Application of cotton GhGG3 gene in regulation and control of compact plant type of cotton

Abstract

The invention relates to application of a cotton GhGG3 gene in regulation and control of compact plant types of cotton, the excellent characters of heterotrimer G protein gamma subunit GhGG3 participating in regulation and control of plant types, fruit branch length, boll spacing and the like are identified in cotton for the first time, and the gene has important value in theoretical research on analysis of molecular mechanisms formed by shortening of the fruit branch length and the boll spacing of cotton and the like. According to the invention, the cotton plant type can be changed to create a cotton breeding material with compact plant type, and the method has important practical application value for cotton plant type improvement.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of cotton GhGG3 gene in regulating the compact plant type of cotton. Background Art

[0002] Cotton is an important fiber crop and oil crop in the world, and one of the important cash crops in my country. It is not only an important source of natural fiber for the textile industry, but also has important uses in edible oil, national defense, medicine, and the automotive industry. It occupies an important position in the development of the national economy and is an important strategic material related to the national economy and people's livelihood. Plant type is an important agronomic trait of cotton. Cotton plant type determines the adaptability of cotton to cultivation, harvest index and potential yield, directly affects the light energy utilization efficiency of cotton plants and the final yield, and also has a great impact on planting costs and mechanized harvesting.

[0003] In order to achieve high-yield and efficient cultivation and management models, one of the important ways to promote early maturity and high yield of cotton is to cultivate high-density, evenly distributed, and uniform high-yield groups and make full use of light energy in the early and middle stages of cotton growth. On the other hand, the implementation of machine harvesting of cotton has become the only way for the sustainable development of the cotton planting industry. The selection and breeding of new cotton varieties suitable for machine harvesting needs to focus on plant type breeding on the basis of taking into account yield, quality, early maturity, resistance, etc., which shows the importance of plant type breeding.

[0004] The plant type of cotton is determined by the fruit branch type, internode length, and fruit branch angle. The factor that has the greatest impact on the plant type is the fruit branch type. The plant type of cotton can be evaluated using seven indicators: plant height, number of fruit branches, height of the first node of the fruit branch, length of the fruit branch, number of fruit branch nodes, angle of the fruit branch, and boll opening rate. The main way to increase the cotton planting density is to improve the cotton plant type, but it is very difficult to improve the cotton plant type using traditional breeding methods. However, with the rapid development of biotechnology, shortening the breeding cycle and directed genetic improvement have become possible. Mining genes related to plant type regulation and creating cotton materials with moderate plant height and compact plant type through genetic engineering technology is a fast and practical strategy to accelerate the breeding and improvement of cotton plant type. Summary of the invention

[0005] The purpose of the present invention is to provide an application of the cotton gene GhGG3 in regulating cotton plant type, thereby solving the problem encountered in the prior art in cultivating cotton varieties with compact plant type and suitable mechanical harvesting characteristics.

[0006] The present invention creates a GhGG3 loss-of-function mutant of upland cotton through CIRSPR-Cas9-mediated gene editing. Phenotypic investigation of different edited strains of mutants revealed that compared with the wild type, the mutants exhibited excellent traits such as compact plants, shortened internode length of the main stem, shortened length of fruit branches at different positions, and shortened spacing between bolls, but did not affect yield traits and main fiber quality traits, indicating that the gene or the protein it encodes plays an important role in controlling cotton plant type.

[0007] The present invention provides a GhGG3 gene for regulating a compact plant type of cotton, wherein the genomic nucleotide sequence thereof is shown in SEQ ID NO: 1, the CDS sequence thereof is shown in SEQ ID NO: 2, and the amino acid sequence encoded by the gene is shown in SEQ ID NO: 3. It should be understood that, considering the degeneracy of the gene expression regulatory region and the codons, the modification of the GhGG3 gene sequence without changing the amino acid sequence also falls within the protection scope of the present invention.

[0008] The present invention provides a GhGG3 gene, and use of an expression cassette, an expression vector or a recombinant microorganism containing the same in any one of the following A1) to A6):

[0009] A1) regulating cotton plant type;

[0010] A2) preparing a product for regulating cotton plant type;

[0011] A3) regulating the length of cotton fruit branches, the distance between fruit nodes, the plant width, the angle between fruit branches, the distance between main stems, and the average fiber length of the upper part;

[0012] A4) preparing products for regulating cotton fruit branch length, fruit node spacing, plant width, fruit branch angle, main stem spacing, and average fiber length in the upper half.

[0013] A5) Cultivate cotton varieties with compact plant types;

[0014] A6) Cotton breeding;

[0015] The amino acid sequence encoded by the gene is shown in SEQ ID NO:3.

[0016] Furthermore, the nucleotide sequence of the GhGG3 gene is shown in SEQ ID NO: 1, and the coding region sequence thereof is shown in SEQ ID NO: 2.

[0017] Furthermore, the GhGG3 gene in cotton was knocked out, causing the cotton to exhibit a compact plant phenotype.

[0018] Furthermore, using CRISPR / Cas9-mediated gene editing technology, a CRISPR / Cas9 gene editing vector of the GhGG3 gene was constructed and transformed into cotton plants, thereby obtaining cotton plants with stably inherited GhGG3 gene deletion.

[0019] Furthermore, the sgRNA sequence in the CRISPR / Cas9 gene editing vector is shown in SEQ ID NO:4 and / or SEQ ID NO:5.

[0020] Furthermore, the cotton exhibits a phenotype of shortened fruit branch length, shortened fruit node spacing, reduced plant width, smaller fruit branch angle, shortened main stem spacing, and increased average fiber length in the upper half.

[0021] The present invention also provides a method for cultivating a cotton variety with a compact plant type, wherein the GhGG3 gene in the cotton is knocked out, thereby making the cotton exhibit a compact plant type phenotype, and the amino acid sequence encoded by the GhGG3 gene is shown in SEQ ID NO:3.

[0022] Furthermore, the nucleotide sequence of the GhGG3 gene is shown in SEQ ID NO.1, and the coding region sequence is shown in SEQ ID NO:2.

[0023] Furthermore, using CRISPR / Cas9-mediated gene editing technology, a CRISPR / Cas9 gene editing vector of the GhGG3 gene was constructed and transformed into cotton plants, thereby obtaining cotton plants with stably inherited GhGG3 gene deletion.

[0024] Furthermore, the target sequence targeted by the CRISPR / Cas9 gene editing vector is shown in SEQ ID NO:4 and / or SEQ ID NO:5.

[0025] Beneficial effects of the present invention: The present invention first identified in cotton that the heterotrimeric G protein γ subunit GhGG3 is involved in regulating excellent traits such as cotton plant type, fruit branch length, and boll spacing. This gene has important value for theoretical research on the molecular mechanism of shortening cotton fruit branch length and boll spacing. The present invention can change the cotton plant type to create cotton breeding materials with compact plant type, and has important practical application value for cotton plant type improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0027] Figure 1 Schematic diagram of the GhGG3 gene structure and two gene editing sites, sgRNA1 and sgRNA2;

[0028] Figure 2 Effects of GhGG3 gene knockout on cotton plant traits. A: Compact plant phenotype of GhGG3 gene knockout strains; B: Sequencing results of GhGG3 gene knockout targets; C: Fruit branch length data of GhGG3 gene knockout strains; D: Fruit node length data of GhGG3 gene knockout strains. The length of fruit branches and fruit nodes of gene-edited plants are significantly shortened;

[0029] Figure 3 Effects of GhGG3 gene knockout on the spacing between cotton bolls; A: Phenotype diagram of cotton boll spacing between GhGG3 gene knockout strains and WT; B: Results of investigation on the spacing between cotton bolls in GhGG3 gene knockout strains, showing that the spacing between cotton bolls in GhGG3 knockout strains was significantly reduced compared with WT;

[0030] Figure 4 Plant structure phenotype of overexpressing GhGG3 gene. A: The plant structure of GhGG3 gene overexpressing strains had no significant changes compared with WT; B: The fruit branch length, plant width, fruit branch angle, main stem spacing and boll spacing of GhGG3 gene overexpressing strains were investigated and found to have no significant changes compared with WT. DETAILED DESCRIPTION

[0031] The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.

[0032] Example 1: Cloning of cotton GhGG3 gene

[0033] Based on the published GhGG3 gene sequence in the tetraploid upland cotton genome, primers were designed to isolate the gDNA sequence of the gene from the leaves of the recipient variety upland cotton Jin668. After amplification and sequencing and sequence alignment, the obtained sequence was 100% homologous to the sequence in the genome database. Cotton is an allotetraploid. The GhGG3 gene is located on chromosome A13 of upland cotton and contains 5 exons, 6 introns ( Figure 1). The genome nucleotide sequence is shown in SEQ ID NO:1, with a total length of 2829 bp; the GhGG3 gene nucleotide sequence is shown in SEQ ID NO:2, and the amino acid sequence encoded by it is shown in SEQ ID NO:3, with a cDNA total length of 1185 bp, encoding 394 amino acids.

[0034] Example 2: Designing two sgRNAs in the exon region of the GhGG3 gene to construct a gene editing vector

[0035] (1) Vector construction: The gene editing site was designed based on the genomic sequence (SEQ ID NO: 1) and CDS sequence (SEQ ID NO: 2) of GhGG3; the sgRNA1 of CRISPR / Cas9 was designed at the first exon thereof, and the sequence was: 5'TGATTTGTATGGGAAACGAA 3' (SEQ ID NO. 4); the sgRNA2 of CRISPR / Cas9 was designed at the second exon thereof (at the junction of intron and exon), and the sequence was: 5'CGAGCAGGAAGAGTTAAAAT 3' (SEQ ID NO: 5). The corresponding primers were designed according to the target sequence to construct the CRISPR vector of the GhGG3 gene. The specific primer sequences are as follows: cGG3-1as: 5'TTCGTTTCCCATACAAATCAtgcaccagccgggaat 3' (SEQ ID NO: 6); cGG3-1s: 5'TGATTTGTATGGGAAACGAAgttttagagctagaaata 3' (SEQ ID NO: 7); cGG3-2as: 5'ATTTTAACTCTTCCTGCTCGtgcaccagccgggaat 3' (SEQ ID NO: 8); inf cGG3-2as: 5'ttctagctctaaaacATTTTAACTCTTCCTGCTCG 3' (SEQ ID NO: 9).

[0036] First, the GhU6.7 promoter-driven GhGG3-gRNA sequence was obtained by Overlapping PCR (the lowercase part is the vector sequence; the underlined part is tRNA; the italic part is gRNA; the bold part is sgRNA):

[0037]

[0038] The vector was connected to pRGEB32-GhU6.7 with T4 DNA ligase, and the vector plasmid was transferred into Agrobacterium strain GV3101 by electroporation to obtain the knockout vector of GhGG3 gene.

[0039] (2) Agrobacterium-mediated genetic transformation of cotton:

[0040] A. Sterile seedling culture: Select seeds with full grains and normal development (variety Jin668), peel off the cottonseed seed coat, soak in 2% sodium hypochlorite solution for 10 minutes, then rinse with sterile water for more than 3 times, inoculate on sterile seedling culture medium, and insert the roots into the culture medium for support after the seeds turn white. Seal the culture medium and culture it in a dark incubator at 28℃ for 5-6 days.

[0041] B. Cut the hypocotyl into small segments (0.5-0.7 cm), infect with activated Agrobacterium containing GhGG3 knockout vector for 3-5 min, discard the bacterial solution, place in a sterile dish with filter paper and blow dry; spread the hypocotyl on the co-culture medium (MS medium + 2,4-D 0.1 mg / L + KT 0.1 mg / L + 30 g / L glucose + 2.6 g / L Phytagel, pH: 5.85-5.95) with filter paper, and culture in the dark in a constant temperature incubator at 20°C for 36-48 h;

[0042] C. Obtaining regenerated materials: The infected hypocotyls were inoculated into DK callus induction medium (MS medium + 2,4-D 0.1 mg / L + KT 0.1 mg / L + 30 g / L glucose + 2.6 g / L Phytagel + kanamycin 50 mg / L + cephalosporin 400 mg / L, pH: 5.85-5.95). Cultured in a light culture room at 28°C (16 h of light + 8 h of darkness), subcultured with fresh callus induction medium every 20-30 days.

[0043] D. When the callus tissue grows into rice-like particles, it is transferred to differentiation medium (MS medium + IBA 0.5 mg / L + KT0.1 mg / L + glutamine 1.0 g / L + asparagine 0.5 g / L + 30 g / L glucose + 2.6 g / L Phytagel, pH: 6.1-6.2) and further differentiated into embryoids.

[0044] E. The differentiated seedlings were subcultured to rooting medium (1 / 2MS medium + 15 g / L glucose + 2.6 g / L Hytagel, pH: 6.1-6.2) until they grew into well-rooted seedlings.

[0045] (3) Identification and phenotype of GhGG3 knockout offspring:

[0046] For the 12 independently transformed transgenic positive cotton lines obtained, DNA from leaves of T0 and T1 transgenic positive plants was extracted by CTAB method, and primers (SEQ ID NO.11: 5'-ggagtgagtacggtgtgcTTCGTCGGTCCCGACTCT-3'; SEQ ID NO.12: R: 5'-gagttggatgctggatggAGGAAACTAATTTCTCTTTCAAGCA-3') were designed to amplify the gene sequence of GhGG3 by PCR. The homozygous mutants of GhGG3 gene knockout GhGG3_KO-1 to KO-6 were screened by Hi-TOM technology sequencing, and field phenotypic identification was performed. After cotton was harvested, the fruit branch length, fruit node spacing and boll spacing of the above GhGG3 gene knockout lines GhGG3_KO-1 to KO-6, wild type Jin668 and negative control plants were measured and counted. The results are shown in Figure 2 and Figure 3 .Depend on Figure 2 It can be seen that the fruit branch length and internode distance of the GhGG3 knockout line were significantly lower than those of the wild type and negative control plants; Figure 3 This is the enlarged picture of the distance between cotton bolls and the trait investigation data of the GhGG3 knockout line. Figure 3 It can be seen that knocking out the GhGG3 gene significantly reduces the boll distance compared to WT. The main agronomic phenotypes of the three high-generation knockout lines were further investigated in the field. The results are shown in Table 1. The yield traits (single boll weight, lint percentage) and five fiber quality traits (i.e., average fiber length in the upper half, fiber uniformity, micronaire value, breaking strength, and elongation) investigated were not significantly different from the transgenic recipients except that the fruit branch length of the gene-edited plants was reduced and the average fiber length in the upper half was increased. This shows that the knockout of the GhGG3 gene can shorten the length of the cotton fruit branch in a targeted manner without affecting the yield and fiber quality traits of cotton.

[0047] Table 1 Main agronomic phenotypes of GhGG3 gene knockout plants

[0048]

[0049] Example 3: Overexpression of GhGG3 gene in cotton

[0050] (1) Construction of overexpression vector

[0051] A pair of primers (SEQ ID NO.13: GG3-BP-F: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGGCTGCCAGGTCCG G-3'; SEQ ID NO.14: GG3-BP-R: 5'-GGGGACCACTTTGTACAAGAAAGCT GGGTGTTAGAAAAATAGGCAGCAAGGATTA-3') were designed according to the coding sequence of the GhGG3 gene. The GhGG3 sequence in Jin668 was amplified with the primers, and the product was detected by agarose gel electrophoresis. The recovered target product was connected to the overexpression vector pK2GWT7, and the recombinant plasmid with correct sequencing was named pK2GWT7-GG3. The recombinant plasmid was transformed into GV3101 Agrobacterium competent cells and used to transform the cotton transgenic receptor Jin668.

[0052] (2) Genetic transformation

[0053] The genetic transformation method is the same as in Example 2.

[0054] (3) Identification and phenotype of GhGG3 overexpressing offspring

[0055] For the 10 independently transformed transgenic positive cotton lines obtained, DNA from leaves of T0 and T1 transgenic positive plants was extracted by CTAB method, and 35S promoter and GhGG3 gene sequences were amplified by PCR using primers (SEQ ID NO.13, SEQ ID NO.14). By Sanger sequencing, homozygous mutants GhGG3_OE-1 to OE-5 containing GhGG3 overexpression elements were screened for field phenotypic identification. After cotton harvest, the fruit branch length, boll spacing and other traits of GhGG3_OE-1 to OE-5 and wild-type Jin668 plants were measured and counted. The results are shown in Figure 4 .Depend on Figure 4 It can be seen that the fruit branch length, boll spacing and other traits of the strains overexpressing the GhGG3 gene did not change significantly compared with the wild-type control plants.

[0056] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. Use of the GhGG3 gene, an expression cassette, an expression vector or a recombinant microorganism containing the same in any of the following A1)-A6): A1) regulating cotton plant type; A2) preparing a product for regulating cotton plant type; A3) regulating the length of cotton fruit branches, the distance between fruit nodes, the plant width, the angle between fruit branches, the distance between main stems, and the average fiber length of the upper part; A4) preparing products for regulating cotton fruit branch length, fruit node spacing, plant width, fruit branch angle, main stem spacing, and average fiber length in the upper half; A5) Cultivate cotton varieties with compact plant types; A6) Cotton breeding; The amino acid sequence encoded by the gene is shown in SEQ ID NO:

3.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the GhGG3 gene is shown in SEQ ID NO: 1, and the coding region sequence thereof is shown in SEQ ID NO:

2.

3. The use according to any one of claims 1-2, characterized in that: Knocking out the GhGG3 gene in cotton will cause the cotton to exhibit a compact plant phenotype.

4. The use according to claim 3, characterized in that: Using CRISPR / Cas9-mediated gene editing technology, a CRISPR / Cas9 gene editing vector of the GhGG3 gene was constructed and transformed into cotton plants, thereby obtaining cotton plants with stably inherited GhGG3 gene deletion.

5. The use according to claim 4, characterized in that: The sgRNA sequence in the CRISPR / Cas9 gene editing vector is shown in SEQ ID NO:4 and / or SEQ ID NO:

5.

6. The use according to claim 3, characterized in that: The cotton exhibits a phenotype of shortened fruit branch length, shortened fruit node spacing, reduced plant width, smaller fruit branch angle, shortened main stem spacing, and increased average fiber length in the upper half.

7. A method for cultivating a cotton variety with a compact plant type, characterized in that: The GhGG3 gene in cotton is knocked out, thereby making the cotton show a compact plant phenotype. The amino acid sequence encoded by the GhGG3 gene is shown in SEQ ID NO:

3.

8. The method according to claim 7, characterized in that The nucleotide sequence of the GhGG3 gene is shown in SEQ ID NO.1, and the coding region sequence is shown in SEQ ID NO:

2.

9. The method according to any one of claims 6-7, characterized in that: Using CRISPR / Cas9-mediated gene editing technology, a CRISPR / Cas9 gene editing vector of the GhGG3 gene was constructed and transformed into cotton plants, thereby obtaining cotton plants with stably inherited GhGG3 gene deletion.

10. The method according to claim 9, characterized in that The target sequence of the CRISPR / Cas9 gene editing vector is shown in SEQ ID NO:4 and / or SEQ ID NO:5.

Images