SNP molecular marker related to low-oxygen tolerance trait of rice and application thereof

By discovering and verifying SNP molecular markers on rice chromosome 12, the problem of difficulty in breeding rice germination flood tolerance traits in existing technologies has been solved. This has enabled efficient identification and improvement of low-oxygen tolerance traits in rice breeding, thereby increasing the yield and stability of direct-seeded rice.

CN119265347BActive Publication Date: 2026-05-15HANGZHOU NORMAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HANGZHOU NORMAL UNIVERSITY
Filing Date
2024-11-20
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently breed rice varieties with good germination and flood tolerance, which affects the yield and stability of direct-seeded rice, and there is a lack of effective molecular marker-assisted selection methods.

Method used

This study provides a molecular marker of a SNP on rice chromosome 12 that is significantly associated with the hypoxia germination trait in rice, along with its specific primers. The SNP site (A/G variation at exon 25740898 bp of the LOC_Os12g41590 gene) was discovered and verified through genome-wide association analysis, and a PCR amplification method was designed to identify the hypoxia tolerance trait in rice.

Benefits of technology

It improves the accuracy of selecting for hypoxia tolerance traits in rice breeding, accelerates the breeding process, significantly enhances the germination ability of rice in hypoxia environments, and promotes high and stable yields of direct-seeded rice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119265347B_ABST
    Figure CN119265347B_ABST
Patent Text Reader

Abstract

The application discloses a SNP molecular marker related to a low-oxygen tolerance character of rice and application thereof. The SNP molecular marker provided by the application is located at the 25740898th position of the 12th chromosome of rice, and the polymorphism is A or G. The SNP molecular marker is significantly related to the seedling germination rate of rice under low-temperature stress conditions, and the low-oxygen germination of the rice variety with the base type G at the site under low-temperature stress conditions is significantly stronger than that of the rice variety with the base type A. The application also designs PCR primers according to the SNP site, and the nucleotide sequences of the primers are shown as SEQ ID NO. 1 and SEQ ID NO. 2. The SNP molecular marker related to the low-oxygen tolerance of rice provided by the application is verified in a natural population, and the marker can effectively predict the low-oxygen germination of rice, thereby being used for marker-assisted breeding of low-oxygen and direct-seeding molecular breeding of rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of rice stress resistance breeding and molecular genetics, and relates to a SNP molecular marker related to the low oxygen tolerance trait in rice and its application. Specifically, it relates to an SNP marker on rice chromosome 12 that is significantly associated with the low oxygen germination trait in rice, primers, and the application of this molecular marker. Background Technology

[0002] Direct seeding of rice is a cultivation method that involves sowing seeds directly into the field without seedling raising or transplanting. Due to its significant labor savings, it is gradually becoming an ideal method for simplified and efficient rice cultivation in modern agriculture. However, the problem of full seedling emergence is a primary factor affecting the low and unstable yield of direct-seeded rice. One reason for this is that direct-seeded rice germinates in a flooded environment. While flooding is beneficial for weed control, it is detrimental to seedling establishment. Therefore, breeding rice varieties with good germination tolerance to flooding is of great importance. Researching the genetic basis of rice seed germination tolerance to flooding can provide important theoretical references for breeding superior direct-seeded rice varieties. Furthermore, identifying QTLs (Quantitative Trait Loci) controlling germination tolerance to flooding, and then finely mapping and cloning these genes, will help to further elucidate the biochemical and molecular mechanisms of rice germination tolerance to flooding.

[0003] Rice flood tolerance is a quantitative trait controlled by multiple genes. Gene expression is closely related to the environment, and the interaction between QTLs and the environment is the main factor affecting quantitative traits. Xu et al. used the flood-tolerant indica rice line IR40931-26 and the flood-tolerant japonica rice line PI543851 as experimental materials. Using RAPD and RFLP molecular markers, they located the QTL associated with rice flood tolerance on chromosome 9, approximately 4 cM from the RFLP marker C1232, and named it Sub1. They found that 69% of the phenotypic variations associated with flood tolerance were controlled by Sub1. The rice Sub1 locus contains three genes encoding ethylene response factor ERF subfamily proteins—Sub1A, Sub1B, and Sub13. Hou Mingyu et al. used the shoot length of rice seedlings that germinated in the dark for 5 days under 20cm deep water conditions as an indicator of the low-oxygen germination capacity of rice seedlings. They detected a total of 5 QTLs for low-oxygen germination capacity on chromosomes 1, 2, 5, 5, and 7. The enhancing alleles of qAG-1, qAG-2, and qAG-7 originated from DV85, while the enhancing alleles of qAG-5a and qAG-5b originated from Kinmaza. With the development of whole-genome sequencing technology, it has become possible to compare gene variations of different germplasm resources at the whole-genome level. Combined with phenotypic identification data, linkage analysis and association analysis (GWAS) can efficiently discover new genes and favorable alleles contained in germplasm resources. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides an SNP molecular marker related to the hypoxia tolerance trait in rice and its application.

[0005] In a first aspect, this invention provides a SNP molecular marker associated with hypoxia tolerance in rice. This marker originates from an exon of the LOC_Os12g41590 gene, located at 25740898 bp on chromosome 12 of rice, and has bases of A or G. The SNP molecular marker is significantly correlated with the hypoxia phenotype in rice, and rice varieties with the G / G genotype at the locus exhibit significantly stronger hypoxia tolerance than rice varieties with the A / A genotype at the locus.

[0006] A second aspect of the present invention provides specific primers for SNP molecular markers related to the hypoxia tolerance trait in rice, for detecting the aforementioned SNP molecular markers, comprising:

[0007] SEQ ID NO.1: 5'-GAGACGATGAGTGCTCACGA-3';

[0008] SEQ ID NO. 2: 5'-ACGTTGCCTTCATCTAGCC-3'.

[0009] Furthermore, the nucleotide sequence of the PCR amplification product fragment of the specific primer is shown in SEQ ID NO.3. The SNP molecular marker is located at the 86th bp of the sequence, where the base type of R is A or G, resulting in different low-temperature phenotypes in rice.

[0010] SEQ ID NO.3:

[0011] GAGACGATGAGTGCTCACGAACTCGAGCCCGATGCCGCGGGACGCGCCCTGCACCATGGACACGCCGCCGCCGGATGTCGCCGTC R ACGAGAACGCCCTCGCCGCCGCCGCCGCAGCCGCCAGCGTCCTCGCCGTCGCCATTGCTCCTCCTCTCGCCTCGATTCGATTCTCTTCCTCCGGGTGCTCGCGGCGGTTCGGTGGCGAGGCGAGGCGCACAGGGGCAGTAATGGCGGGTCGTTGTTGTGGGGGAAATTTTGGGGGAGAATTGCGTGGCTAGATGAAGGCACACGT

[0012] Furthermore, the method for screening SNP molecular markers related to the hypoxia tolerance trait in rice is specifically as follows:

[0013] SNP detection was performed on several rice samples;

[0014] Genome-wide association analysis was performed on rice samples using the detected SNPs to obtain one SNP molecular marker that is closely linked to the hypoxia tolerance trait in rice. The SNP molecular marker is from an exon of the LOC_Os12g41590 gene, located at position 25740898 bp on chromosome 12 of rice, and has bases A or G.

[0015] In a third aspect, the present invention provides a kit for SNP markers related to the hypoxia tolerance trait in rice, comprising the specific primers described above.

[0016] In a fourth aspect, the present invention provides the application of the SNP molecular marker, the specific primer, or the kit in identifying the hypoxia tolerance trait in rice.

[0017] Furthermore, the base types of SNP molecular markers related to the hypoxia tolerance trait in the rice samples were detected, and the G base type rice showed stronger hypoxia tolerance than the A base type rice.

[0018] In a fifth aspect, the present invention provides the application of the SNP molecular markers related to the rice's hypoxia tolerance trait, the specific primers, or the kit in genetic breeding.

[0019] In this invention, the SNP molecular marker is located in the exon of the LOC_Os12g41590 gene. LOC_Os12g41590 is an oxidoreductase that participates in the abiotic stress response of plants and may respond to hypoxia stress.

[0020] Specifically, taking the cultivation of new hypoxia-tolerant rice varieties as an example, the hypoxia tolerance of rice can be enhanced by transferring the LOC_Os12g41590 gene (with a G base type for the SNP molecular marker) containing strong hypoxia tolerance into rice varieties through genetic engineering. Alternatively, the SNP site of the LOC_Os12g41590 gene (with an A base type for the SNP molecular marker) in hypoxia-sensitive rice can be directly mutated to create a new hypoxia-tolerant rice variety. In a sixth aspect, this invention provides a method for identifying or assisting in the identification of hypoxia tolerance in rice. Specifically, the method involves detecting whether the genotype at position 25740898 on chromosome 12 of the rice sample is A / A or G / G: the G / G genotype rice sample exhibits stronger hypoxia tolerance than the A / A genotype rice sample.

[0021] The A / A genotype is a homozygous combination where all deoxyribonucleic acid (DNA) at position 25740898 on chromosome 12 of the rice genome is A; the G / G genotype is a homozygous combination where all deoxyribonucleic acid (DNA) at position 25740898 on chromosome 12 of the rice genome is G.

[0022] Furthermore, the method for detecting whether the genotype at position 25740898 of chromosome 12 of the rice sample is A / A or G / G includes the following steps:

[0023] 1) Extract genomic DNA from the rice sample to be tested;

[0024] 2) Using the genomic DNA of the rice sample to be tested as a template, PCR amplification was performed using the specific primers for the SNP molecular markers related to the rice's hypoxia tolerance trait to obtain the amplified product fragment.

[0025] 3) Detect the base types at the SNP molecular markers related to the rice hypoxia tolerance trait described in the PCR amplification product fragment.

[0026] Furthermore, step (3) specifically includes:

[0027] The base type at the 86th bp of the PCR amplification product fragment was detected. Rice with the G base type showed stronger tolerance to hypoxia than rice with the A base type.

[0028] By adopting the above technical solution, the beneficial effects achieved by the present invention are as follows:

[0029] This invention utilizes genome-wide association analysis to identify a significant association between the sequence polymorphism of LOC_Os12g41590 and the hypoxia tolerance trait in rice. This indicates the presence of a SNP molecular marker in this gene that is associated with the hypoxia tolerance trait in rice. This provides an SNP molecular marker that is highly significantly associated with the hypoxia tolerance trait in rice, which can be used as an auxiliary selection marker for the hypoxia tolerance trait in rice breeding, thereby improving the accuracy of selection and accelerating the breeding process. Attached Figure Description

[0030] Figure 1 This is a frequency histogram of the hypoxia germination rate trait in the rice test population identified in Example 1;

[0031] Figure 2 This is a Manhattan plot of the genome-wide association analysis of the low-oxygen germination rate trait in rice in Example 1;

[0032] Figure 3 This is a box plot of the germination rate of samples with different genotypes at the Chr12:25740898 locus of the LOC_Os12g41590 gene in Example 1;

[0033] Figure 4This is a schematic diagram showing the location of the SNP sites;

[0034] Figure 5 This is a base peak diagram of the sequencing results of 10 rice materials collected in Example 2. Detailed Implementation

[0035] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Modifications or substitutions to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the invention are all within the scope of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the materials, reagents, etc., used in the embodiments are all commercially available.

[0036] Example 1: Obtaining and identifying SNP molecular markers closely linked to hypoxia germination in rice.

[0037] I. Obtaining SNP molecular markers closely linked to hypoxia germination in rice

[0038] 1. This experiment used 208 rice varieties from the China National Rice Research Institute.

[0039] 2. 208 materials were used, with two biological replicates for each material. Fifteen seeds were collected from each replicate (empty, shriveled, and moldy seeds were removed; seeds were dried in a 42°C oven for 3 days before the experiment). Seeds were surface-sterilized by soaking in 5% NaClO for 15 minutes, then thoroughly rinsed with distilled water. The sterilized seeds were then immersed in a 13cm deep, completely black plastic container, filled with distilled water, and tightly sealed to create a submerged, low-oxygen environment. The container was placed in a 28˚C incubation room for germination. Dark conditions were established to simulate the natural darkness under the soil during rice germination. After 10 days of incubation, the seeds were removed, and germination rate, coleoptile fresh weight, coleoptile length, and mesocotyl length were measured for genome-wide association analysis (GWAS).

[0040] 3. Genome-wide association analysis (GEMMA) was performed using GEMMA software (https: / / www.xzlab.org / software.html). A mixed linear model was used for analysis, with population structure and the phylogenetic matrix between materials as covariates. Combined with genotype and phenotypic values, the statistical test value P for SNPs was calculated. Using P < 0.001 as the criterion, genetic loci associated with phenotypic traits were screened. To further analyze closely spaced significant SNPs, significant SNPs with a distance ≤ 200 kb were merged, and the most significant SNP within the interval was labeled as a QTL. Candidate genes within 200 kb upstream and downstream of the QTL were queried. Through genome-wide association analysis, a SNP locus significantly associated with hypoxic germination in rice was discovered. This SNP locus is located at position 25740898 on chromosome 12 of rice, which is also position 86 of SEQ ID NO. 3 (e.g., ...). Figure 4 (As shown). When the SNP is G, the seedling germination rate is high, indicating strong hypoxic germination ability. When the SNP is A, the seedling germination rate is low, indicating poor hypoxic germination ability.

[0041] The frequency histogram of the hypoxia germination rate trait in the rice test population identified in this embodiment is shown below. Figure 1 As shown in the Manhattan plot of genome-wide association analysis of the hypoxia germination rate trait in rice, Figure 2 As shown in the figure, the box plot of germination rate of different genotype samples at the SNP locus for low oxygen germination in rice is as follows: Figure 3 As shown.

[0042] 4. Primers were designed for the SNP sites obtained in step 3. The primer sequences are shown below:

[0043] SEQ ID NO.1: 5'-GAGACGATGAGTGCTCACGA-3';

[0044] SEQ ID NO.2: 5'-ACGTTGCCTTCATCTAGCC-3'

[0045] II. Methods for Identifying Low-Oxygen Tolerance in Rice Based on SNP Molecular Markers

[0046] The method for identifying the hypoxia tolerance of rice varieties based on SNP molecular markers is to detect whether the base type of the SNP locus (position 25740898 on chromosome 12) is A or G: rice with a G base type exhibits stronger hypoxia tolerance than rice with an A base type. G-type rice is a homozygous variety with a G deoxyribonucleotide at position 25740898 on chromosome 12 of the rice genome; A-type rice is a homozygous variety with an A deoxyribonucleotide at position 25740898 on chromosome 12 of the rice genome.

[0047] The specific steps for detecting whether the base type of the SNP site (position 25740898 on chromosome 12) in the rice to be tested is A or G are as follows: Extract rice genomic DNA, use the genomic DNA as a template, and perform PCR amplification using SEQ ID NO.1 and SEQ ID NO.2 to obtain PCR amplification products; sequence the PCR amplification products, and determine whether the base type of the rice SNP site to be tested is A or G based on the sequencing results.

[0048] Example 2: Application of SNP molecular markers closely linked to hypoxia germination in rice

[0049] I. Base Type Detection

[0050] Ten additional rice samples were selected as test samples, and the base types of the test samples were detected according to the method in step two of Example 1.

[0051] The results are shown in Table 1. Of the 10 rice materials, 5 had a base type of A at this SNP locus, and 5 had a base type of G. It was also found that the average germination rate under hypoxia was 100% for rice materials with base type G at this SNP locus, while the average germination rate under hypoxia was 68% for rice materials with base type A, with a highly significant difference between the two. The results indicate that the seedling germination rate of rice materials with base type G at this SNP locus was significantly higher than that of rice materials with base type A, suggesting that the hypoxia germination ability of rice materials with base type G was significantly stronger than that of rice materials with base type A. This invention further demonstrates that this SNP locus can serve as an effective genetic marker for marker-assisted selection in rice to improve the hypoxia germination characteristics of rice and accelerate the breeding process of direct-seeded rice.

[0052] The base peak diagram of sequencing results of 10 rice materials is shown below. Figure 5 As shown.

[0053] Table 1. Hypoxia phenotypes of 10 rice materials

[0054] Material Number Germination rate Fresh weight (g) Bud length (cm) Mesocotyl length (cm) Base type QC53 100% 0.374 13.34 2.89 G QC98 100% 0.581 12.14 2.22 G QC109 100% 0.597 10.38 2.65 G QC99 100% 0.663 9.43 2.25 G QC23 100% 0.348 7.16 2.96 G QC95 70% 0.021 0.885 0.241 A QC3 70% 0.123 2.604 0.000 A QC117 70% 0.098 2.177 0.263 A QC198 65% 0.124 1.375 0.461 A QC137 65% 0.114 2.098 0.294 A

[0055] The various embodiments of this disclosure have been described above. These descriptions are exemplary and not exhaustive, nor are they limited to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments. The terminology used herein is chosen to best explain the principles, practical application, or technical improvements to the embodiments in the market, or to enable others skilled in the art to understand the embodiments disclosed herein.

[0056] The above are merely optional embodiments of this disclosure and are not intended to limit this disclosure. Various modifications and variations can be made to this disclosure by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the scope of protection of this disclosure.

Claims

1. The application of SNP molecular markers or their specific primers related to the rice hypoxia tolerance trait in identifying the rice hypoxia tolerance trait, characterized in that, The SNP molecular marker is derived from an exon of the LOC_Os12g41590 gene, located at 25740898 bp on chromosome 12 of rice, with bases A or G; rice varieties with the SNP molecular marker genotype G / G exhibit stronger hypoxia tolerance than rice varieties with the genotype A / A. The nucleotide sequences of the specific primers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, and the nucleotide sequence of the PCR amplification product fragment of the specific primers is shown in SEQ ID NO.

3. The SNP molecular marker is located at position 86 bp in SEQ ID NO.

3.

2. A method for identifying or assisting in the identification of the hypoxia tolerance trait in rice, characterized in that, The method is as follows: detect whether the genotype at position 25740898 of chromosome 12 of the rice to be tested is A / A or G / G: the rice to be tested with the G / G genotype has stronger hypoxia tolerance than the rice to be tested with the A / A genotype. Specifically, the following steps are included: (1) Extract genomic DNA from the rice sample to be tested; (2) Using the genomic DNA of the rice sample to be tested as a template, PCR amplification reaction was performed using specific primers to obtain the amplification product fragment; the nucleotide sequences of the specific primers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively; the nucleotide sequence of the PCR amplification product fragment of the specific primers is shown in SEQ ID NO.3, and the SNP molecular marker is located at the 86th bp in SEQ ID NO.3; (3) The base types at the SNP molecular markers related to the low oxygen tolerance trait in rice were detected in the PCR amplification product fragments. Rice with G base type has stronger low oxygen tolerance than rice with A base type.