A primer set for a microsatellite marker HA223 associated with growth in Hippocampus inflatus and its application
By designing the primer set of microsatellite labeled HA223 related to the growth of the bulging hippocampus, individuals with specific fragments were screened using PCR amplification and capillary electrophoresis technology, the problem of differences in the growth rate of the bulging hippocampus was solved, and the rapid breeding of high growth rates was achieved, and breeding efficiency was improved.
Patent Information
- Application Number
- CN202411651811.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-19
- Publication Date
- 2025-05-06
- Estimated Expiration
- 2044-11-19
AI Technical Summary
During the breeding of bulging hippocampus, there are differences in the growth rate of the same group of hippocampus individuals, and there is a lack of effective molecular marking methods to assist in the selection and breeding of rapidly growing lines.
Primers sets of microsatellite labeled HA223 related to bloated hippocampus growth were designed and provided, and individuals with specific fragments were screened through PCR amplification and capillary electrophoresis to breed progeny with faster growth rates.
Efficient screening and breeding of growth traits of bloated hippocampus has been achieved, breeding years have been shortened, breeding process has been accelerated, and breeding efficiency has been improved.
Smart Images
Figure CN119265317B_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of fish DNA marker technology and application, and specifically involves a primer set of a microsatellite marker HA223 related to the growth of Hippocampus inflatus and its application. Background Art
[0002] The puffy seahorse is a special marine aquaculture fish introduced to my country in recent years. It has high nutritional and medicinal value. In the actual production and breeding process, the same batch of seahorses showed different specifications, that is, within the same breeding cycle, the growth rate of the same batch of seahorses was different. The average weight of the fast-growing seahorses at one month old was 0.260g heavier than the slow-growing seahorses, and the average body length was 2.533cm. The breeding growth rate of seahorses has a significant impact on improving the enthusiasm of farmers and promoting the development of the puffy seahorse breeding industry. Growth is an important economic and technical indicator. Breeding a fast-growing puffy seahorse strain can effectively shorten the breeding cycle, reduce breeding costs, and increase breeding income.
[0003] Molecular marker-assisted breeding is the direct selection and breeding of individuals with alleles or genotypes that have trait advantages by means of molecular markers that are closely related to the trait. Compared with traditional breeding methods, molecular marker-assisted selection has a large amount of information, is not easily affected by the environment, has a high selection intensity, and has high selection efficiency and accuracy. Among the common molecular marker technologies, microsatellite molecular markers (simple sequence repeats, SSR) are widely and randomly distributed in the genome, have the advantages of co-dominant inheritance, high polymorphism, good stability and simple operation, and have been widely used in aquatic animal breeding research.
[0004] Using molecular markers to assist in the breeding of fast-growing seahorses is an important way to reduce costs and improve economic benefits. Currently, the screening of seahorse SSR markers is mainly focused on variety identification, and there are few studies on growth. There are no reports on molecular markers for seahorse growth traits at home and abroad. Summary of the invention
[0005] The technical problem to be solved by the present invention is to provide a primer set of a microsatellite marker HA223 related to the growth of hippocampus distended and its application.
[0006] The present invention is achieved through the following technical solutions:
[0007] A primer set for a microsatellite marker HA223 associated with the growth of hippocampus bulging, wherein the sequence of the forward primer in the primer set is ACTTCCGCAGAATGAAAGCC (SEQ ID NO.1), and the sequence of the reverse primer is ACGTGGTTGCACTCACACA (SEQ ID NO.2) 。
[0008] The present invention also provides the application of the primer set in the selection of growth traits of Hippocampus inflatus. The application method is to use the primer set to perform PCR amplification on the DNA of Hippocampus inflatus individuals, screen individuals that can amplify a specific fragment with a size of 260bp as basic parents, produce heterozygous individuals or homozygous individuals with the fragment, and the offspring have a faster growth rate.
[0009] Furthermore, the PCR reaction system was 50 μL: 1 μL DNA solution, 1 μL upstream primer, 1 μL downstream primer, 25 μL 2×HS Taq PreMix (TORO IVD), and 22 μL sterile double distilled water.
[0010] Furthermore, the PCR amplification reaction conditions were: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; and extension at 72°C for 10 min.
[0011] The beneficial effects of the present invention compared with the prior art are as follows:
[0012] The present invention obtains molecular markers related to the growth of Hippocampus inflatus for the first time, and uses the primer set to be applied in the breeding of growth traits of Hippocampus inflatus for the breeding of fast-growing varieties. Compared with conventional breeding methods, this method can shorten the breeding period, speed up the breeding process, and improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0013] Figure 1 Banding of microsatellite markers in group F and group S (mixed pool population) electropherogram and peak diagram;
[0014] Figure 2 Electropherograms of the band distribution of microsatellite markers in groups F and S (all individuals);
[0015] Figure 3 Electrophoresis of amplification bands of HA223 in a mixed pool of DNA from 46 full-sib families;
[0016] Figure 4 Electrophoresis of the amplified band pattern of HA223 in 30 individuals of family A03. DETAILED DESCRIPTION
[0017] The technical scheme of the present invention is further explained below by examples in combination with the accompanying drawings, but the protection scope of the present invention is not limited in any form by the examples. Unless otherwise specified, the experimental methods used in the examples are conventional methods and techniques well known to those skilled in the art, and the materials and reagents are all purchased commercially.
[0018] Example 1
[0019] 1. Acquisition of materials related to the growth traits of Hippocampus bulging
[0020] The experimental seahorses came from Weihai Yinze Biotechnology Co., Ltd. About 10,000 seahorse fry (body length 1.6±0.2cm, weight 0.008±0.002g) produced on the same day were placed in the same breeding pond for 30 days. During the experiment, they were fed normally, and the water temperature was maintained at 18±0.5℃, salinity 30ppt, and dissolved oxygen>6.0mg / L. After the experiment, they stopped feeding for 24h, and 1,000 seahorses were randomly picked from the breeding pond, and their growth indicators were measured. The weight of each seahorse was recorded, and 60 seahorses with a weight greater than 0.2g and 60 seahorses with a weight less than 0.1g were taken.
[0021] After the measurement, the hippocampus samples were placed in anhydrous ethanol and frozen in a -80°C refrigerator for later use. 60 tails with fast growth rate were selected as the fast growth rate group (F group), and 60 tails with slow growth rate were selected as the slow growth rate group (S group). The T test was used to verify whether there was a significant difference between the two groups.
[0022] 2. Microsatellite primers
[0023] According to the genome data of Hippocampus inflatus (https: / / ngdc.cncb.ac.cn / gwh / Ass embly / 18745 / show), the microsatellite identification tool MISA was used to search for microsatellite loci, and 95 microsatellite loci were selected. Primers were designed according to their flanking conserved sequences. The primers were synthesized by Shanghai Bioengineering Co., Ltd.
[0024] 3. Extraction and detection of genomic DNA
[0025] The Tiangen marine animal DNA extraction kit was used to extract DNA from 60 tails of Hippocampus inflatus F and S groups. The quality and integrity of the extracted DNA were determined by 1% agarose gel electrophoresis, and the concentration was determined by UV spectrophotometer. The DNA was diluted to 50 ng / μL with double distilled water and stored at -80℃ for later use.
[0026] 4. Establishment of BSA gene pool
[0027] The 30 samples with the fastest growth rate in group F were selected, and an equal amount of 5 μL of DNA solution was taken from each sample to form a fast-growing gene pool (F pool). Similarly, the 30 samples with the slowest growth rate in group S were selected, and an equal amount of 5 μL of DNA solution was taken from each sample to form a slow-growing gene pool (S pool).
[0028] 5. Microsatellite marker screening
[0029] 95 pairs of microsatellite primers were used to perform PCR amplification on two DNA pools. PCR reaction system: 1 μL DNA solution, 1 μL upstream primer, 1 μL downstream primer, 25 μL 2×HS Taq PreMix (TOROIVD), and 22 μL sterilized double distilled water. PCR amplification reaction conditions: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, reaction at the actual annealing temperature of each pair of primers for 30 s, 72°C extension for 30 s, a total of 35 cycles; 72°C extension for 10 min.
[0030] The PCR products were analyzed by FragmentAnalyzer TM The electrophoresis was performed using a fully automated capillary electrophoresis system, with a sample volume of 2 μL, a constant voltage of 6 kV, and electrophoresis for 1 h. After the electrophoresis, the results were analyzed using ProSize data analysis software. By analyzing the PCR amplification of DNA from the two gene pools, a microsatellite locus that could amplify differential allele fragments in the two pools was preliminarily screened, such as Figure 1 shown.
[0031] 6. Preliminary verification of microsatellite markers
[0032] Using the technical means in step 4 (PCR amplification and capillary electrophoresis), the differential bands of a microsatellite marker in group F and group S were analyzed, and the frequency of the differential bands was tested by Pearson test, and finally a microsatellite marker HA223 with significant differences was obtained. Forward primer: ACTTCCGCAGAATGAAAGCC (SEQ ID NO.1), reverse primer: ACGTGGTTGCACTCACACA (SEQ ID NO.2).
[0033] like Figure 2 As shown in Table 1, the frequency of the 260bp fragment of the marker in the F group was 21, and the frequency in the S group was 46. Pearson correlation analysis showed that the fragment was significantly negatively correlated with the growth of hippocampus distensis, and the specific statistical data and correlation analysis results are shown in Table 1;
[0034] Table 1 Statistics of the occurrence of HA223 allele fragments in individual amplified band patterns
[0035]
[0036]
[0037] 7. Family individual re-verification
[0038] The primers of microsatellite locus HA223 were used to amplify the pooled DNA of 46 families by PCR, and capillary gel electrophoresis was performed. The results showed that 260 bp bands of HA223 locus appeared in 41 families ( Figure 3 ), select one family with significant growth difference from these 41 families, take 15 fastest growing samples (F group) and 15 slowest growing samples (S group) from this family, perform SSR differential band analysis on all individuals in the family, and count the amplification of 260bp differential alleles in the F group and S group in the family ( Figure 4 ), the results are shown in Table 2. After Pearson's test, there was a significant negative correlation between the differential alleles of family A03 and the growth traits (P<0.05), which further verified that the microsatellite locus HA223 was significantly correlated with the growth traits of Hippocampus inflatus;
[0039] Table 2 Statistics of the occurrence of HA233 allele fragments in the amplified band patterns of individuals in family A03
[0040]
[0041] Example 2: Application of microsatellite markers for growth traits in the selection of high growth rate strains of hippocampus bulging
[0042] Before strengthening the broodstock, part of the dorsal fin of the candidate parent was clipped, fixed and stored at low temperature in 95% anhydrous ethanol for extraction of genomic DNA. The extraction and detection of DNA, the PCR and capillary electrophoresis process, and the analysis of the electrophoresis results are as described in Example 1. Individuals without 260bp were selected as basic parents to construct a core breeding group, and the offspring produced were collected for cultivation. 1,000 seahorses were randomly picked up regularly every month for weight measurement, and the measurement was repeated 5 times in a row. The weight of the offspring of the ordinary breeding group of the same period was measured in the same way. The results showed that under the same breeding and management conditions, the offspring of the core breeding group of parents without the 260bp band were always heavier than the offspring of the ordinary group at different developmental stages, and had a faster growth rate. The results are shown in Table 3;
[0043] Table 3 Mean body weight of offspring in the core breeding group and the common breeding group at different developmental stages
[0044]
Claims
1. The application of the primer set in the breeding of growth traits of hippocampus bulging, characterized in that: The DNA of Hippocampus inflatus individuals was amplified by PCR using a primer set, and individuals that could amplify a specific fragment of 260 bp in size were selected as basic parents to produce heterozygous or homozygous individuals having the fragment. The sequence of the primer set is shown in SEQ ID NO.1-2.
2. The use according to claim 1, characterized in that: The PCR reaction system is 50 μL: 1 μL DNA solution, 1 μL upstream primer, 1 μL downstream primer, 25 μL 2× HS Taq PreMix, and 22 μL sterilized double distilled water.
3. The use according to claim 2, characterized in that: The PCR amplification reaction conditions were as follows: pre-denaturation at 94° C. for 5 min; denaturation at 94° C. for 30 s, annealing at 56° C. for 30 s, and extension at 72° C. for 30 s, for a total of 35 cycles; and extension at 72° C. for 10 min.