A biochip, a method for preparing a biochip and a method for synthesizing DNA

Abstract

The present invention relates to the field of bioengineering, and specifically, to a biochip, a method for preparing the biochip, and a method for synthesizing DNA. The biochip comprises: an azido substrate; a DNA probe, wherein the probe is ssDNA, and its 5' end is modified with an alkynyl group; and the DNA probe is connected to the azido substrate through an azido and alkynyl addition reaction catalyzed by copper ions. The biochip and the preparation method provided by the present invention connect the probe and the substrate of the biochip through an azido click reaction, which can not only enhance the probe binding strength and keep the probe upright, but also reduce the non-specific binding of ssDNA to the glass slide, solve the technical problem that ssDNA is prone to lodging, and improve the efficiency of enzymatic DNA synthesis.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering, and in particular to a biochip, a method for preparing the biochip and a method for synthesizing DNA. Background Art

[0002] In recent years, synthetic biology has developed rapidly with the advancement of science and technology and the needs of public health, which has posed a very important challenge to the DNA synthesis technology that is the basis of synthetic biology. In some existing implementation schemes, DNA synthesis technology can use biological enzymes to catalyze the addition of single bases to the end of the DNA chain and perform multiple rounds of reactions to synthesize the target DNA chain. In this process, the DNA chain needs to be fixed on a solid surface and dissociated after the reaction is completed for subsequent reactions.

[0003] Enzymatic DNA synthesis has attracted much attention due to its advantages such as rapidity and large scale. Currently, solid-phase DNA synthesis is the main technical direction of enzymatic DNA synthesis. Therefore, biochips, as the fixed phase of DNA synthesis, have become the key technology of enzymatic DNA synthesis. DNA immobilization technology mainly fixes the probe on the support through covalent or non-covalent binding. The non-covalent immobilization method mainly uses hydrophobic interaction and electrostatic interaction, and the covalent immobilization method mainly produces covalent bonds through chemical reactions between functional groups.

[0004] The existing probe immobilization method mainly adopts the chemical reaction of aldehyde group and amino group to form Schiff base. Since aldehyde group is relatively active, it can react with aromatic amine, hydroxyl group, etc., causing ssDNA to fall over, affecting the efficiency of enzymatic DNA synthesis; and aldehyde glass slides have nonspecific adsorption phenomenon, resulting in a high error rate of DNA synthesis.

[0005] In view of this, this application is filed. Summary of the invention

[0006] The object of the present invention is to provide a biochip, a method for preparing the biochip and a method for synthesizing DNA, so as to solve at least one technical problem in the background technology.

[0007] Specifically, the first aspect of the present application provides a biochip, comprising:

[0008] Azide substrate,

[0009] A DNA probe, wherein the DNA probe is ssDNA, and the 5' end of the DNA probe is modified with an alkyne group;

[0010] The DNA probe is connected to the azido substrate through an addition reaction of azido and alkynyl catalyzed by copper ions.

[0011] Preferably, the probe sequence length is 40-60 nt.

[0012] Preferably, the DNA probe sequence has a thymine segment and a probe main segment from the 5' end to the 3' end.

[0013] Preferably, the method for preparing the azido substrate comprises the steps of:

[0014] Cleaning the slides: Clean the slides with 5-20% sodium hydroxide solution and acetone for 2-10 minutes;

[0015] Soaking slides: Soak in a mixed solution of concentrated sulfuric acid and hydrogen peroxide (V:V = 5-10:3) for 0.5-2 hours, clean with acetonitrile and blow dry;

[0016] Azide modification: Soak the dry glass slide in 1-5% triethoxypropylsilazide acetonitrile solution for 2-5 hours, wash with acetonitrile and blow dry, and heat in an oven at 80-150℃ for 0.5-2 hours.

[0017] Preferably, the method for preparing the azido substrate comprises the steps of:

[0018] Cleaning the slides: Clean the slides with 10% sodium hydroxide solution and acetone for 5 minutes in sequence;

[0019] Soaking slides: Soak in a mixture of concentrated sulfuric acid and hydrogen peroxide (V:V = 7:3) for 1 hour, rinse with acetonitrile and blow dry;

[0020] Azide modification: Soak the dried slides in a 3% triethoxypropylsilazide solution in acetonitrile for 4 hours, rinse with acetonitrile, blow dry, and heat in an oven at 110°C for 1 hour.

[0021] The second aspect of the present application provides a method for preparing a biochip as described in the first aspect of the present application, comprising the steps of:

[0022] The probe design step is a ssDNA probe with an alkyne modification at the 5' end;

[0023] In the probe fixing step, the probe is fixed on the surface of the azide substrate through an addition reaction of an azide group and an alkyne group catalyzed by copper ions.

[0024] Preferably, the probe sequence length is 40-60 nt.

[0025] Preferably, the probe sequence has a thymine segment and a probe main segment from the 5' end to the 3' end.

[0026] Preferably, the probe fixing step comprises:

[0027] A step of preparing a diluent, wherein the diluent comprises, by volume, 500-1000 parts of sodium chloride, 30-60 parts of copper sulfate, and 5-20 parts of ascorbic acid;

[0028] Probe dilution step: diluting the probe solution to 0.5-2 μM using a diluent to obtain a probe dilution solution;

[0029] In the probe fixation reaction step, 0.5-2 μl of the probe solution is spotted on the azido substrate at 70%-80% humidity and incubated overnight at room temperature in the dark.

[0030] Preferably, in the step of diluting the probe, 0.01% glycerol is added to evenly distribute the probe on the surface of the slide and reduce the volatilization of the spotting solution.

[0031] Preferably, the diluent comprises 600 parts of sodium chloride, 50 parts of copper sulfate, and 10 parts of ascorbic acid.

[0032] Preferably, in the step of diluting the probe:

[0033] The probe solution was obtained by dissolving the probe in enzyme-free water, with a final concentration of 10 μM.

[0034] Preferably, in the step of diluting the probe:

[0035] Dilute the probe solution to 1 μM using diluent.

[0036] Preferably, in the probe fixation reaction step:

[0037] Spot 1 μl of the probe solution on the azido substrate.

[0038] Preferably, the probe fixing step further comprises:

[0039] The substrate cleaning step uses a first cleaning solution, a second cleaning solution, and a third cleaning solution to clean the substrate in sequence.

[0040] Preferably, the first cleaning liquid is pure water at 30-50°C.

[0041] Preferably, the second cleaning solution is a 0.5-1.0 M sodium nitrite solution. More preferably, the second cleaning solution is a 0.7 M sodium nitrite solution.

[0042] Preferably, the third cleaning liquid is pure water at room temperature, wherein the room temperature is 20-25°C.

[0043] The third aspect of the present application provides a method for DNA synthesis, comprising the steps of:

[0044] a step of designing a primer, wherein the primer is ssDNA, has a CY3 fluorescent group at the 5' end, and its sequence has a complementary hybridization sequence with the DNA probe described in the first aspect of the present application;

[0045] The hybridization solution is prepared by volume: water, 1-2 parts; 30% formamide, 1-2 parts; 20× sodium hydrochloride citrate buffer (SSC buffer), 1-2 parts; 0.5% sodium dodecyl sulfate (SDS), 0.01-0.05 parts; 50× Denhardt buffer, 0.5-1 parts.

[0046] Hybridization reaction step: Use hybridization solution to dilute the primer to obtain a primer solution, and preheat it to 45-50°C and mix it thoroughly; place the prepared primer solution and the biochip as described in the first aspect of the present application under the following reaction conditions: heat at 90-110°C for 2-10min, cool to 20-40°C at 1-5°C / min, and react for 20-40min.

[0047] Synthesis reaction steps: Use cleaning solution to clean the biochip, and then perform DNA synthesis reaction after drying.

[0048] Preferably, the hybridization solution comprises, by volume: water, 1.8 parts; 30% formamide, 1.8 parts; 20× sodium hydrochloride citrate buffer (SSC buffer), 1.8 parts; 0.5% sodium dodecyl sulfate (SDS), 0.03 parts; 50× Denhardt buffer, 0.6 parts.

[0049] Preferably, the 50×Denhardt buffer, per 100 ml, comprises the following components:

[0050] 2% polysucrose 1g;

[0051] 2% polyvinylpyrrolidone 1g;

[0052] 2% BSA 1g;

[0053] Add water to make up to 100ml.

[0054] Preferably, in the step of cleaning the biochip with a cleaning solution, the cleaning solution comprises:

[0055] The fourth cleaning solution: comprising 1× sodium hydrochloride citrate buffer and 0.5% sodium dodecyl sulfate, the volume ratio of the two being 1:1;

[0056] Fifth cleaning solution: 0.05× sodium hydrochloride citrate buffer;

[0057] Sixth cleaning solution: 95% ethanol;

[0058] Wherein, the fourth cleaning liquid, the fifth cleaning liquid and the sixth cleaning liquid are used in sequence.

[0059] Preferably, the step of cleaning the biochip using a cleaning solution comprises the following steps:

[0060] Use the fourth cleaning solution to clean for 1-5 minutes; use the fifth cleaning solution to clean for 1-5 minutes; use the sixth cleaning solution to clean for 1-4 minutes.

[0061] Preferably, the DNA synthesis reaction comprises the steps of:

[0062] The enzyme reaction is carried out using TdT enzyme and dNTP with protected bases, and the protected bases are eluted using a deprotection solution. Multiple rounds of cycles are performed to achieve enzymatic synthesis of the target DNA sequence.

[0063] Compared with the prior art, the present invention has the following advantages:

[0064] The biochip and preparation method thereof provided by the present invention connect the probe and substrate of the biochip through an azide click reaction, which can not only enhance the probe binding strength and keep the probe upright, but also reduce the nonspecific binding of ssDNA to the glass slide, solve the technical problem that ssDNA is prone to lodging, and improve the efficiency of enzymatic DNA synthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 This is a fluorescence image of a glass slide modified with an azide group in some embodiments of the present application;

[0066] Figure 2 This is a fluorescence image after the azide group-modified glass slide is combined with a DNA probe and hybridized with a fluorescent probe in some embodiments of the present application;

[0067] Figure 3 This is a fluorescence image of the glass slide modified with azide groups and spotted with unmodified alkyne DNA in the comparative example of the present application. DETAILED DESCRIPTION

[0068] Exemplary embodiments will be described in detail herein, examples of which are shown in the accompanying drawings. When the following description refers to the drawings, the same numbers in different drawings represent the same or similar elements unless otherwise indicated. The implementations described in the following exemplary embodiments do not represent all implementations consistent with the present application. Instead, they are merely examples of devices and methods consistent with some aspects of the present application as detailed in the appended claims.

[0069] The terms used in this application are for the purpose of describing specific embodiments only and are not intended to limit this application. The singular forms of "a", "said" and "the" used in this application and the appended claims are also intended to include plural forms unless the context clearly indicates other meanings. It should also be understood that the term "and / or" used herein refers to and includes any or all possible combinations of one or more associated listed items.

[0070] The present application will be described in detail below through examples.

[0071] The existing probe immobilization method mainly adopts the chemical reaction of aldehyde group and amino group to form Schiff base. Since aldehyde group is relatively active, it can react with aromatic amine, hydroxyl group, etc., causing ssDNA to fall over, affecting the efficiency of enzymatic DNA synthesis; and aldehyde glass slides have nonspecific adsorption phenomenon, resulting in a high error rate of DNA synthesis.

[0072] In view of this, in order to solve the existing technical problems in the background technology, the inventive concept of the present application is to provide a biochip, including: an azido substrate; a DNA probe, wherein the probe is ssDNA (Single-Stranded DNA) and its 5' end is modified with an alkynyl group; wherein the DNA probe and the azido substrate are connected through an azido and alkynyl addition reaction catalyzed by copper ions.

[0073] According to the inventive concept, the probe and substrate of the biochip are connected through the azide click reaction, which can not only enhance the binding strength of the probe and keep the probe upright, but also reduce the nonspecific binding of ssDNA to the glass slide, solve the technical problem that ssDNA is prone to falling over, and improve the efficiency of enzymatic DNA synthesis.

[0074] In order to better understand the above technical solution, the above technical solution will be described in detail in combination with specific implementation methods. Those skilled in the art should also understand that the reaction time and component feeding involved in this application cannot be absolutely accurate in actual production or experimental processes, but are all within the allowable error range. For example, if you want to heat the sample for 30 minutes, the actual operation may be 1 second more or less than 1 second in 30 minutes; if you want to weigh 30g of sample, you may actually weigh 30.001g or 29.998g.

[0075] The following are specific embodiments of the present invention, and the embodiments are intended to further describe the present invention rather than to limit the present invention.

[0076] The reagents used in this application are usually commercially available without any description. The specific sources of the reagents are listed as follows:

[0077] SSC buffer: 20×SSC solution (pH 7.4) purchased from Coolaber, product number SL3030, diluted with ultrapure water to the corresponding concentration when used.

[0078] dNTPs with protected bases: purchased from Firebird Biomolecular Sciences.

[0079] TdT enzyme: can be selected from muTdT enzyme derived from mouse.

[0080] Those skilled in the art should understand that the above reagents are only provided as a reference for the source of reagents and do not limit the scope of protection of the present application. Unless otherwise specified, the above reagents are not the only choice.

[0081] Example 1. Preparation of Azide Substrate

[0082] The glass slide was first cleaned with 10% sodium hydroxide solution and acetone for 5 minutes respectively, then soaked in a mixed solution of concentrated sulfuric acid and hydrogen peroxide (V:V=7:3) for 1 hour, cleaned with acetonitrile, and dried with compressed air. The dried glass slide was soaked in a 3% triethoxypropylsilazide acetonitrile solution for 4 hours, cleaned with acetonitrile, dried with compressed air, and then heated in an oven at 110°C for 1 hour to obtain an azido substrate.

[0083] Its fluorescence image is as follows Figure 1 As shown, it is a display of the fluorescence background of the chip. It can be found that the fluorescence background of the azido substrate in this embodiment is very weak, which is conducive to comparison with the state after inoculation of the probe.

[0084] The azido substrate (or, the glass slide modified by azido-modified silane) obtained in this embodiment can be used in subsequent embodiments.

[0085] Example 2: Biochip and its preparation

[0086] S2.1 Design probe sequence:

[0087] In this embodiment, the design requirements of the probe include:

[0088] (1) A ssDNA chain with a total length of 40-60 nt;

[0089] (2) The 5' end of its DNA is modified with an alkyne group.

[0090] According to the above design requirements, the nucleotide sequence of the designed probe is as follows:

[0091] 5'-TTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3'-CHCH; (SEQ ID NO.1, the 3' end of which is modified by an alkynyl group)

[0092] Among them, the "TTTTTTTTTTT" segment (SEQ ID NO.2) is a thymine segment, and the "GGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG" (SEQ ID NO.3) is the probe body segment.

[0093] S2.2 Probe cross-linking to azidosilane-modified glass slides:

[0094] (1) Dissolve the designed probe in enzyme-free water to a final concentration of 10 μM to obtain an enzyme-free aqueous solution of the probe;

[0095] (2) preparing a diluent consisting of sodium chloride, copper sulfate, and sodium ascorbate in a mass ratio of 600:50:10, and diluting the enzyme-free aqueous solution of the probe to 1 μM to obtain a probe dilution;

[0096] (3) Spot 1 μl of the probe dilution on an azide-modified silane-modified glass slide at 75 ± 5% humidity and store overnight at room temperature away from light.

[0097] (4) The spotted azido-modified silane-modified glass slide is cleaned by first soaking it in 40°C hot water for 30 seconds; then cleaning it twice with 0.7M sodium nitrite solution, each time for 0.5 minutes; finally, cleaning it twice with room temperature ultrapure water, each time for 0.5 minutes, and drying it to obtain the biochip.

[0098] The biochip prepared in this embodiment includes:

[0099] Azide substrate,

[0100] A DNA probe, wherein the probe is ssDNA, and the 5' end of the probe is modified with an alkyne group;

[0101] The DNA probe is connected to the azido substrate through an addition reaction of azido and alkynyl catalyzed by copper ions.

[0102] S2.3 Fluorescence hybridization of biochip

[0103] S2.3.1 Primer design

[0104] In this embodiment, the design requirements of the primers include:

[0105] (1) ssDNA chain with a total length of 20-30 nt,

[0106] (2) The 5' end of its DNA is modified with the CY3 fluorescent group.

[0107] (3) It has a complementary hybridization sequence to the probe in Example 2.

[0108] According to the above design requirements, the nucleotide sequences of the designed primers are as follows:

[0109] 5'-TCAAGTCGCGTAGGAGTCTCTAGCC-3'-CY3, (SEQ ID NO. 4, whose 3' end is modified by CY3).

[0110] S2.3.2 Probe and primer hybridization

[0111] (1) Hybridization solution: water, 6 ml; 30% formamide, 1.8 ml; 6× sodium hydrochloride citrate buffer, 1.8 ml; 0.5% sodium dodecyl sulfate, 0.03 g; 5× Denhardt buffer, 0.6 ml;

[0112] Wherein, the 5×Denhardt buffer, per 100 ml, comprises the following components:

[0113] 2% polysucrose 0.1 g;

[0114] 2% polyvinylpyrrolidone 0.1g;

[0115] 2% BSA 0.1 g;

[0116] Add water to make up to 100ml.

[0117] (2) Preparation of cleaning solution:

[0118] The fourth cleaning solution: comprising sodium hydrochloride citrate buffer and 0.5% sodium dodecyl sulfate;

[0119] Fifth cleaning solution: 0.05× sodium hydrochloride citrate buffer;

[0120] Sixth cleaning solution: 95% ethanol;

[0121] (3) Use hybridization solution to dilute the primer chain to 0.5 μM, preheat to 45-50°C, and mix thoroughly to obtain a primer solution;

[0122] (4) Add the prepared primer solution and the azido substrate (biochip) prepared in Example 1 to the eight-tube strip, heat at 100°C for 5 min, cool to 30°C at 3°C / min, and react for 30 min;

[0123] (5) Use the fourth cleaning solution to clean for 3 minutes, the fifth cleaning solution to clean for 3 minutes, and the sixth cleaning solution to clean twice.

[0124] (6) After drying, the hybridized biochip is obtained and stored at 4°C for later use.

[0125] The fluorescence image after the probe and primer chain hybridize is as follows Figure 2 As shown in the figure, it can be found that the probe is well attached to the surface of the glass slide in the fluorescence image. Figure 1 The contrast forms a sharp contrast.

[0126] Example 3: Enzymatic DNA synthesis

[0127] S3.1 Enzymatic DNA synthesis

[0128] (1) Use TdT enzyme and dNTP with protected bases to perform enzyme reaction on the hybridized biochip. The enzyme reaction system is:

[0129]

[0130] The enzyme reaction conditions are 30°C and the reaction time is 5-10 min.

[0131] (2) Use a deprotection solution (0.7 M sodium nitrite solution) to elute the protected bases, and repeat multiple cycles to achieve enzymatic synthesis of the target DNA sequence.

[0132] Comparative Example 1

[0133] This comparative example is basically similar to Example 2, except that:

[0134] The 5' end of the DNA of the probe is not modified with an alkyne group.

[0135] The nucleotide sequence of the designed probe is as follows:

[0136] 5'-TTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3' (SEQ ID NO. 5).

[0137] After the probe was cross-linked with the azido substrate according to the experimental method of Example 2, the fluorescence results of the biochip were as follows: Figure 3 shown.

[0138] By comparing the experimental results of Example 2 with those of Comparative Example 1, it can be clearly observed that the DNA probe whose 5' end is not modified by the alkynyl group is hardly cross-linked with the azido substrate, so the biochip produces almost no fluorescence, proving the necessity of alkynyl modification and proving that the primary amino group on the probe will not cause nonspecific adsorption of the chip. In summary, the specific binding of the azide chip to the probe is caused by its unique chemical structure and properties. Therefore, the coupling of the azide chip to the probe is rapid, and less nonspecific binding is produced, which solves the problem of probe lodging caused by the aldehyde-based glass slides commonly used in the industry.

[0139] In addition, the connection reaction between the probe and the substrate in the present application is easy to occur, and there are few side reactions: Specifically, the copper-catalyzed azide-alkyne cycloaddition reaction rate is more than 100 times higher than the non-catalyzed 1,3-dipolar cycloaddition reaction, and it can react over a wide temperature range and is insensitive to water. The reaction can occur in the pH range of 4 to 12, and it has tolerance to many functional groups. Therefore, the reaction can occur at room temperature, reducing the occurrence of side reactions.

[0140] In summary, the biochip, biochip preparation method and DNA synthesis method provided in the embodiments of the present invention use an azide click reaction to connect the probe and substrate of the biochip, which can not only enhance the probe binding strength and keep the probe upright, but also reduce the nonspecific binding of ssDNA to the glass slide, solve the technical problem that ssDNA is prone to lodging, improve the efficiency of enzymatic DNA synthesis, and have good commercial prospects.

[0141] It should be pointed out that for ordinary technicians in this field, the technical features in the above embodiments can be freely combined, and the formed technical solutions also belong to the embodiments disclosed in this application.

[0142] Furthermore, without departing from the principles of the present application, several improvements and modifications may be made to the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.

Claims

1. A method for DNA synthesis, characterized in that: Applied to a biochip, the biochip comprising: Azide substrate, A DNA probe, wherein the DNA probe is ssDNA, and the 5' end of the DNA probe is modified with an alkyne group; Wherein, the DNA probe is connected to the azido substrate through an addition reaction of azido and alkyne groups catalyzed by copper ions; The DNA synthesis method comprises the steps of: a step of designing a primer, wherein the primer is ssDNA, has a CY3 fluorescent group at the 5' end, and its sequence has a complementary hybridization sequence with the DNA probe; The hybridization solution is prepared by volume, wherein the hybridization solution comprises: water, 4-8 parts; 30% formamide, 1-2 parts; 6× sodium hydrochloride citrate buffer, 1-2 parts; 0.5% sodium dodecyl sulfate, 0.01-0.05 parts; 5× Denhardt buffer, 0.5-1 parts; Hybridization reaction step: dilute the primer with hybridization solution to obtain a primer solution, preheat to 45-50°C, and mix thoroughly; place the prepared primer solution and the biochip under the following reaction conditions: heat at 90-110°C for 2-10min, cool to 20-40°C at 1-5°C / min, and react for 20-40min; Synthesis reaction steps: Use cleaning solution to clean the biochip, and then perform DNA synthesis reaction after drying.

2. The method for DNA synthesis according to claim 1, characterized in that: The DNA probe sequence has a thymine segment and a probe main segment in sequence from the 5' end to the 3' end.

3. The method for DNA synthesis according to claim 1, characterized in that: The method for preparing the azido substrate comprises the steps of: Cleaning the slides: Clean the slides with 5-20% sodium hydroxide solution and acetone for 2-10 minutes; Soak the slides: Soak in a mixed solution of concentrated sulfuric acid and hydrogen peroxide at a volume ratio of 5-10:3 for 0.5-2 hours, rinse with acetonitrile and blow dry; Azide modification: Soak the dry glass slide in 1-5% triethoxypropylsilazide acetonitrile solution for 2-5 hours, wash with acetonitrile and blow dry, and heat in an oven at 80-150℃ for 0.5-2 hours.

4. The method for DNA synthesis according to claim 1, characterized in that: In the step of using a cleaning solution to clean the biochip, the cleaning solution comprises: The fourth cleaning solution: comprising sodium hydrochloride citrate buffer and 0.5% sodium dodecyl sulfate; Fifth cleaning solution: 0.05× sodium hydrochloride citrate buffer; Sixth cleaning solution: 95% ethanol; Wherein, the fourth cleaning liquid, the fifth cleaning liquid and the sixth cleaning liquid are used in sequence.

5. The method for DNA synthesis according to claim 1, characterized in that: The DNA synthesis reaction comprises the steps of: The enzyme reaction is carried out using TdT enzyme and dNTP with protected bases, and the protected bases are eluted using a deprotection solution. Multiple rounds of cycles are performed to achieve enzymatic synthesis of the target DNA sequence.

Images