety texture. The middle of the colony is turquoise ( Figure 1 ).like Figure 2 The conidiophores shown are separate and have broom-like branchlets, which are usually in two whorls, occasionally in three or one whorl; the spores usually grow in chains, mostly spherical, with a smooth surface; they are light yellow to light green when spores are formed, and eventually turn into turquoise.

[0023] The length of the ITS gene sequence obtained by DNA extraction, PCR amplification and sequencing was 513 bp. BLAST comparison on GenBank showed that the strain had a base similarity of 99.8% with Penicillium oxalicum (MF802280.1), and the strain Tla16 was identified as Penicillium oxalicum. The ITS sequence information is as follows: gattgatggtgttcgccggcgggcgccggccgggcctacagagcgggtgacgaagccccatacgctcgaggaccggacgcggtgccgccgctgcctttcgggcccgccccccggaagcggggggcgagagcccaacacacaagccgtgcttgagggcagcaatgacgctcggacaggcatgccccccggaataccagggggcgcaatgtgcgttcaaagactcgatgattcactgaattctgcaattcacatt acttatcgcatttcgctgcgttcttcatcgatgccggaaccaagagatccgttgttgaaagttttaactgatttagtcaagtactcagactgcaatcttcagacaagagttcgtttgtgtgtcttcggcggg cgcgggcccgggggcggatgccccccggcggccgtgaggcgggcccgccgaagcaaaggtacgataaacacgggtggggaggttggacccagagggccctcactcggtaatgatccttccgcaggc (seq ID NO.1).

[0024] The Penicillium oxalicum Tla16 described in this invention has been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on October 21, 2024, with the deposit number: CGMCC No. 41547. The address of the deposit unit is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0025] 2) Product characterization: HPLC-ESI-QTOF-MS was used to characterize the products in the fermentation broth. 1 µL of fermentation broth (10 µg / mL) was loaded onto an Agilent ZORBAX Eclipse Plus 95Å C18 column (5 µm, 4.6 × 100 mm) with acetonitrile (A) and ultrapure water (B) as the mobile phases. The elution program was: 0–10 min, 20–100% A. The elution flow rate was 0.8 mL / min and the column temperature was 40°C. High-resolution mass spectrometry was performed using an electrospray ionization source (ESI) and positive ion mode ( m / z 50–1000). HPLC-ESI-QTOF-MS was used in positive ion mode to qualitatively analyze the fermentation broth components. Figure 3 As shown in (a): From the retention time and mass spectrum data of the standard, it can be seen that the peak time of pyrimidine A is 5.29 min, and the detected molecular ion peak is the hydrogen addition ion m / z 584.2539 [M+H] + The theoretical molecular formula is C 31 H 37 NO 10 (Accurate molecular weight 584.2496, error 7.36 ppm). In the positive ion mode, hydrogen adduct ions were detected at a retention time of 5.482 min in the fermentation broth. m / z 584.2518 [M+H] + , error 3.77 ppm, such as Figure 3 As shown in b. By comparing the retention time and mass spectrometry data with those of the pyrimidine A standard, it was determined that the fermentation broth contained pyrimidine A.

[0026] Example 2 Production of pyripyropyrine A by fermentation with Penicillium oxalicum Tla16

[0027] 1) Strain activation: Pick the strain and streak it into the activation medium: glucose 5 g / L, malt extract powder 5 g / L, yeast extract powder 5 g / L, agar 20 g / L, natural pH, sterilize with high pressure steam at 121℃ for 20min; streak it and culture it in a constant temperature incubator at 25℃ for 48h;

[0028] 2) Liquid seed preparation: Pick 1 ring of activated strain and inoculate it into a 500mL Erlenmeyer flask containing 50mL seed culture medium. The liquid seed culture medium components are: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder, natural pH, sterilize with high pressure steam at 121℃ for 20min; seal with eight layers of gauze, shake and culture at 25℃, 200r / min for 2d to obtain liquid seeds;

[0029] 3) Liquid fermentation: Inoculate the medium with a volume ratio of 15% and the final concentrations are soluble starch 20 g / L, sodium acetate 5, K2HPO4 1.5 g / L, yeast extract 1 g / L, soybean powder 10 g / L, cottonseed protein 5 g / L, magnesium sulfate 0.3 g / L, KCl 0.5 g / L, FeSO4 0.01 g / L, CaCl2 0.1 g / L, niacin 2 g / L, calcium pantothenate 2 mg / L, riboflavin 1 mg / L, adenosine 2 mg / L, ZnSO4 1 mg / L, CuSO4 0.4 mg / L, sodium molybdate 0.05 mg / L, pH 6.5, sterilize with high pressure steam at 115 °C for 20 min, inoculate the prepared fermentation medium with liquid seeds, fill 100 mL / 500 mL Erlenmeyer flask, rotate at 220 r / min, pH 6.5, fermentation temperature 28℃, after 7 days of shaking culture, the yield of pyriproxyproline A was determined to be 267 mg / L.

[0030] Example 3 Production of pyripyropyrine A by fermentation with Penicillium oxalicum Tla16

[0031] 1) Strain activation: Pick the strain and streak it into the activation medium: glucose 5 g / L, malt extract powder 5 g / L, yeast extract powder 5 g / L, agar 20 g / L, natural pH, sterilize with high pressure steam at 121℃ for 20min; streak it and culture it in a constant temperature incubator at 28℃ for 48h;

[0032] 2) Liquid seed preparation: Pick 1 ring of activated strain and inoculate it into a 500mL Erlenmeyer flask containing 50mL seed culture medium. The liquid seed culture medium components are: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder, natural pH, sterilized by high pressure steam at 121℃ for 20min; seal with eight layers of gauze, culture at 28℃, 200r / min shaking for 2d to obtain liquid seeds;

[0033] 3) Liquid fermentation: Inoculate 15% of the inoculum into a fermentation medium composed of 50 g / L glucose, 5 g / L sodium acetate, 1.5 g / L K2HPO4, 1 g / L yeast extract, 10 g / L soybean powder, 5 g / L cottonseed protein, 0.3 g / L magnesium sulfate, 0.5 g / L KCl, 0.01 g / L FeSO4, 0.1 g / L CaCl2, 2 g / L niacin, 2 mg / L calcium pantothenate, 1 mg / L riboflavin, 2 mg / L adenosine, 1 mg / L ZnSO4, 0.4 mg / L CuSO4, 0.05 mg / L sodium molybdate, pH 6.5, sterilize with high pressure steam at 115°C for 20 min, fill with 100 mL / 500 mL Erlenmeyer flask, rotate at 220 rpm. r / min, pH 6.5, fermentation temperature 30℃, after 10 days of shaking culture, the pyriproxyproline production was determined to be 753 mg / L.

Claims

1. A strain producing pyriproxyfentamethylenetetracycline A, characterized in that: The strain is deposited in the China General Microbiological Culture Collection Center on October 21, 2024, and is classified and named Penicillium oxalicum. Penicillium Oxalicum , the deposit number is: CGMCC No. 41547.

2. A biological agent, characterized in that: The biological preparation contains the fermentation product of the strain according to claim 1.

3. The use of the strain according to claim 1, characterized in that: The application is to produce pyriproxypyrimidine A by fermentation using the strain described in claim 1.

4. The use according to claim 3, characterized in that: The fermentation conditions for producing pyripyropyrine A by the strain are as follows: a rotation speed of 220 r / min, a pH of 6.0-6.8, a fermentation temperature of 20-30°C, and a shaking culture on a shaking table for 5-10 days; the components and final concentrations of the fermentation medium are as follows: a carbon source of 20-50 g / L, K2HPO4 of 1.5 g / L, yeast extract powder of 1 g / L, soybean powder of 10 g / L, cottonseed protein of 5 g / L, magnesium sulfate of 0.3 g / L, KCl of 0.5 g / L, FeSO4 of 0.01 g / L, CaCl2 of 0.1 g / L, nicotinic acid of 0.5-2 g / L, calcium pantothenate of 2 mg / L, riboflavin of 1 mg / L, adenosine of 2 mg / L, ZnSO4 of 1 mg / L, CuSO4 of 0.4 mg / L, and sodium molybdate of 0.05 mg / L.

5. The use according to claim 4, characterized in that: The carbon source in the fermentation medium is one or more of soluble starch, glucose, dextrin and sucrose.

Images