Application of a SNP molecular marker associated with the oblique length trait of beef cattle at 6 months of age
By detecting the SNP molecular marker at site 71085551 on chromosome 3 in the beef cattle genome GCF_002263795.1_ARS-UCD1.2_genomic.fna, the problem of backward beef cattle breeding was solved, early and accurate screening of the oblique body length trait and breeding optimization of beef cattle were achieved, and the accuracy of beef cattle growth rate and muscle quality assessment was improved.
Patent Information
- Application Number
- CN202410679460.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-29
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2044-05-29
AI Technical Summary
The existing technology of beef cattle breeding is relatively backward, resulting in a gap between the beef cattle industry and other breeding powers in the world. In addition, the assessment of beef cattle growth rate and muscle quality is not accurate enough, affecting the production efficiency of beef cattle.
The SNP molecular marker at position 71085551 of chromosome 3 in the beef cattle genome GCF_002263795.1_ARS-UCD1.2_genomic.fna was used to detect the base type of beef cattle genomic DNA by PCR amplification and restriction endonuclease Mnl I digestion to determine the superiority of the oblique length trait in beef cattle at 6 months of age.
It achieves early and accurate screening of the oblique length trait of beef cattle, improves the efficiency of beef cattle breeding, shortens the breeding cycle, and improves the benefits of cattle farms.
Smart Images

Figure CN119265308B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular marker-assisted selection of beef cattle, and in particular to the application of a SNP molecular marker associated with the oblique length trait of 6-month-old beef cattle. Background Art
[0002] As a key pillar of my country's animal husbandry, the beef cattle industry boasts an output value of nearly 200 billion yuan, with cattle stocks accounting for 10% of the world's total. While my country is a major beef cattle producer, there is still a significant gap compared to other leading producers. One of the main reasons for this is the relatively backward selection and breeding of high-quality beef cattle breeds and insufficient development of genetic resources.
[0003] The body length of cattle, measured from the front edge of the shoulder blade to the ischial bone, is a key indicator of body conformation in beef cattle. It directly reflects the cattle's body length development and indirectly reflects the degree of muscle development. Longer body length generally indicates faster growth in the same period of time, potentially resulting in greater muscle mass and volume, which is beneficial for both meat yield and meat quality. Measuring body length in six-month-old beef cattle can assess growth rate and potential and inform breeding decisions. Therefore, studying and evaluating body length in six-month-old beef cattle can provide important guidance and insights for beef cattle production, helping to optimize growth performance and meat quality.
[0004] Marker-assisted breeding utilizes the close linkage between molecular markers and target trait genes. By detecting molecular markers, the presence of target genes can be detected, enabling selection for the desired trait. This approach is rapid, accurate, and unaffected by environmental factors. Single nucleotide polymorphisms (SNPs), a type of molecular marker, refer to changes in the DNA sequence caused by variations in a single nucleotide at the same position in the genome between individuals. These changes can subsequently affect gene expression, transcriptional activity, and splicing modifications. Beef cattle have a long growth cycle. Screening for genes associated with economic traits and genetic markers such as SNPs, combined with marker-assisted breeding methods for early selection of cattle, can accelerate the breeding process. Summary of the Invention
[0005] The purpose of the present invention is to provide a SNP molecular marker associated with the oblique elongation trait of beef cattle at 6 months of age, so as to provide guidance for the growth and meat production performance detection of beef cattle or molecular marker-assisted breeding.
[0006] The technical solutions of the present invention are as follows:
[0007] The present invention provides a beef cattle SNP molecular marker, which is located at the base of position 71085551 on chromosome 3 in the beef cattle genome GCF_002263795.1_ARS-UCD1.2_genomic.fna. The SNP site of the molecular marker has a G / A polymorphism and is named g.71085551G>A, wherein A is an unfavorable allele variation of the oblique length trait of beef cattle at 6 months of age.
[0008] Application of the beef cattle SNP molecular marker and the material for detecting the beef cattle SNP molecular marker in any of the following aspects:
[0009] Used to detect or assist in detecting the oblique length trait of beef cattle at 6 months old;
[0010] Used to improve the genetic breeding of oblique length traits in beef cattle at 6 months of age;
[0011] Preferably, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1.
[0012] In the present invention, the substance for detecting the SNP molecular marker of beef cattle includes PCR primers for amplifying genomic DNA fragments including the molecular marker SNP site, or a kit containing the primers.
[0013] Preferably, the nucleotide sequences of the primers are shown as SEQ ID NO.2 and SEQ ID NO.3.
[0014] Preferably, the kit further comprises a PCR amplification reagent, and / or an enzyme cleavage reagent, wherein the enzyme cleavage reagent comprises the restriction endonuclease MnlI.
[0015] The present invention also provides a method for detecting the oblique length trait of beef cattle at 6 months of age, comprising: detecting the base type at position 71085551 of chromosome 3 of the beef cattle genome, and the oblique length trait of the GG genotype and AG genotype groups at 6 months of age is longer than that of the AA genotype group.
[0016] Preferably, the method for detecting the base type at position 71085551 on chromosome 3 of the beef cattle genome includes: designing a primer set for amplifying the nucleotide sequence shown in SEQ ID NO.1, performing PCR amplification on beef cattle genomic DNA using the primer set, enzymatically digesting the obtained amplified product using the restriction endonuclease MnlI, subjecting the enzymatic digestion product to agarose gel electrophoresis, and determining the base type at position 71085551 on chromosome 3 of the beef cattle genome based on the electrophoresis bands: if the enzymatic digestion product is band 1, it is AA type, band 2 is GG type, and band 3 is AG type.
[0017] More preferably, the size of the enzyme digestion product with only one band is 461 bp, the sizes of the enzyme digestion product with two bands are 275 bp and 186 bp respectively, and the sizes of the enzyme digestion product with three bands are 461 bp, 275 bp and 186 bp respectively.
[0018] The present invention also provides a genetic breeding method for optimizing the oblique elongation trait of beef cattle at 6 months of age, comprising: determining the base type of position 71085551 on chromosome 3 of cattle in a core group of beef cattle, and making corresponding selections based on the base type:
[0019] In the successive breeding of breeding cattle, individuals with GG and AT bases at position 71085551 of chromosome 3 are selected, and AA individuals are eliminated to increase the frequency of gene G at this position from generation to generation, thereby optimizing the oblique length trait of the 6-month-old offspring beef cattle.
[0020] Preferably, the base at position 71085551 of the bovine chromosome 3 is shown as 196bp in the sequence shown in SEQ ID NO.1.
[0021] Beneficial effects of the present invention:
[0022] The present invention studies and determines SNP molecular markers that affect the oblique length trait of beef cattle at 6 months of age, and uses the molecular markers for early molecular marker-assisted selection, which can accelerate the beef cattle breeding process.
[0023] The present invention predicts the body plagioclase trait of beef cattle at 6 months of age by detecting the base type of the molecular marker SNP site. The body plagioclase trait of the GG and AG genotype groups at 6 months of age is longer than that of the AA genotype group. A primer set is used to amplify the molecular marker affecting the body plagioclase trait of beef cattle at 6 months of age. Using the molecular marker and primer set, an efficient and accurate molecular marker-assisted breeding technology for beef cattle is established. This technology is applied to beef cattle breeding, and can screen calves with excellent body plagioclase trait at 6 months of age and timely eliminate inferior calves, thereby reducing the breeding cycle and improving the breeding efficiency of cattle farms. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 These are the GWAS results for body length of 6-month-old beef cattle, where A is the Manhattan plot and B is the QQ plot.
[0025] Figure 2 These are the results of effect analysis on SNP molecular markers and the obliquely long phenotype of beef cattle at 6 months of age.
[0026] Figure 3 Agarose gel electrophoresis results of PCR amplification products.
[0027] Figure 4 The results of agarose gel electrophoresis of the enzyme digestion products are shown in Figure 2. DETAILED DESCRIPTION
[0028] The present invention performs whole-genome resequencing on beef cattle genomic DNA, aligns the resequencing data with a beef cattle reference genome (GCF_002263795.1_ARS-UCD1.2_genomic.fna), obtains all high-quality SNPs on the genome, and analyzes the correlation between each site and the body plagioclase trait of beef cattle at 6 months of age. A molecular marker associated with the body plagioclase trait of beef cattle at 6 months of age is obtained. The SNP molecular marker is located at the base 71085551 position on chromosome 3 of the cattle genome GCF_002263795.1_ARS-UCD1.2_genomic.fna. The SNP site of the molecular marker has a G / A polymorphism, wherein A is an unfavorable allele variation for the body plagioclase trait of beef cattle at 6 months of age.
[0029] The nucleotide sequence of the SNP molecular marker of the present invention is shown in SEQ ID NO: 1:
[0030] ATTATCTAGCAATCTGGGCTTGCATTTTATTAACATTTATTCTGAATAAATTCGTCTCTCAAATGTGAATTTGTTGAGCACCAGCAAAGATTCAATTTTTTTTTTTTTTTGCTGTCAATTGAGATGAAGCCTACTGTGATGAATTATTAGGACAATGAAAATTAAACAAGAGTGAAGGCTGTAATTTGAGAGNGAAATAAATCTGCAACTTGCAGAAAGAACAGTAGCT TGGAAGATTTATTCTCTCTTTTAAAGTCACCTGTCATAATATGGTAACGCTAGGCATCAGAATTTGAAAGATGGCTTCAAAATCTCCTTATTGACAATATTTCTAAGTGGCCAACTTTTCATGTGCCACCGTGTGGGGGTGGGGGGAGCTTGCTGCCTGTCTTTTATCTTTGCCATGATTTGAAGGAGACGTTTATAATAATTAATAACTGAGAAGGTAGGTTGCTTTG (SEQ ID NO.1).
[0031] In the sequence SEQ ID NO.1, the base 196 has a G / A polymorphism, which is significantly correlated with the body oblique length of beef cattle at 6 months of age. The body oblique length of individuals with AA genotype at 6 months of age is extremely significantly lower than that of GG genotype (P<0.01), and the body oblique length of individuals with AA genotype at 6 months of age is significantly lower than that of individuals with AG genotype (P<0.05).
[0032] In the present invention, if the base at position 196 of the molecular marker nucleotide sequence mutates from G to A, it cannot be recognized and cut by the restriction endonuclease Mnl I. If no mutation occurs, it can be cut by Mnl I.
[0033] The present invention provides substances for detecting the SNP molecular marker described in beef cattle, including PCR primers for amplifying genomic DNA fragments including the SNP site of the molecular marker, or a kit containing the primers. The primer set for amplifying the SNP molecular marker described in the present invention includes an upstream primer F: 5'-ATTATCTAGCAATCTGGG-3' (SEQ ID NO. 2) and a downstream primer R: 5'-CAAAGCAACCTACCTTCT-3' (SEQ ID NO. 3). The kit also includes a PCR amplification reagent and / or an enzyme digestion reagent, wherein the enzyme digestion reagent includes the restriction endonuclease Mnl I.
[0034] In the present invention, the PCR amplification reagent is preferably 2×Taq FastMaster Mix, which is a mixture of TaqDNA polymerase, dNTP mixture, MgCl2 and reaction buffer pre-prepared into a 2-fold concentration and then optimized in proportion, and has good amplification efficiency and high detection sensitivity.
[0035] The above primer set was used to perform PCR amplification on beef cattle genomic DNA. As an embodiment, the PCR amplification procedure is 98°C for 45 seconds; 98°C for 10 seconds, 55°C for 30 seconds, 72°C for 1 minute, 35 cycles; 72°C for 5 minutes; and 12°C for 1 minute. The obtained amplified product was digested with the restriction endonuclease Mnl I and subjected to electrophoresis. If neither DNA double strand has mutated, the electrophoresis result will be two bands (GG type: 275 bp, 186 bp); if only one DNA single strand has mutated, the electrophoresis result will be three bands (AG type: 461 bp, 275 bp, 186 bp); if both DNA double strands have mutated, they cannot be cut by Mnl I, and the electrophoresis result will be a single band (AA type: 461 bp).
[0036] The criteria for judging the quality of the oblique length of beef cattle at 6 months of age are:
[0037] If the enzyme digestion product is one band, it is AA type, and the body length of the 6-month-old cattle is poor;
[0038] If the enzyme digestion product is 2 bands, it is GG type, and the body length of the cattle is best at 6 months old;
[0039] If the enzyme digestion product is 3 bands, it is AG type. The cow is 6 months old and has a medium body length.
[0040] The present invention uses restriction endonuclease Mn1 I to digest the target fragment amplified by the primer set. By detecting the number of bands after the digestion, the genotype of the cattle can be determined, thereby achieving the purpose of determining the quality of the plagioclase trait of beef cattle at 6 months of age. The detection of the plagioclase trait of beef cattle at 6 months of age and the optimization of the genetic breeding of the plagioclase trait of beef cattle at 6 months of age can be carried out.
[0041] The SNP molecular marker of the present invention can be applied to the association analysis of genotypes related to body lengthening or body lengthening traits related to 6-month-old beef cattle, providing a new molecular marker resource for molecular marker-assisted selection of growth and meat production performance of beef cattle.
[0042] The technical solution of the present invention will be described in more detail below with reference to the embodiments and accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0043] The reagents and consumables used in the present invention are all common commercial products and can be purchased from the market.
[0044] The following uses Charolais cattle as an example to illustrate the technical solutions of the present invention, but this does not limit the technical solutions of the present invention. Those skilled in the art can apply the technical solutions of the present invention to other beef cattle breeds to detect and optimize breeding for the oblique elongation trait in six-month-old beef cattle, which also falls within the scope of protection of the present invention.
[0045] Example 1
[0046] Screening of molecular markers associated with body length in 6-month-old beef cattle
[0047] (1) Charolais cattle phenotypic data collection
[0048] A total of 240 Charolais cattle born between 2013 and 2023 were selected as research subjects, and the body length trait data of the Charolais cattle group at 6 months of age were collected.
[0049] (2) Charolais cattle sample collection and genomic DNA preparation
[0050] A 5 mL blood sample was collected from the jugular vein of Charolais cattle using a veterinary lancet and placed in an EDTA anticoagulant tube and stored at 4°C. After extracting leukocytes from Charolais blood samples, genomic DNA was extracted using the Beijing Tianmo DNA extraction kit according to the manufacturer's instructions. After passing quality inspection, the sample was stored in a -80°C freezer.
[0051] (3) Whole genome resequencing and SNPs detection and filtering
[0052] DNA that passed quality control was sent to the BGI platform for whole-genome resequencing at a depth of 10× to obtain raw data. The raw data were filtered using Fastp software using the following criteria: reads with adapters; reads with a certain percentage of N (N indicates undetermined base information) (the default is 5 bp); reads containing more than 40% low-quality bases (quality value ≤ 20); and read quality trimming using a 4 bp sliding window size and trimming reads with an average quality value below 20. After quality control, clean reads were obtained. Clean reads were aligned to the beef cattle reference genome (GCF_002263795.1_ARS-UCD1.2_genomic.fna) using BWA software. A BAM file containing the initial alignment was generated and sorted using Samtools software, with duplicate reads marked using Picard. Then, the GATK4.2.0.0 software toolkit was used to detect SNPs sites, and the Plink software was used to filter the SNP sites (geno 0.1--maf0.05--hwe 1e-06). Finally, Beagle version 5.4 software was used for genotype filling, and finally 4,088,633 high-quality SNPs were obtained for subsequent analysis.
[0053] (4) GWAS analysis
[0054] The FarmCPU model was used to combine the phenotypic values of the 6-month-old Charolais cattle with the SNPs loci for GWAS analysis using rMVP software, and the Manhattan plot and QQ plot were generated ( Figure 1 ). Using P = 2.44E-07 as the threshold for significant SNP sites, we obtained SNPs sites that were significantly associated with the oblique length trait of Charolais cattle at 6 months of age.
[0055] Example 2
[0056] SNPs variant site effect analysis
[0057] Based on the significant SNP sites and sample genotype information obtained from the GWAS analysis, the beef cattle population in step (1) of Example 1 was grouped, and individuals with the same genotype were divided into the same group. The phenotypic values of each group were counted, and the mean and standard deviation were calculated. The effect size of each SNP site mutation on the corresponding phenotype was then analyzed using GraphPadPrism 8 and plotted ( Figure 2 ).
[0058] The results of effect analysis showed that the mutation at site 71085551 on chromosome 3 of the beef cattle genome GCF_002263795.1_ARS-UCD1.2_genomic.fna could reduce the body skew length of Charolais cattle at 6 months of age. The body skew length of the homozygous mutant AA genotype at 6 months of age was significantly lower than that of the wild GG genotype (P<0.01), indicating that AA is an unfavorable allele for this trait.
[0059] Example 3
[0060] PCR-RFLP genotyping, the specific steps are as follows:
[0061] 1) The gene sequence containing the SNP site was found in the cattle genome database using the NCBI website, and the region extending 1000 bp upstream and downstream of the SNP site was selected as a template, and a specific amplification primer set was designed using Primer5 software.
[0062] 2) Collect blood samples from Charolais cattle to be tested, extract leukocytes from the blood samples, and use the Beijing Tianmo DNA extraction kit according to the kit instructions to extract genomic DNA from the samples. The samples that pass the quality inspection will be used for the next step of SNP typing.
[0063] 3) Using the extracted whole-genomic DNA as a template, amplify the DNA sequence containing the SNP marker by PCR using the primers described in Table 1. The PCR program was 35 cycles of 98°C for 45 s, 98°C for 10 s, 55°C for 30 s, 72°C for 1 min, 72°C for 5 min, and 12°C for 1 min. The PCR system is shown in Table 2.
[0064] Table 1 Primer sets and restriction enzymes used in PCR-RFLP
[0065]
[0066] Table 2 PCR reaction system
[0067]
[0068]
[0069] 3) The PCR amplification product was detected using 2% agarose gel electrophoresis at 100 V and 120 mA. After a single band appeared and the size was consistent with the expected value, subsequent SNP enzyme digestion and typing were performed.
[0070] 4) Digest the PCR amplification product with the restriction endonuclease Mnl I (New England Biolabs). Prepare the enzyme digestion system shown in Table 3 and incubate at 37°C for 20 minutes.
[0071] Table 3 Enzyme digestion reaction system
[0072]
[0073] 5) After the enzyme digestion is completed, the above enzyme digestion products are detected using 2% agarose gel electrophoresis under the conditions of 100V, 120mA.
[0074] 6) According to the enzyme typing results ( Figure 3-4 ) to determine the quality of the body plagioclase length trait of six-month-old Charolais cattle and thus select breeding individuals. The judgment criteria are: if the enzyme digestion product shows one band, it is AA type, and the six-month-old Charolais cattle have poor body plagioclase length; if the enzyme digestion product shows two bands, it is GG type, and the six-month-old Charolais cattle have the best body plagioclase length; if the enzyme digestion product shows three bands, it is AG type, and the six-month-old Charolais cattle have medium body plagioclase length.
[0075] In summary, the SNP molecular markers associated with the oblique body length trait of beef cattle at 6 months of age provided by the present invention can be used to identify the oblique body length trait of beef cattle at 6 months of age according to genotype, thereby achieving early selection and accelerating the breeding process.
[0076] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. A method for detecting SNP molecular markers in beef cattle, wherein: Used to detect the oblique length trait of beef cattle at 6 months old; Used to improve the genetic breeding of oblique length traits in beef cattle at 6 months of age; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the base at position 196 of SEQ ID NO.1 has a G / A polymorphism, wherein A is an unfavorable allele variation for the oblique length trait of beef cattle at 6 months of age; The beef cattle are Charolais cattle.
2. The use according to claim 1, characterized in that The substance for detecting the beef cattle SNP molecular marker comprises a PCR primer for amplifying a genomic DNA fragment including the molecular marker SNP site, or a kit containing the primer.
3. The use according to claim 2, characterized in that The nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.
3.
4. The use according to claim 2 or 3, characterized in that The kit also includes a PCR amplification reagent and / or an enzyme cleavage reagent, wherein the enzyme cleavage reagent includes a restriction endonuclease Mnl I.
5. A method for detecting the oblique length trait of beef cattle at 6 months of age, characterized in that: The base type of position 71085551 on chromosome 3 of the beef cattle genome was detected. The base at position 71085551 on chromosome 3 of the cattle was shown at 196 bp in the sequence shown in SEQ ID NO.
1. The GG genotype and AG genotype groups had a longer body oblique length trait at 6 months of age than the AA genotype group. The beef cattle were Charolais cattle.
6. The method according to claim 5, characterized in that The method for detecting the base type of position 71085551 of chromosome 3 of the beef cattle genome comprises: designing a primer set for amplifying the nucleotide sequence shown in SEQ ID NO.1, wherein the nucleotide sequence of the primer set is shown in SEQ ID NO.2 and SEQ ID NO.3, performing PCR amplification on the beef cattle genomic DNA using the primer set, and using restriction endonucleases Mnl I. The obtained amplified product is digested with enzymes, and the digested product is subjected to agarose gel electrophoresis. The base type of the 71085551 position of chromosome 3 of the beef cattle genome is determined according to the electrophoresis bands: the digested product has 1 band of AA type, 2 bands of GG type, and 3 bands of AG type.
7. The method according to claim 6, characterized in that The size of the enzyme digestion product with only one band is 461 bp, the sizes of the enzyme digestion product with two bands are 275 bp and 186 bp respectively, and the sizes of the enzyme digestion product with three bands are 461 bp, 275 bp and 186 bp respectively.
8. A genetic breeding method for optimizing the oblique length trait of beef cattle at 6 months of age, characterized in that: Determine the base type of position 71085551 of chromosome 3 of cattle in the core group of beef cattle, where the base at position 71085551 of chromosome 3 of cattle is represented by bp 196 in the sequence shown in SEQ ID NO. 1, and make corresponding selections based on the base type: In the successive breeding of cattle, individuals with GG and AG bases at position 71085551 of chromosome 3 are selected, and individuals with AA bases are eliminated to increase the frequency of gene G at this position generation by generation, thereby optimizing the oblique length trait of the offspring beef cattle at 6 months of age; The beef cattle are Charolais cattle.
Citation Information
Patent Citations
SNP molecular marker related to buffalo growth traits and application of SNP molecular marker
CN113308554A