Male molecular marker primers of Odontobutis sinensis and their applications

Abstract

The present invention discloses male molecular marker primers of Odontobutis sinensis and their applications. The male molecular marker primers of Odontobutis sinensis are primer STLM2 or primer STLM9. The primer STLM2 includes upstream primer STLM2_F2 and downstream primer STLM2_R2. The primer STLM9 includes upstream primer STLM9_F2 and downstream primer STLM9_R2. The male molecular markers STLM2.2 or STLM9.2 of Odontobutis sinensis and a method for sex identification of Odontobutis sinensis are also disclosed, as well as the applications of the primers or the method in sex identification of Odontobutis sinensis. These primers have good specificity and can quickly and accurately identify the sex of Odontobutis sinensis, breaking through the technical bottleneck that the sex of early fry of Odontobutis sinensis cannot be identified. The primers and method of the present invention have important scientific research value and practical application value for sex determination and sex control of Odontobutis sinensis.

Description

Technical Field

[0001] The present invention belongs to the technical field of sex identification of Odontobutis sinensis, and particularly relates to a male molecular marker primer for Odontobutis sinensis and its application. Background Art

[0002] Odontobutis sinensis belongs to Perciformes, Odontobutidae, and Odontobutis. Odontobutis sinensis is widely distributed in vast waters such as Hubei, Jiangxi, and Hunan in the middle and upper reaches of the Yangtze River and Guangdong and Guangxi in the Pearl River system. It has a high meat content, delicious meat, has a nourishing effect, and has a relatively high market price. It is a precious economic fish.

[0003] However, male and female individuals of Odontobutis sinensis cannot be identified by morphology at the embryonic and juvenile stages, which brings great difficulties to the study of gonadal differentiation and the cultivation of single-sex fry of Odontobutis sinensis, and also greatly restricts the development of the industry of this species. So far, there has been no report on molecular marker primers that can successfully identify the genetic sex of Odontobutis sinensis at home and abroad. Therefore, developing a molecular marker primer for accurately identifying genetic sex has great production application value in the single-sex breeding of Odontobutis sinensis. Summary of the Invention

[0004] The first object of the present invention is to provide a male molecular marker primer for Odontobutis sinensis.

[0005] The second object of the present invention is to provide a method for sex identification of Odontobutis sinensis.

[0006] The third object of the present invention is to provide the application of the primer in the sex identification of Odontobutis sinensis.

[0007] The above first object of the present invention can be achieved by the following technical solution: A male molecular marker primer for Odontobutis sinensis, the male molecular marker primer for Odontobutis sinensis is primer STLM2 or primer STLM9, the primer STLM2 includes upstream primer STLM2_F2 and downstream primer STLM2_R2, the primer STLM9 includes upstream primer STLM9_F2 and downstream primer STLM9_R2, the nucleotide sequence of the upstream primer STLM2_F2 is as shown in SEQ ID NO: 1, the nucleotide sequence of the downstream primer STLM2_R2 is as shown in SEQ ID NO: 2, the nucleotide sequence of the upstream primer STLM9_F2 is as shown in SEQ ID NO: 3, and the nucleotide sequence of the downstream primer STLM9_R2 is as shown in SEQ ID NO: 4.

[0008] Specifically, the nucleotide sequence of primer STLM2 is as follows:

[0009] Forward primer STLM2_F2: 5’-ATGTATGTATGCCAGTGAG -3’ (as shown in SEQ ID NO: 1);

[0010] Reverse primer STLM2_R2: 5’-CCATGTGAAAGGGCTCAAT-3’ (as shown in SEQ ID NO: 2);

[0011] Specifically, the nucleotide sequence of primer STLM9 is as follows:

[0012] Forward primer STLM9_F2: 5’-CTTGAATGTCCCTGGAGTC -3’ (as shown in SEQ ID NO: 3);

[0013] Reverse primer STLM9_R2: 5’-CCTTTGAAATAGCCCGTAC -3’ (as shown in SEQ ID NO: 4).

[0014] The second object of the present invention can be achieved by the following technical solution: A method for sex identification of Odontobutis sinensis, comprising the following steps:

[0015] Step (1): Extract the genomic DNA of the Odontobutis sinensis to be tested;

[0016] Step (2): Using the genomic DNA extracted in step (1) as a template, perform PCR amplification with the primer STLM2 or primer STLM9. After the amplification reaction, perform electrophoresis detection. If the electrophoresis result shows that the amplification product has specific DNA bands, the tested Odontobutis sinensis DNA sample is a male Odontobutis sinensis; if the electrophoresis result shows that the amplification product does not have specific DNA bands, the tested Odontobutis sinensis DNA sample is a female Odontobutis sinensis.

[0017] In the above method for sex identification of Odontobutis sinensis:

[0018] Preferably, the PCR reaction system used in the PCR amplification in step (2) is: 2×Taq MasterMix 10 μL, 0.8 μL of the forward primer STLM2_F2 or STLM9_F2 with a concentration of 10 μM, 0.8 μL of the reverse primer STLM2_R2 or STLM9_R2 with a concentration of 10 μM, ddH 2 O 7.4 μL, genomic DNA 1 μL, for a total of 20 μL.

[0019] Preferably, the PCR reaction program used in the PCR amplification in step (2) is: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 sec, 30 cycles, and extension at 72°C for 5 min.

[0020] Preferably, in step (2), PCR amplification is carried out using the primer STLM2. After the amplification reaction, electrophoresis detection is performed. If the electrophoresis result shows that the amplification product has a specific DNA band at 237 bp, the detected Odontobutis sinensis DNA sample is a male Odontobutis sinensis; in step (2), PCR amplification is carried out using the primer STLM9. After the amplification reaction, electrophoresis detection is performed. If the electrophoresis result shows that the amplification product has a specific DNA band at 435 bp, the detected Odontobutis sinensis DNA sample is a male Odontobutis sinensis.

[0021] The above third object of the present invention can be achieved by the following technical solution: the application of the primer in the sex identification of Odontobutis sinensis.

[0022] Therefore, the successful development of the male molecular marker primer for Odontobutis sinensis in the present invention breaks through the technical bottleneck of the genetic sex identification of Odontobutis sinensis, provides a tool for the genetic sex control of Odontobutis sinensis. The application of this technology can realize the sex identification of Odontobutis sinensis fry at the early stage of hatching, improve the cultivation efficiency, reduce the cost, and promote the research work on sex determination and sex control of Odontobutis sinensis.

[0023] Compared with the prior art, the present invention has the following advantages:

[0024] (1) Based on the genome sequencing data of male and female Odontobutis sinensis, the present invention uses methods such as genome assembly, alignment, and in-depth analysis to accurately screen out the male molecular sequences of Odontobutis sinensis, and for the first time designs primers for male molecular markers for identifying the sex of Odontobutis sinensis, which can quickly and accurately identify the sex of Odontobutis sinensis;

[0025] (2) The primer for male molecular markers of Odontobutis sinensis designed in the present invention has good specificity. Using any one of a pair of specific primer pairs to complete a PCR reaction can identify the genetic sex of Odontobutis sinensis, which takes a short time, has high efficiency, and saves resources;

[0026] (3) The method of the present invention realizes the accurate identification of the genetic sex of Odontobutis sinensis fry, breaking through the technical bottleneck that the sex of Odontobutis sinensis fry cannot be identified at an early stage;

[0027] (4) The primer and method of the present invention have important scientific research value and practical application value for the sex determination and sex control of Odontobutis sinensis. Description of the Drawings

[0028] Figure 1 Electrophoresis diagram of PCR products detected in male and female individuals (16 tails) of primer STLM2 in Example 2;

[0029] Figure 2 Electrophoresis diagram of PCR products detected in male and female individuals (16 tails) of primer STLM9 in Example 2;

[0030] Figure 3 Electrophoresis diagram of PCR products detected in male and female individuals (32 tails) of primer STLM2 in Example 3;

[0031] Figure 4 Electrophoresis diagram of PCR products detected in male and female individuals (32 tails) of primer STLM9 in Example 3. Detailed implementation mode

[0032] The technical solutions of the present invention will be described in detail below in conjunction with specific embodiments, so that those skilled in the art can better understand and implement the technical solutions of the present invention. The following embodiments and drawings are only for illustrative purposes and should not be construed as limiting the present invention. The reagents or materials used in the embodiments are all from commercial channels unless otherwise specified. Unless otherwise specified, the experimental instruments used are all conventional laboratory instruments.

[0033] Example 1

[0034] The male molecular marker primer of Odontobutis sinensis provided in this embodiment, the male molecular marker primer of Odontobutis sinensis is primer STLM2 or primer STLM9, the primer STLM2 includes upstream primer STLM2_F2 and downstream primer STLM2_R2, the primer STLM9 includes upstream primer STLM9_F2 and downstream primer STLM9_R2, the nucleotide sequence of the upstream primer STLM2_F2 is as shown in SEQ ID NO: 1, the nucleotide sequence of the downstream primer STLM2_R2 is as shown in SEQ ID NO: 2, the nucleotide sequence of the upstream primer STLM9_F2 is as shown in SEQ ID NO: 3, and the nucleotide sequence of the downstream primer STLM9_R2 is as shown in SEQ ID NO: 4.

[0035] Specifically, the nucleotide sequence of primer STLM2 is as follows:

[0036] Upstream primer STLM2_F2: 5'-ATGTATGTATGCCAGTGAG -3' (as shown in SEQ ID NO: 1);

[0037] Downstream primer STLM2_R2: 5'-CCATGTGAAAGGGCTCAAT-3' (as shown in SEQ ID NO: 2);

[0038] Specifically, the nucleotide sequence of primer STLM9 is as follows:

[0039] Forward primer STLM9_F2: 5'-CTTGAATGTCCCTGGAGTC-3' (shown as SEQ ID NO: 3);

[0040] Reverse primer STLM9_R2: 5'-CCTTTGAAATAGCCCGTAC-3' (shown as SEQ ID NO: 4).

[0041] The molecular marker primer for male Odontobutis sinensis provided in this example is designed as follows:

[0042] (1) Method overview

[0043] For the molecular marker of male Odontobutis sinensis in this example, a whole-genome high-throughput sequencing strategy is used, combined with genome assembly technology, paired-end sequencing data fine alignment technology, and characteristic sequence detection technology to identify sex-specific markers. Through genome assembly, female and male genome sequences are obtained respectively. According to the sequence alignment results, the sequence characteristics between female and male genome sequences are analyzed, and the genome sequences associated with sex are detected, analyzed, and identified. Further, sex-specific primers are designed based on the sex-specific sequences screened from the high-throughput sequencing data analysis results. The sex-specific primers show different PCR characteristics in female and male samples. For species with XY sex determination mechanism, it shows that there are target bands in male samples and no target bands in female samples.

[0044] (2) Technical route

[0045] Specifically, it includes:

[0046] Based on the whole-genome sequencing data of 3 female samples of Odontobutis sinensis with known sex (STL-F1, STL-F4, STL-F8) and 3 male samples of Odontobutis sinensis (STL-M1, STL-M8, STL-M9), it is initially determined whether the species to be studied belongs to the genetic sex determination mechanism (GSD) or the environmental sex determination mechanism (ESD). This part includes the de novo assembly of female and male genomes and the comparison between female genome sequences and male genome sequences.

[0047] If female-specific genomic DNA sequences and male-specific genomic DNA sequences are detected, it is initially determined as the genetic sex determination mechanism (GSD), and further determined whether it belongs to the XY sex determination mechanism or the ZW sex determination mechanism. This step is determined by combining the sex-specific gene sequences obtained from sequencing analysis and the results of PCR experiments.

[0048] Based on the verification results of the previous step, collect female and male samples in batches to verify the reliability of sex-specific molecular markers in a larger range. If it belongs to the XY sex determination mechanism, for the collected female samples, extract DNA, mix them in equal amounts and then sequence to remove false-positive Y-specific sequences; if it belongs to the ZW type, correspondingly select male samples for mixed sequencing to remove false-positive W-specific sequences.

[0049] According to the sequencing data of the mixed samples, further screen and confirm Y / W-specific sequences.

[0050] Assemble the XY and ZW chromosome sequences to obtain sex chromosomes.

[0051] (3)Analysis steps

[0052] (3.1)Quality control of sequencing data:

[0053] The Illumina high-throughput sequencing results initially exist as raw image data files and are converted into raw sequencing sequences (Raw Reads) after base calling by the CASAVA software. The raw sequencing sequences obtained by sequencing will contain sequencing adapter sequences and low-quality sequences. To ensure the quality of information analysis data, the raw sequences are filtered to obtain high-quality Clean Reads, and all subsequent analyses are based on Clean Reads. The raw sequencing data is filtered using the fastp 0.23.2 software, and the filtering parameters are: -q 20 -l 150, and other parameters are default.

[0054] (3.2)Genome assessment:

[0055] Genome size evaluation is performed using jellyfish (version: 2.3.0, https: / / github.com / gmarcais / Jellyfish) and GenomeScope2 (version: 2.0, https: / / github.com / tbenavi1 / genomescope2.0). Among them, jellyfish is used for kmer distribution statistics, with the K value set to 21, and GenomeScope2 is used for genome size evaluation, with the parameter settings for diploid and the K value set to 21.

[0056] Genome evaluation: In this study, the predicted genome size of the female data was 838,759,995 - 871,597,817 bp, with the proportion of unique sequences being 61.2% and the proportion of repetitive sequences being 38.8%. The heterozygosity was 0.438%. The predicted genome size of the male data was 1,078,176,779 - 1,093,806,426 bp, with the proportion of unique sequences being 47.9% and the proportion of repetitive sequences being 52.1%. The heterozygosity was 0.377%. The Kmer distribution maps of the female and male genomes in this study both showed a single peak similar to a normal distribution, without obvious heterozygous peaks and repetitive peaks, suggesting a common diploid species.

[0057] (3.3) Genome assembly:

[0058] The genome sequence was assembled using the SOAP Denovo2 (version 2.04) genome assembly software. A multi-Kmer assembly strategy was adopted. According to the overlap relationship and Pair-End relationship of the sequencing data, the sequencing data was assembled into scaffold sequences, and the scaffold sequences were used as the reference genome sequences for subsequent analysis after GapCloser (version 1.12).

[0059] The female genome (Female) was assembled using the STL-F1 sequencing data; the male genome (Male) was assembled using the STL-M1 sequencing data.

[0060] (3.4) Alignment of sequencing reads:

[0061] The sequence alignment was performed using the bwa (0.7.17-r1188) sequence alignment software. The paired-end sequencing sequences of the female samples and the paired-end sequencing sequences of the male samples were respectively aligned to the female and male reference genomes. The mem alignment method and default parameters were used for the alignment. The SAMtools (1.14) software was used to sort the alignment results with the sort parameter to obtain the aligned bam file. To improve the alignment accuracy, the SAMtools (1.14) view program was used with the -bF 12 parameter to screen the paired-end aligned sequencing reads for subsequent analysis.

[0062] (3.5) Detection of sex-specific sequences:

[0063] A. Detection of male-specific sequences:

[0064] According to the filtered paired-end sequence alignment results, under the condition of the male reference genome, sequences that were covered by all male samples but not covered by any female sample and the female pool sample were screened as male-specific sequences.

[0065] B. Detection of female-specific sequences:

[0066] According to the filtered results of paired-end sequence alignment, sequences that are covered by all female samples but not covered by any male sample are counted as female-specific sequences under the condition of the female reference genome.

[0067] In the first round, the sequencing data of 3 male samples and 3 female samples were analyzed. A certain number of female-specific sequences and male-specific sequences were detected in the first round.

[0068] In the results of the first-round screening, significantly more male-specific sequences than female-specific sequences were found. It is speculated that Odontobutis obscura has an XY sex determination mechanism. Based on the results of the first-round verification, in the second round, 1 additional female pool data (mixed from the sequencing data of 14 female individuals) was added to re-screen the male-specific sequences to remove false-positive specific sequences.

[0069] There may be some invalid specific sequences among the specific sequences after two rounds of screening, such as repetitive sequences, sequences with a relatively large proportion of N bases, etc. Such sequences are prone to assembly errors and cannot be verified by subsequent experiments, and are defined as invalid specific sequences. Such sequences will be manually excluded. After several rounds of screening, the specific sequences are shown in Table 1 below, and the length distribution table of sex-specific sequences is shown in Table 2 below:

[0070] Table 1 Information of sex-specific sequences

[0071]

[0072] Note: Sequence Type: Sequence type (Male: Male-specific sequence, Female: Female-specific sequence); SeqNum: Number of sequences; Total length(nt): Total length of the assembled sequence; Max length(nt): Maximum sequence length; Min length(nt): Minimum sequence length; Average length(nt): Average sequence length.

[0073] Table 2 Length distribution table of sex-specific sequences

[0074]

[0075] (3.6) Annotation of specific sequences:

[0076] BLASTN 2.15.0+ and BLASTX 2.15.0+ were respectively used to align the male-specific sequences with the nt database (nt, Nucleotide collection) and nr database (nr, Non-redundant protein sequences) of NCBI for annotation.

[0077] Finally, two molecular markers, STLM2.2 or STLM9.2, were obtained from male Odontobutis sinensis after final screening.

[0078] Specifically, the nucleotide sequence of the molecular marker STLM2.2 is as follows:

[0079] ATGTATGTATGCCAGTGAG CCTCCGAAAACTAATTTCCTCATGCTAATGCATGACAATAAAGATTCTTGATATTGCTTGAGAAAATTAAGGTTGCTTGAGAAGGAAAATTCTTCTCACAGAAGGAGCGCTCCCAGCCTTCACTACGAGCCTTTTGCCATGCCTGAGGAAAAAGAAAAATGTCAGTATATTTTACAGCAAAAAACATTGCACATTCAGC AT TGAGCCCTTTCACATGG (as shown in SEQ ID NO: 5);

[0080] Note: The underlined parts correspond to the sequences of the upstream primer and the complementary sequence of the downstream primer, respectively.

[0081] Specifically, the nucleotide sequence of the molecular marker STLM9.2 is as follows:

[0082] CTTGAATGTCCCTGGAGTC CGACTGAGTTGTGGTGTTAGTAACCGATGTGTTTGTAGGTTGACGTTGTAATCTTTGGGGTAACGGAGGCGGTCTCTGGGGTAACGGGGGTGGTATCTGCTGTGTGTCGGTGGCAGAGGAGACCATCAAAGGAGCTGGAATACCCGTAGGTTGGTGTGAGAGTGGTGAAGAGATCCGCGTCCGAGACGTGGTCGGTGTAGGAACCCTCTGGGAGTGTGGTGTAGTGGCCACATTATGTGAAGCAGCTGTGTCGAGGATCCGTTGGAGTGGGGGTTCGTTCTGTTGACCATCTATACTATCCCTCTTCCCGGGTACGAGCGCCAGGGCGGTCTGAATTTCGGTCCTGGTCAGTTCCAAAGTCCGTTGCGTAATGCGCGTAAAATTACGCACAGCCCAA GTACGGGCTATTTCAAAGG (as shown in SEQ ID NO: 6);

[0083] Note: The underlined parts correspond to the sequences of the upstream primer and the complementary sequence of the downstream primer, respectively.

[0084] (3.7) Primer design:

[0085] Based on the analysis results of high-throughput sequencing data, the sex-specific sequences were screened out, and the PCR verification primers were designed using the Primer3 version 4.1.0 software (https: / / bioinfo.ut.ee / primer3-0.4.0 / ). The sex-specific primers showed different PCR characteristics in female and male samples. For species with the XY sex determination mechanism, the performance was as follows: there were target bands in male samples, and no target bands in female samples.

[0086] The information of the designed primers is shown in Table 3 below:

[0087] Table 3 Primer Information

[0088] 。

[0089] Example 2

[0090] Using the primers in Example 1, the sex of Odontobutis sinensis was identified as follows:

[0091] 1. Sample information

[0092] There were 8 male and 8 female samples of Odontobutis sinensis for verification, a total of 16 samples. The sample information is shown in Table 4 below:

[0093] Table 4 Information of Batch Verification Samples

[0094]

[0095] 2. Genomic DNA extraction

[0096] The genomic DNA was extracted using the Universal Column Genomic DNA Extraction Kit (Product number: CW2298M) from Jiangsu Kangwei Century Technology Co., Ltd. The extraction method can be found in the kit instruction manual.

[0097] 3. PCR amplification

[0098] 3.1 Reagents and consumables

[0099] DNA polymerase: 2×Taq MasterMix (Dye) (purchased from Jiangsu Kangwei Century Technology Co., Ltd., product number: CW0682L); sample templates are shown in Table 4; primers are shown in Table 3; RNase free water.

[0100] 3.2 PCR reaction system

[0101] The PCR reaction system is shown in Table 5 below, and the PCR reaction conditions are shown in Table 6 below:

[0102] Table 5 PCR reaction system

[0103]

[0104] Table 6 PCR reaction conditions

[0105] 。

[0106] 4. Agarose gel diagram

[0107] Gel concentration: Gel concentration 1% (wt), voltage 180 V, time 30 min;

[0108] Marker: M is DM2000, purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd., product number CW0632M;

[0109] DM2000 DNA Marker is composed of 6 DNA fragments, namely 2,000 bp, 1,000 bp, 750 bp, 500 bp, 250 bp and 100 bp. Take 3 μL for direct electrophoresis. During electrophoresis, the amount of 750 bp DNA fragment is about 90 ng, showing a bright band, and the amount of DNA of other bands is about 30 ng.

[0110] Agarose gel diagrams of 8 male samples and 8 female samples using primer STLM2 are as Figure 1 shown.

[0111] Agarose gel diagrams of 8 male samples and 8 female samples using primer STLM9 are as Figure 2 shown.

[0112] Figure 1 and Figure 2 The lane numbers in are the same as the sample numbers in Table 4, and the primer numbers correspond to Table 3.

[0113] From Figure 1 it can be seen that using primer STLM2 for PCR amplification, after the amplification reaction, electrophoresis detection is carried out. The electrophoresis results of 8 male samples show that the amplified product has a specific DNA band at 237 bp, so the detected Chinese sleeper DNA sample is a male Chinese sleeper, while the electrophoresis results of 8 female samples show that the amplified product does not have a specific DNA band at 237 bp, so the detected Chinese sleeper DNA sample is a female Chinese sleeper.

[0114] From Figure 2It can be seen that primer STLM9 was used for PCR amplification. After the amplification reaction, electrophoresis detection was carried out. The electrophoresis results of 8 male samples showed that the amplified product had a specific DNA band at 435 bp, indicating that the detected DNA samples of Odontobutis sinensis were male Odontobutis sinensis. The electrophoresis results of 8 female samples showed that the amplified product did not have a specific DNA band at 435 bp, indicating that the detected DNA samples of Odontobutis sinensis were female Odontobutis sinensis.

[0115] 5. Result Statistics and Description

[0116] The PCR conditions using primer STLM2 are summarized in Table 7 below, and the PCR conditions using primer STLM9 are summarized in Table 8 below:

[0117] Table 7 Summary of PCR Conditions Using Primer STLM2

[0118]

[0119] Note: In the fourth column of Table 7, 1 represents male and 0 represents female.

[0120] Table 8 Summary of PCR Conditions Using Primer STLM9

[0121]

[0122] Note: In the fourth column of Table 8, 1 represents male and 0 represents female.

[0123] As can be seen from Table 7 and Table 8, the identification results of the 2 pairs of specific primers for male molecular markers screened this time are consistent with the physiological genders of the respective samples. The 2 pairs of specific primers for male molecular markers screened this time can all achieve the purpose of identifying the genders of male and female Odontobutis sinensis. Further, the above primers can be made into kits or biological agents for use in the identification of the gender of Odontobutis sinensis.

[0124] Example 3

[0125] Sixteen males and sixteen females were used to further verify the gender identification of Odontobutis sinensis. The method was the same as in Example 2, and the results are as Figures 3 - 4 shown. It can be seen from Figure 3 that primer STLM2 was used for PCR amplification. After the amplification reaction, electrophoresis detection was carried out. The electrophoresis results of 16 male Odontobutis sinensis showed that the amplified product had a specific DNA band at 237 bp, while the electrophoresis results of 16 female Odontobutis sinensis showed that the amplified product did not have a specific DNA band at 237 bp; from Figure 4It can be seen that primer STLM9 was used for PCR amplification. After the amplification reaction, electrophoresis detection was carried out. The electrophoresis results of 16 male Odontobutis sinensis showed that the amplified product had a specific DNA band at 435 bp, while the electrophoresis results of 16 female Odontobutis sinensis showed that the amplified product did not have a specific DNA band at 435 bp.

[0126] The above embodiments are only used to illustrate the present invention, and the protection scope of the present invention is not limited to the above embodiments. Those of ordinary skill in the art can achieve the purpose of the present invention based on the content disclosed above. Any improvements and deformations made on the basis of the concept of the present invention fall within the protection scope of the present invention. The specific protection scope shall be subject to the claims.

Claims

1. A male molecular marker primer for Channa sinensis, characterized in that: The male molecular marker primer of Chinese sand snakehead is primer STLM2 or primer STLM9, the primer STLM2 includes upstream primer STLM2_F2 and downstream primer STLM2_R2, the primer STLM9 includes upstream primer STLM9_F2 and downstream primer STLM9_R2, the nucleotide sequence of the upstream primer STLM2_F2 is shown in SEQ ID NO: 1, the nucleotide sequence of the downstream primer STLM2_R2 is shown in SEQ ID NO: 2, the nucleotide sequence of the upstream primer STLM9_F2 is shown in SEQ ID NO: 3, and the nucleotide sequence of the downstream primer STLM9_R2 is shown in SEQ ID NO:

4.

2. A method for identifying the sex of Channa sinensis, characterized in that: The following steps are involved: Step (1): extracting genomic DNA of the tested Channa sinensis; Step (2): using the genomic DNA extracted in step (1) as a template, using the primer STLM2 or the primer STLM9 described in claim 1 to perform PCR amplification, and performing electrophoresis detection after the amplification reaction is completed. If the electrophoresis result shows that the amplified product has a specific DNA band, then the detected Chinese sand channandra DNA sample is a male Chinese sand channandra; if the electrophoresis result shows that the amplified product does not have a specific DNA band, then the detected Chinese sand channandra DNA sample is a female Chinese sand channandra.

3. The method for sex identification of Channa sinensis according to claim 2, characterized in that: The PCR reaction system used in step (2) for PCR amplification is: 2×Taq MasterMix 10 μL, upstream primer STLM2_F2 or STLM9_F2 0.8 μL at a concentration of 10 μM, downstream primer STLM2_R2 or STLM9_R2 0.8 μL at a concentration of 10 μM, ddH2O 7.4 μL, genomic DNA 1 μL, a total of 20 μL.

4. The method for sex identification of Channa sinensis according to claim 2, characterized in that: The PCR reaction program used in step (2) of PCR amplification is: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 sec, 30 cycles, and extension at 72°C for 5 min.

5. The method for sex identification of Channa sinensis according to claim 2, characterized in that: In step (2), the primer STLM2 is used for PCR amplification, and after the amplification reaction is completed, electrophoresis detection is performed, and the electrophoresis result shows that the amplification product has a specific DNA band at 237 bp, then the detected Chinese sand channandra DNA sample is a male Chinese sand channandra; in step (2), the primer STLM9 is used for PCR amplification, and after the amplification reaction is completed, electrophoresis detection is performed, and the electrophoresis result shows that the amplification product has a specific DNA band at 435 bp, then the detected Chinese sand channandra DNA sample is a male Chinese sand channandra.

6. Use of the primers described in claim 1 in sex identification of Channa sinensis.

Images