A glycosyltransferase mutant for synthesizing rebaudioside M and a synthetic method of rebaudioside M

Abstract

The invention discloses a glycosyltransferase mutant for synthesizing rebaudioside M and a synthesis method of rebaudioside M, and belongs to the technical field of genetic engineering. The glycosyltransferase mutant for synthesizing rebaudioside M is a glycosyltransferase UGT76G4 mutant and / or a glycosyltransferase UGT91C1 mutant; the glycosyltransferase UGT76G4 mutant is obtained by the following mutation of the amino acid sequence shown in SEQ ID NO:1: the 85th amino acid is mutated from L to R, and the 90th amino acid is mutated from I to G; the glycosyltransferase UGT91C1 mutant is obtained by the following mutation of the amino acid sequence shown in SEQ ID NO:3: the 204th amino acid is mutated from L to A, the 208th amino acid is mutated from F to A, and the 380th amino acid is mutated from G to D. The mutant can realize the efficient catalytic synthesis of rebaudioside M, and improve the yield of enzymatic synthesis of rebaudioside M.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a glycosyltransferase mutant for synthesizing rebaudioside M and a method for synthesizing rebaudioside M. Background Art

[0002] Reb M is a high-sweetness, low-calorie natural sweetener from Stevia rebaudiana, and is a member of the steviol glycoside family. Reb M is about 300-400 times sweeter than sucrose, and has almost no bitterness or aftertaste. Reb M has attracted much attention for its excellent taste and high sweetness. Reb M is widely used in low-calorie beverages, candies, cakes, dairy products and other foods as a natural sweetener to replace sucrose. Moreover, due to its low calorie and high sweetness, Reb M is also used in health foods and functional foods. In addition, Reb M also has potential health benefits, such as anti-oxidation and anti-inflammatory, so it also has certain application prospects in the medical field.

[0003] The content of rebaudioside M in stevia leaves is relatively low, and it is usually prepared by biocatalytic synthesis. However, the enzyme activity of the glycosyltransferase for synthesizing rebaudioside M in the prior art is not high enough, resulting in low synthesis efficiency of rebaudioside M. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a glycosyltransferase mutant for synthesizing rebaudioside M and a method for synthesizing rebaudioside M, so as to overcome the problems in the prior art that the enzymatic activity of glycosyltransferase is not high enough and the synthesis efficiency of rebaudioside M is low.

[0005] In a first aspect, the present invention provides a glycosyltransferase mutant for synthesizing rebaudioside M, wherein the glycosyltransferase mutant is a glycosyltransferase UGT76G4 mutant and / or a glycosyltransferase UGT91C1 mutant.

[0006] The glycosyltransferase UGT76G4 mutant is obtained by subjecting the amino acid sequence shown in SEQ ID NO: 1 to the following mutations: the 85th amino acid is mutated from L to R, and the 90th amino acid is mutated from I to G.

[0007] The glycosyltransferase UGT91C1 mutant is obtained by subjecting the amino acid sequence shown in SEQ ID NO: 3 to the following mutations: the 204th amino acid is mutated from L to A, the 208th amino acid is mutated from F to A, and the 380th amino acid is mutated from G to D.

[0008] Furthermore, the amino acid sequence of the glycosyltransferase UGT76G4 mutant is shown in SEQ ID NO:5; the amino acid sequence of the glycosyltransferase UGT91C1 mutant is shown in SEQ ID NO:7.

[0009] Preferably, the nucleotide sequence of the gene encoding the glycosyltransferase UGT76G4 mutant is shown in SEQ ID NO:6; the nucleotide sequence of the gene encoding the glycosyltransferase UGT91C1 mutant is shown in SEQ ID NO:8.

[0010] In a second aspect, the present invention provides a method for synthesizing rebaudioside M, using stevioside, UDPG, and sucrose as substrates, and using the above-mentioned glycosyltransferase UGT76G4 mutant and / or glycosyltransferase UGT91C1 mutant coupled with sucrose synthase to catalyze the synthesis of rebaudioside M.

[0011] Furthermore, the steviol glycoside is rebaudioside E, rebaudioside D, STV, rebaudioside A or a steviol glycoside combination.

[0012] Furthermore, in the stevioside composition, by mass percentage: rebaudioside A accounts for 40% to 60%, STV, rebaudioside E and rebaudioside D account for 35% to 55% in total, and the remainder is other steviosides or impurities.

[0013] Furthermore, when the substrate is rebaudioside E, the reaction system is catalyzed by coupling the glycosyltransferase UGT76G4 mutant with sucrose synthase; and / or, the concentrations of each material in the reaction system are: glycosyltransferase UGT76G4 mutant enzyme solution 20~50OD, sucrose synthase enzyme solution 10~30OD, sucrose 400~600mM, UDPG 1~2mM, and rebaudioside E 30~50mM.

[0014] Furthermore, when the substrate is rebaudioside D, the reaction system is catalyzed by coupling the glycosyltransferase UGT91C1 mutant with sucrose synthase; and / or, the concentrations of each material in the reaction system are: glycosyltransferase UGT91C1 mutant enzyme solution 20~50OD, sucrose synthase enzyme solution 10~30OD, sucrose 400~600mM, UDPG 1~2mM, and rebaudioside D 30~50mM.

[0015] Furthermore, when the substrate is STV, rebaudioside A or a stevioside composition, the reaction system uses a glycosyltransferase UGT76G4 mutant and a glycosyltransferase UGT91C1 mutant to co-couple sucrose synthase to carry out a catalytic reaction.

[0016] Furthermore, when the substrate is STV, the concentrations of each material in the reaction system are: glycosyltransferase UGT76G4 mutant enzyme solution 10~20OD, glycosyltransferase UGT91C1 mutant enzyme solution 20~50OD, sucrose synthase enzyme solution 20~30OD, sucrose 400~600mM, UDPG 1~2mM, and STV 30~50mM.

[0017] When the substrate is rebaudioside A, the concentrations of each material in the reaction system are: glycosyltransferase UGT76G4 mutant enzyme solution 10~20OD, glycosyltransferase UGT91C1 mutant enzyme solution 20~50OD, sucrose synthase enzyme solution 20~30OD, sucrose 500~700mM, UDPG 1~2mM, and rebaudioside A 50~80mM.

[0018] When the substrate is a stevioside composition, the concentrations of the materials in the reaction system are: 10-20OD of glycosyltransferase UGT76G4 mutant enzyme solution, 20-50OD of glycosyltransferase UGT91C1 mutant enzyme solution, 20-30OD of sucrose synthase enzyme solution, 500-700mM of sucrose, 1-2mM of UDPG, and 50-80mM of stevioside composition.

[0019] Furthermore, the reaction conditions during the catalytic synthesis are: pH value is 7-7.5, and temperature is 35-40°C.

[0020] Compared with the prior art, the present invention has the following technical effects:

[0021] (1) Compared with the prior art, the glycosyltransferase mutant provided by the present invention improves the enzymatic activity and catalytic efficiency of the glycosyltransferase, can achieve efficient catalytic synthesis of rebaudioside M, and thus improves the yield of rebaudioside M synthesized by the enzymatic method.

[0022] (2) The present invention uses the above-mentioned glycosyltransferase UGT76G4 mutant and / or glycosyltransferase UGT91C1 mutant coupled with sucrose synthase to catalyze the synthesis of rebaudioside M, thereby establishing a UDPG cycle in the reaction system and reducing the amount of UDPG added.

[0023] (3) In the present invention, when the substrate is STV, rebaudioside A or a stevioside composition, the glycosyltransferase UGT76G4 mutant and the glycosyltransferase UGT91C1 mutant are selected to be coupled with sucrose synthase to carry out the catalytic reaction. The two glycosyltransferase mutants are used together to further improve the synthesis efficiency of rebaudioside M. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a diagram of the enzyme activity assay results in Example 3.

[0025] Figure 2This is a stability test at different pH values ​​when the glycosyltransferase mutant in Example 4 is coupled to sucrose synthase.

[0026] Figure 3 This is a stability test at different temperatures when the glycosyltransferase mutant in Example 5 is coupled to sucrose synthase.

[0027] Figure 4 This is the reaction conversion diagram for the biosynthesis of RM using RE as substrate in Example 6.

[0028] Figure 5 This is the reaction conversion diagram for the biosynthesis of RM using RD as substrate in Example 7.

[0029] Figure 6 This is the reaction conversion diagram for the biosynthesis of RM using STV as a substrate in Example 8.

[0030] Figure 7 This is the reaction conversion diagram for the biosynthesis of RM using RA as a substrate in Example 9.

[0031] Figure 8 This is the reaction conversion diagram for the biosynthesis of RM using TSG as a substrate in Example 10. DETAILED DESCRIPTION

[0032] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0033] It should be understood that the raw materials used in the following examples are all commercially available raw materials unless otherwise specified. Example 1

[0034] 1. Construct a recombinant strain J2 containing the glycosyltransferase UGT76G4 mutant T1 gene. The specific process is as follows:

[0035] Using ugt76G4-F and ugt76G4-R as primers, and the cDNA of the wild-type stevioside-derived glycosyltransferase UGT76G4 encoding gene (SEQ ID NO: 2) as a template, PCR amplification was performed using a high-fidelity DNA polymerase (Wuhan Abotek Biotechnology Co., Ltd.) to obtain the correct ugt76G4 gene fragment. The glycosyltransferase UGT76G4 is disclosed in patent CN115094074 A. The amino acid sequence of the glycosyltransferase UGT76G4 is shown in SEQ ID NO: 1.

[0036] The ugt76G4 gene fragment was connected to the pET21a(+) vector after double digestion with NdeI and XhoI using the Gibson Assembly method to obtain a recombinant vector containing the ugt76G4 gene fragment. Take 5 μL of the recombinant vector containing the ugt76G4 gene fragment and transform it into E.coli TOP10 competent cells, spread it on a solid Luria-Bertani medium containing 100 μg / mL ampicillin, and culture it at 37°C for 14 hours. After the culture is completed, pick the monoclonal clone on the culture medium, perform PCR verification, and inoculate the monoclonal clone with the correct length of the amplified product into a liquid Luria-Bertani medium containing 100 μg / mL ampicillin to obtain a recombinant plasmid containing the ugt76G4 gene fragment.

[0037] ugt76G4-F (SEQ ID NO:9):

[0038] GAGATATACATATGGCTAGCATGGAAAATAAAACGGAGACCACC.

[0039] ugt76G4-R (SEQ ID NO:10):

[0040] GTGGTGGTGGTGCTCGAGTTACAACGATGAAATGTAAGAAA.

[0041] The recombinant plasmid containing the ugt76G4 gene fragment obtained above was used as a template, and F1 and F2 were used as primers to carry out a PCR amplification reaction. The PCR amplification reaction product was digested with DpnI to obtain a recombinant plasmid containing the gene encoding the glycosyltransferase UGT76G4 mutant I90G, and the mutation site of the mutant was I90G. The recombinant plasmid was transformed into E. coli TOP10 competent cells to obtain the recombinant strain J1.

[0042] F1:TCGCTGGTATGCGGGGACCGATTATCAACGA (SEQ ID NO: 11).

[0043] F2: TCGTTGATAATCGGTCCCCGCATACCAGCGA (SEQ ID NO: 12).

[0044] The above obtained recombinant plasmid containing the glycosyltransferase UGT76G4 mutant I90G encoding gene was used as a template, and F3 and F4 were used as primers to perform PCR amplification reaction. The PCR amplification reaction product was digested with DpnI to obtain a recombinant plasmid containing the glycosyltransferase UGT76G4 mutant encoding gene, which also contained mutation sites L85R and I90G and was named T1. The recombinant plasmid was transformed into E. coli TOP10 competent cells to obtain the recombinant strain J2.

[0045] The amino acid sequence of glycosyltransferase UGT76G4 mutant T1 is shown in SEQ ID NO:5; the nucleotide sequence of the gene encoding glycosyltransferase UGT76G4 mutant T1 is shown in SEQ ID NO:6.

[0046] F3: ACCGACTCATGGTCCGCGCGCTGGTAT (SEQ ID NO: 13).

[0047] F4: ATACCAGCGCGCGGACCATGAGTCGGT (SEQ ID NO: 14).

[0048] 2. Construction of recombinant strain J4 containing the glycosyltransferase UGT91C1 mutant T2 gene. The specific process is as follows:

[0049] Using UGT91C1-F and UGT91C1-R as primers, and the cDNA of the wild-type rice-derived glycosyltransferase UGT91C1 encoding gene (SEQ ID NO: 4) as a template, PCR amplification was performed using a high-fidelity DNA polymerase (Wuhan Abotek Biotechnology Co., Ltd.) to obtain the correct UGT91C1 gene fragment. The amino acid sequence of the glycosyltransferase UGT91C1 is shown in SEQ ID NO: 3.

[0050] UGT91C1-F: GAATTCCATATGATGGACTCCGGCTACTCC (SEQ ID NO: 15).

[0051] UGT91C1-R: CCTCGAGTCAATCCTTGTAAGATCTCAATTGC (SEQ ID NO: 16).

[0052] The vector pET21a(+) and the above-mentioned PCR product UGT91C1 gene fragment were double-digested using restriction endonucleases NdeI and XhoI, respectively, and the above-mentioned double-digested products were connected using T4 DNA ligase to obtain a recombinant plasmid containing the UGT91C1 gene. Take 5 μL of the recombinant plasmid containing the UGT91C1 gene and transform it into E. coli TOP10 competent cells to obtain the recombinant strain UGT91C1, which was spread on a solid Luria-Bertani medium containing 100 μg / mL ampicillin and cultured at 37°C for 12 hours. Then pick the monoclonal colonies on the culture medium, perform PCR verification on the colonies, and inoculate the monoclonal colonies with the correct length of the PCR amplification product into a liquid Luria-Bertani medium containing 100 μg / mL ampicillin for continued culture to extract the recombinant plasmid containing the UGT91C1 gene.

[0053] The recombinant plasmid containing the UGT91C1 gene obtained above was used as a template, and F5 and F6 were used as primers to carry out a PCR amplification reaction. The PCR amplification reaction product was digested with DpnI to obtain a recombinant plasmid containing a gene encoding a glycosyltransferase UGT91C1 mutant G380D, the mutation site of which was G380D. The recombinant plasmid was transformed into E. coli TOP10 competent cells to obtain a recombinant strain J3.

[0054] F5: GCCGATCTTCGACGACCAGGGACCG (SEQ ID NO: 17).

[0055] F6: CGGTCCCTGGTCGTCGAAGATCGGC (SEQ ID NO: 18).

[0056] The recombinant plasmid containing the glycosyltransferase UGT91C1 mutant G380D encoding gene obtained above was used as a template, and F7 and F8 were used as primers to perform PCR amplification reaction. The PCR amplification reaction product was digested with DpnI to obtain a recombinant plasmid containing the glycosyltransferase UGT91C1 mutant encoding gene, which simultaneously carried mutation sites L204A, L208A and G380D and was named T2. The recombinant plasmid was transformed into E. coli TOP10 competent cells to obtain the recombinant strain J4.

[0057] The amino acid sequence of the glycosyltransferase UGT91C1 mutant T2 is shown in SEQ ID NO:7; the nucleotide sequence of the glycosyltransferase UGT91C1 mutant T2 encoding gene is shown in SEQ ID NO:8.

[0058] F7:AATGTCCGCAGCCGAGCGCGCATCCTTGACGCTCTCG (SEQ ID NO: 19).

[0059] F8:CAAGGATGCGCGCTCGGCTGCGGACATTCCCGATG (SEQ ID NO: 20). Example 2

[0060] Preparation of enzyme solution

[0061] The single colonies of the constructed recombinant strain J2 and the recombinant strain J4 were inoculated into LB solid culture medium for culture, and the culture conditions were as follows: cultured at 35°C for 16 hours, and the colonies with uniform color, raised colonies, round and smooth surfaces, and colony diameters of 2-3 mm were selected, and then inoculated into 5 mL of LB liquid culture medium, which contained 50 mg / L of ampicillin, and placed in a shaker, shaken and cultured at 37°C and 220 rpm for 7 hours to obtain the primary seed solution of the recombinant strain J2 and the primary seed solution of the recombinant strain J4, respectively.

[0062] The above-mentioned primary seed liquids were inoculated into another 50 ml LB medium at a volume ratio of 1%, placed in a shaker, and cultured at 37°C and 220 rpm for 6 h to obtain the secondary seed liquid of the recombinant strain J2 and the secondary seed liquid of the recombinant strain J4, respectively.

[0063] The above-mentioned secondary seed solutions were added to LB fermentation medium and cultured at 37°C for 3 hours, and then IPTG with a final concentration of 0.5 mM was added for induction culture. The fermentation tank speed was controlled to be ≤1000Rpm, the ventilation ratio was 1V / V / min, the temperature was 30°C, and the pH value was 7.0. The culture was continued for 36 hours until the fermentation ended, and the fermentation broth of the recombinant strain J2 and the fermentation broth of the recombinant strain J4 were obtained, respectively.

[0064] After the induction culture was completed, the fermentation broths were centrifuged at 5000 × g for 10 min, the cells were collected, and the cells were resuspended in 100 mM sodium phosphate buffer with a pH of 7.5 to obtain the OD 600 The resuspension with a value of 150 was ultrasonicated at a power of 400 W for 30 min to break the bacterial cells and release the intracellular enzymes. After the ultrasonication, the cells were centrifuged at 4 ° C and 8000 × g for 10 min in a refrigerated centrifuge, and the supernatants were collected to obtain the glycosyltransferase UGT76G4 mutant T1 enzyme solution and the glycosyltransferase UGT91C1 mutant T2 enzyme solution, respectively. Example 3

[0065] Determination of enzyme activity

[0066] 1. Using the wild-type glycosyltransferase UGT76G4 enzyme solution as a control, the glycosyltransferase UGT76G4 mutant T1 enzyme solution obtained above was used to prepare the following reaction system (1 mL):

[0067] (1) 100 mM phosphate buffer (pH 7), 2 mM UDPG, 2 mM rebaudioside A (RA), and 5 OD of wild-type glycosyltransferase UGT76G4 enzyme solution were reacted at 40°C and 200 rpm for 30 min.

[0068] (2) 100 mM phosphate buffer (pH 7), 2 mM UDPG, 2 mM rebaudioside A (RA), and 5 OD of glycosyltransferase UGT76G4 mutant T1 enzyme solution were reacted at 40°C and 200 rpm for 30 min.

[0069] After the above reactions were completed, samples were taken and heated at 95°C for 5 min to terminate the reaction, 4 volumes of methanol were added, and the mixture was centrifuged at 12,000 rpm for 5 min. The supernatant was filtered through a 0.22 μm filter membrane, and the filtrate was detected by high performance liquid chromatography to calculate the enzyme activity.

[0070] The results are as follows Figure 1 As shown: Compared with the wild-type glycosyltransferase UGT76G4, the enzyme activity of the glycosyltransferase UGT76G4 mutant T1 was significantly improved.

[0071] 2. Using the wild-type glycosyltransferase UGT91C1 enzyme solution as a control, the glycosyltransferase UGT91C1 mutant T2 enzyme solution obtained above was used to prepare the following reaction system (1 mL):

[0072] (1) 100 mM phosphate buffer (pH 7), 2 mM UDPG, 2 mM rebaudioside A (RA), and 5 OD of wild-type glycosyltransferase UGT91C1 enzyme solution were reacted at 40°C and 200 rpm for 30 min.

[0073] (2) 100 mM phosphate buffer (pH 7), 2 mM UDPG, 2 mM rebaudioside A (RA), and 5 OD of glycosyltransferase UGT91C1 mutant T2 enzyme solution were reacted at 40°C and 200 rpm for 30 min.

[0074] After the above reactions were completed, samples were taken and heated at 95°C for 5 min to terminate the reaction, 4 volumes of ethanol were added, and the mixture was centrifuged at 12,000 rpm for 5 min. The supernatant was filtered through a 0.22 μm filter membrane, and the filtrate was detected by high performance liquid chromatography to calculate the enzyme activity.

[0075] The results are as follows Figure 1As shown: Compared with the wild-type glycosyltransferase UGT91C1, the enzyme activity of the glycosyltransferase UGT91C1 mutant T2 was significantly improved.

[0076] The detection conditions of HPLC in this embodiment are as follows:

[0077] Injection volume: 10 μL; column temperature: 45°C. Chromatographic conditions: UV 210 nm, mobile phase: (A) acetonitrile, (B) 10 mmol sodium dihydrogen phosphate (adjusted to pH = 2.6 with phosphoric acid), flow rate: 0.8 mL / min, elution program: 0-15 min, 26% volume of (A), 74% volume of (B); 16-42 min, 33% volume of (A), 67% volume of (B). Example 4

[0078] When the glycosyltransferase mutant is coupled to sucrose synthase, the stability test at different pH values ​​is as follows:

[0079] 1. The following reaction systems with different pH values ​​were prepared using the glycosyltransferase UGT76G4 mutant T1 enzyme solution obtained in Example 2 (1 mL):

[0080] 100 mM phosphate buffer, 0.5 mM UDPG, 5 mM STV, 50 mM sucrose, 2 OD of sucrose synthase, and 5 OD of glycosyltransferase UGT76G4 mutant T1 enzyme solution.

[0081] Four portions of the above reaction system were prepared, and the pH values ​​of the reaction systems were 6.5, 7.0, 7.5, and 8.0, respectively. The reaction systems with different pH values ​​were reacted at 35°C and 200 rpm for 0.5 h. After the reaction was completed, samples were taken and heated at 95°C for 5 min to terminate the reaction. After cooling, 4 volumes of ethanol were added, and the mixture was centrifuged at 12000 rpm for 5 min. After the supernatant was filtered through a 0.22 μm filter membrane, the filtrate was detected by liquid chromatography, and the conversion rate of the substrate STV was calculated.

[0082] The results are as follows Figure 2 As shown: when the pH value of the reaction system is 7-7.5, the conversion rate of the substrate STV is the highest, indicating that the stability of the mutant T1 is the highest at this pH value.

[0083] 2. The following reaction systems with different pH values ​​were prepared using the glycosyltransferase UGT91C1 mutant T2 enzyme solution obtained in Example 2 (1 mL):

[0084] 100 mM phosphate buffer, 0.5 mM UDPG, 5 mM STV, 50 mM sucrose, 2 OD of sucrose synthase, and 5 OD of glycosyltransferase UGT91C1 mutant T2 enzyme solution.

[0085] Four portions of the above reaction system were prepared, and the pH values ​​of the reaction systems were 6.5, 7.0, 7.5, and 8.0, respectively. The reaction systems with different pH values ​​were reacted at 35°C and 200 rpm for 0.5 h. After the reaction was completed, samples were taken and heated at 95°C for 5 min to terminate the reaction. After cooling, 4 volumes of ethanol were added, and the mixture was centrifuged at 12000 rpm for 5 min. After the supernatant was filtered through a 0.22 μm filter membrane, the filtrate was detected by liquid chromatography, and the conversion rate of the substrate STV was calculated.

[0086] The results are as follows Figure 2 As shown: when the pH value of the reaction system is 7-7.5, the conversion rate of the substrate STV is the highest, indicating that the stability of the mutant T2 is the highest at this pH value. Example 5

[0087] When the glycosyltransferase mutant is coupled to sucrose synthase, the stability test at different temperatures is as follows:

[0088] 1. Prepare the following 4 reaction systems (1 mL) with the glycosyltransferase UGT76G4 mutant T1 enzyme solution obtained in Example 2:

[0089] 100mM phosphate buffer (pH 7.0), 0.5mM UDPG, 5mM STV, 50mM sucrose, 2OD sucrose synthase, 5OD glycosyltransferase UGT76G4 mutant T1 enzyme solution. The above 4 reaction systems were reacted at 30℃, 35℃, 40℃ or 45℃, 200rpm for 0.5h.

[0090] After the reaction, samples were taken and heated at 95°C for 5 min to terminate the reaction. After oscillation and mixing, the samples were centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μm filter membrane, and the filtrate was detected by liquid chromatography to calculate the conversion rate of the substrate STV.

[0091] The results are as follows Figure 3 As shown: when the temperature of the reaction system is 35~40℃, the conversion rate of the substrate STV is the highest, indicating that the stability of the mutant T1 is the highest at this temperature.

[0092] 2. The following 4 reaction systems (1 mL) were prepared with the glycosyltransferase UGT91C1 mutant T2 enzyme solution obtained in Example 2:

[0093] 100mM phosphate buffer (pH 7.0), 0.5mM UDPG, 5mM STV, 50mM sucrose, 2OD sucrose synthase, 5OD glycosyltransferase UGT91C1 mutant T2 enzyme solution. The above 4 reaction systems were reacted at 30℃, 35℃, 40℃ or 45℃, 200rpm for 0.5h.

[0094] After the reaction, samples were taken and heated at 95°C for 5 min to terminate the reaction. After oscillation and mixing, the samples were centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μm filter membrane, and the filtrate was detected by liquid chromatography to calculate the conversion rate of the substrate STV.

[0095] The results are as follows Figure 3 As shown: when the temperature of the reaction system is 35~40℃, the conversion rate of the substrate STV is the highest, indicating that the stability of the mutant T2 is the highest at this temperature. Example 6

[0096] Rebaudioside M (RM) was biosynthesized by glycosyltransferase UGT76G4 mutant T1 using rebaudioside E (RE) as substrate. The specific process is as follows:

[0097] The following reaction system was scaled up for in vitro shake flask transformation. The final concentrations of the materials in the reaction system were as follows:

[0098] Glycosyltransferase UGT76G4 mutant T1 enzyme solution 20OD, sucrose synthase enzyme solution 20OD, 500mM sucrose, 1.5mM UDPG, 30mM RE, dilute to 10ml with 100mM phosphate buffer, and adjust with 1mM NaOH to maintain the pH value of the conversion system at 7.5.

[0099] The reaction was terminated after shaking at 40°C for 24 hours. Samples were taken at 4h, 8h, 16h and 24h during the conversion process to detect the progress of the reaction. The samples were diluted to clarify and then filtered through a 0.22μm organic filter membrane to obtain a filtered clear liquid. Liquid chromatography was used to qualitatively and quantitatively detect the composition of the reaction products.

[0100] The results are as follows Figure 4 As shown: The glycosyltransferase UGT76G4 mutant T1 coupled with sucrose synthase can catalyze RE to generate RM, and the conversion rate of RE reaches more than 85%. Example 7

[0101] Rebaudioside M (RM) was biosynthesized by glycosyltransferase UGT91C1 mutant T2 using rebaudioside D (RD) as substrate. The specific process is as follows:

[0102] The following reaction system was scaled up for in vitro shake flask transformation. The final concentrations of the materials in the reaction system were as follows:

[0103] 20OD of glycosyltransferase UGT91C1 mutant T2 enzyme solution, 20OD of sucrose synthase enzyme solution, 500mM sucrose, 1.5mM UDPG, 30mM RD, made up to 10ml with 100mM phosphate buffer, and 1mM NaOH was used to adjust and maintain the pH value of the conversion system at 7.5.

[0104] The reaction was terminated after shaking at 40°C for 24 hours. Samples were taken at 4h, 8h, 16h and 24h during the conversion process to detect the progress of the reaction. The samples were diluted to clarify and then filtered through a 0.22μm organic filter membrane to obtain a filtered clear liquid. Liquid chromatography was used to qualitatively and quantitatively detect the composition of the reaction products.

[0105] The results are as follows Figure 5 As shown: Glycosyltransferase UGT91C1 mutant T2 coupled with sucrose synthase can catalyze RD to produce RM, and the conversion rate of RD reaches more than 85%. Example 8

[0106] Glycosyltransferase UGT76G4 mutant T1 and glycosyltransferase UGT91C1 mutant T2 were coupled with sucrose synthase to biosynthesize rebaudioside M (RM) using STV as a substrate. The specific process is as follows:

[0107] The following reaction system (10 ml) was scaled up for in vitro shake flask transformation. The final concentrations of the materials in the reaction system were as follows:

[0108] 30OD of glycosyltransferase UGT91C1 mutant T2 enzyme solution, 20OD of sucrose synthase enzyme solution, 500mM sucrose, 1.5mM UDPG, 30mM STV. When the conversion rate of STV reached 20%, 10OD of glycosyltransferase UGT76G4 mutant T1 enzyme solution was added, and the volume was fixed to 10ml with 100mM phosphate buffer, and 1mM NaOH was used to adjust and maintain the pH value of the conversion system to 7.5.

[0109] The reaction was terminated after shaking at 40°C for 24 hours. Samples were taken at 4h, 8h, 16h and 24h during the conversion process to detect the progress of the reaction. The samples were diluted to clarify and then filtered through a 0.22μm organic filter membrane to obtain a filtered clear liquid. Liquid chromatography was used to qualitatively and quantitatively detect the composition of the reaction products.

[0110] The results are as follows Figure 6 As shown: The combination of glycosyltransferase UGT76G4 mutant T1 and glycosyltransferase UGT91C1 mutant T2 and coupled with sucrose synthase can catalyze STV to produce RM, and the conversion rate of STV reaches more than 90%. Example 9

[0111] Glycosyltransferase UGT76G4 mutant T1 and glycosyltransferase UGT91C1 mutant T2 were coupled with sucrose synthase to biosynthesize rebaudioside M (RM) using rebaudioside A (RA) as substrate. The specific process is as follows:

[0112] The following reaction system was scaled up for in vitro shake flask transformation. The final concentrations of the materials in the reaction system were as follows:

[0113] Glycosyltransferase UGT91C1 mutant T2 enzyme solution 30 OD, sucrose synthase enzyme solution 20 OD, 700mM sucrose, 1.5mM UDPG, 50mM RA. When the conversion rate of RA reaches 20%, add UGT76G4 mutant T1 enzyme solution 10OD, make up to 10ml with 100mM phosphate buffer, and adjust the pH value of the conversion system to 7.5 with 1mM NaOH.

[0114] The reaction was terminated after shaking at 40°C for 24 hours. Samples were taken at 4h, 8h, 16h and 24h during the conversion process to detect the progress of the reaction. The samples were diluted to clarify and then filtered through a 0.22μm organic filter membrane to obtain a filtered clear liquid. Liquid chromatography was used to qualitatively and quantitatively detect the composition of the reaction products.

[0115] The results are as follows Figure 7 As shown: The combination of glycosyltransferase UGT76G4 mutant T1 and glycosyltransferase UGT91C1 mutant T2 and coupled with sucrose synthase can catalyze RA to produce RM, and the conversion rate of RA reaches more than 90%. Example 10

[0116] Glycosyltransferase UGT76G4 mutant T1 and glycosyltransferase UGT91C1 mutant T2 coupled with sucrose synthase biosynthesize rebaudioside M (RM) using steviol glycoside composition (TSG) as substrate.

[0117] In terms of mass percentage, in the above-mentioned steviol glycoside composition, RA accounts for 50%, STV, RE and RD account for 45% in total, and the remainder is other steviol glycosides or impurities.

[0118] The following reaction system was scaled up for in vitro shake flask transformation. The final concentrations of the materials in the reaction system were as follows:

[0119] Glycosyltransferase UGT91C1 mutant T2 enzyme solution 30 OD, glycosyltransferase UGT76G4 mutant T1 enzyme solution 10 OD, sucrose synthase enzyme solution 20 OD, 700 mM sucrose, 1.5 mM UDPG, 50 mM TSG, made up to 10 ml with 100 mM phosphate buffer, and adjusted with 1 mM NaOH to maintain the pH value of the conversion system at 7.5.

[0120] The reaction was terminated after shaking at 40°C for 24 hours. Samples were taken at 4h, 8h, 16h and 24h during the conversion process to detect the progress of the reaction. The samples were diluted to clarify and then filtered through a 0.22μm organic filter membrane to obtain a filtered clear liquid. Liquid chromatography was used to qualitatively and quantitatively detect the composition of the reaction products.

[0121] The results are as follows Figure 8As shown: The glycosyltransferase UGT76G4 mutant T1 and the glycosyltransferase UGT91C1 mutant T2 are used in combination and coupled with sucrose synthase, which can catalyze the production of RM using steviol glycoside composition (TSG) as a substrate, and the conversion rate of RM reaches more than 85%.

[0122] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A glycosyltransferase mutant for synthesizing rebaudioside M, characterized in that: The glycosyltransferase mutant is a glycosyltransferase UGT76G4 mutant; The glycosyltransferase UGT76G4 mutant is obtained by subjecting the amino acid sequence shown in SEQ ID NO: 1 to the following mutations: the 85th amino acid is mutated from L to R, and the 90th amino acid is mutated from I to G.

2. The glycosyltransferase mutant according to claim 1, characterized in that The amino acid sequence of the glycosyltransferase UGT76G4 mutant is shown in SEQ ID NO:

5.

3. A method for synthesizing rebaudioside M, characterized in that: Using stevioside, UDPG and sucrose as substrates, the glycosyltransferase UGT76G4 mutant and / or the glycosyltransferase UGT91C1 mutant described in claim 1 is coupled to sucrose synthase to catalyze the synthesis of rebaudioside M; The glycosyltransferase UGT91C1 mutant is obtained by subjecting the amino acid sequence shown in SEQ ID NO: 3 to the following mutations: the 204th amino acid is mutated from L to A, the 208th amino acid is mutated from F to A, and the 380th amino acid is mutated from G to D; The amino acid sequence of the glycosyltransferase UGT91C1 mutant is shown in SEQ ID NO: 7; The steviol glycoside is rebaudioside E, rebaudioside D, STV, rebaudioside A or a steviol glycoside combination; In terms of mass percentage, in the steviol glycoside composition, rebaudioside A accounts for 40% to 60%, STV, rebaudioside E and rebaudioside D account for 35% to 55% in total, and the remainder is other steviol glycosides or impurities; When the steviol glycoside in the substrate is rebaudioside E, the reaction system uses a glycosyltransferase UGT76G4 mutant coupled with sucrose synthase to carry out a catalytic reaction; When the steviol glycoside in the substrate is rebaudioside D, the reaction system uses a glycosyltransferase UGT91C1 mutant coupled with sucrose synthase to carry out a catalytic reaction; When the steviol glycoside in the substrate is STV, the steviol glycoside in the substrate is rebaudioside A, or the steviol glycoside in the substrate is a steviol glycoside composition, the reaction system uses a glycosyltransferase UGT76G4 mutant and a glycosyltransferase UGT91C1 mutant to couple sucrose synthase to carry out a catalytic reaction.

4. The method for synthesizing rebaudioside M according to claim 3, characterized in that: When the stevioside in the substrate is rebaudioside E, a glycosyltransferase UGT76G4 mutant is coupled with sucrose synthase in the reaction system for catalytic reaction, and the concentrations of the materials in the reaction system are: glycosyltransferase UGT76G4 mutant enzyme solution 20-50OD, sucrose synthase enzyme solution 10-30OD, sucrose 400-600mM, UDPG 1-2mM, and rebaudioside E 30-50mM.

5. The method for synthesizing rebaudioside M according to claim 3, characterized in that: When the stevioside in the substrate is rebaudioside D, a glycosyltransferase UGT91C1 mutant is coupled with sucrose synthase in the reaction system for catalytic reaction, and the concentrations of the materials in the reaction system are: glycosyltransferase UGT91C1 mutant enzyme solution 20-50OD, sucrose synthase enzyme solution 10-30OD, sucrose 400-600mM, UDPG 1-2mM, and rebaudioside D 30-50mM.

6. The method for synthesizing rebaudioside M according to claim 3, characterized in that: When the steviol glycoside in the substrate is STV, the concentrations of the materials in the reaction system are: 10-20OD of glycosyltransferase UGT76G4 mutant enzyme solution, 20-50OD of glycosyltransferase UGT91C1 mutant enzyme solution, 20-30OD of sucrose synthase enzyme solution, 400-600mM of sucrose, 1-2mM of UDPG, and 30-50mM of STV; When the stevioside in the substrate is rebaudioside A, the concentrations of the materials in the reaction system are: 10-20OD of glycosyltransferase UGT76G4 mutant enzyme solution, 20-50OD of glycosyltransferase UGT91C1 mutant enzyme solution, 20-30OD of sucrose synthase enzyme solution, 500-700mM of sucrose, 1-2mM of UDPG, and 50-80mM of rebaudioside A; When the steviol glycoside in the substrate is a steviol glycoside composition, the concentrations of the materials in the reaction system are: 10-20OD of glycosyltransferase UGT76G4 mutant enzyme solution, 20-50OD of glycosyltransferase UGT91C1 mutant enzyme solution, 20-30OD of sucrose synthase enzyme solution, 500-700mM of sucrose, 1-2mM of UDPG, and 50-80mM of the steviol glycoside composition.

7. The method for synthesizing rebaudioside M according to claim 3, characterized in that: The reaction conditions during the catalytic synthesis are: pH value of 7-7.5 and temperature of 35-40°C.

Images