A method and application of detecting salmon alphavirus in salmon based on RAA-CRISPRCas12a

Abstract

The present invention relates to the field of virus detection technology, and discloses a method and application of detecting salmon alphavirus in salmon based on RAA-CRISPRCas12a, comprising the following steps: dispersing a solution of Cas12 protein, a solution of guide RNA, a solution of ssDNA reporter probe, a ribonuclease inhibitor, nuclease-free water and RAA reactant in a buffer, incubating, and performing fluorescence intensity detection; the amino acid sequence of the Cas12 protein is shown in SEQ ID NO.5. A novel Cas12a protease with better cleavage activity is used in the method of the present invention, which can be successfully applied to the detection of salmon alphavirus in salmon.

Description

Technical Field

[0001] The present invention relates to the technical field of virus detection, and in particular to a method and application of detecting salmon alphavirus in salmon based on RAA-CRISPRCas12a. Background Art

[0002] The CRISPR-Cas system was originally derived from a natural immune mechanism in bacteria and archaea to resist the invasion of foreign genetic material, such as plasmids and bacteriophages. In recent years, the CRISPR-Cas system has attracted widespread attention in the field of biological sciences as a revolutionary gene editing technology. With its simplicity and efficiency, this technology provides a powerful tool for gene editing, gene regulation, and nucleic acid detection. The system uses Cas nucleases and crRNA to guide the recognition and cutting of specific DNA sequences, and has extremely high target specificity. As an emerging detection method, CRISPR-Cas detection technology has shown great application potential in the fields of virus detection, disease diagnosis, metal ion detection, and mycotoxin detection.

[0003] Recombinase-aid Amplification (RAA) is a constant temperature rapid nucleic acid amplification technology. The recombinase obtained from bacteria or fungi can bind tightly to the primer DNA at room temperature to form a recombinase / primer complex, which invades the DNA double-stranded nucleic acid template. At the invasion site, the recombinase opens the double-stranded nucleic acid template, and the single-stranded binding protein binds to the single-stranded nucleic acid opened by the recombinase, maintaining the double-stranded template in an open-strand state. The recombinase / primer complex begins to scan the double-stranded nucleic acid. When the primer searches for a complementary sequence that matches it perfectly on the template, the recombinase / primer complex disintegrates, and the DNA polymerase binds to the 3' end of the primer to start synthesizing a new chain. The synthesized new chain can be used as a template, and the final amplification product grows exponentially to complete the amplification of the target gene.

[0004] Although the conversion of viral RNA into DNA and amplification can improve the accuracy of detection to a certain extent, the Cas12a variants in the prior art still face insufficient cleavage activity, which limits their promotion in practical applications. Therefore, it is necessary to discover or improve the existing Cas12a protein and find a new Cas12a protease with better cleavage activity and more convenient use, so as to make CRISPR-Cas detection technology more suitable for detecting viruses. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a method and application for detecting salmon alphavirus in salmon based on RAA-CRISPRCas12a. The method of the present invention uses a new Cas12a protease with better cleavage activity, which can be successfully used to detect salmon alphavirus in salmon.

[0006] The present invention provides a method for detecting salmon alphavirus in salmon based on RAA-CRISPRCas12a, comprising the following steps:

[0007] The solution of Cas12 protein, the solution of guide RNA (crRNA), the solution of ssDNA reporter probe, ribonuclease inhibitor, nuclease-free water and RAA reactant were dispersed in a buffer, incubated, and fluorescence intensity was detected;

[0008] The amino acid sequence of the Cas12 protein is shown in SEQ ID NO.5;

[0009] The preparation method of the RAA reactant is specifically as follows:

[0010] Based on the cDNA sequence obtained by reverse transcription of the total RNA sequence of salmon alphavirus in salmon,

[0011] A RAA primer pair designed based on a cDNA sequence obtained from salmon alphavirus in salmon, the RAA primer pair comprising an upstream primer SAV-RAA-F1 and a downstream primer SAV-RAA-R1;

[0012] Upstream primer, concentration 10 μM, volume 2 μL; downstream primer, concentration 10 μM, volume 2 μL; buffer A, volume 25 μL; nuclease-free plum water, volume 13.5 μL; after mixing the above solutions in a tube of reaction dry powder, the above reaction system is divided into 5 parts, and cDNA sequence is added to each reaction system, volume 5 μL; buffer B, volume 2.5 μL.

[0013] Furthermore, the sequence of the guide RNA is shown as SEQ ID NO.4.

[0014] Further, the nucleotide sequence of the ssDNA reporter probe is FAM-TTATT-BHQ1, wherein the N-terminus of the ssDNA reporter probe is modified with a fluorescent group, and the C-terminus of the ssDNA reporter probe is modified with a quenching group;

[0015] The fluorescent group is 5'-FAM;

[0016] The quenching group is 3'-BHQ1.

[0017] Furthermore, the incubation temperature is 36°C-38°C, and the incubation time is 25min-35min.

[0018] Furthermore, the buffer comprises 10 mM Tris-HCl (tris(hydroxymethyl)aminomethane hydrochloride), 10 mM magnesium chloride, 10 mM sodium chloride, and 100 g / mL bovine serum albumin solution (BSA).

[0019] Furthermore, the method for preparing the bovine serum albumin solution is specifically to disperse the bovine serum albumin solution in deionized water.

[0020] Furthermore, by volume, the ratio of the solution of Cas12 protein, the solution of guide RNA, the solution of ssDNA reporter probe, ribonuclease inhibitor, nuclease-free water, RAA reactant and buffer is 2:2:1:1:22:10:2.

[0021] Further, the molar concentration of the solution of the Cas12a protein is 200nM.

[0022] Furthermore, the method for preparing the solution of the Cas12a protein is specifically to dissolve and disperse the Cas12a protein in nuclease-free water.

[0023] Furthermore, the molar concentration of the guide RNA solution is 200 nM.

[0024] Furthermore, the method for preparing the guide RNA solution is specifically to dissolve and disperse the guide RNA in nuclease-free water.

[0025] Furthermore, the molar concentration of the ssDNA reporter probe solution is 200 nM.

[0026] Furthermore, the method for preparing the solution of the ssDNA reporter probe is specifically to dissolve and disperse the ssDNA reporter probe in nuclease-free water.

[0027] Furthermore, the concentration of the ribonuclease inhibitor is 40 U / μL.

[0028] The ribonuclease inhibitor in the present invention was purchased from Sangon Biotech (Shanghai) Co., Ltd., and the CAS number of the product is B600478.

[0029] Furthermore, the fluorescence intensity is detected using an enzyme marker with an excitation wavelength of 480nm-500nm and an emission wavelength of 510nm-540nm.

[0030] Furthermore, the cDNA sequence is shown as SEQ ID NO.1.

[0031] Furthermore, the nucleotide sequence of the upstream primer SAV-RAA-F1 is shown in SEQ ID No.2.

[0032] Furthermore, the nucleotide sequence of the downstream primer SAV-RAA-R1 is shown in SEQ ID No.3.

[0033] Furthermore, the reaction temperature in the reaction system is 39° C. and the reaction time is 30 min.

[0034] The present invention also provides the application of the RAA-CRISPR Cas12a-based method for detecting salmon alphavirus in salmon in detecting the salmon alphavirus content in salmon.

[0035] The embodiments of the present invention have the following technical effects:

[0036] 1. In the method of the present invention, when the RAA reactant, crRNA and Cas12 protein form a ternary complex, the cutting activity of the Cas12 protein will be activated, and the fluorescent group on the ssDNA reporter probe will be cut by the Cas12 protein. The Cas12 protein obtained by the present invention has a high cutting activity, so for targets with low content, the accuracy of detection can be improved.

[0037] 2. The method of the present invention, first, has high sensitivity: due to the combination of the efficient amplification ability of the RAA technology and the high specificity of the Cas12a protein, this method has high detection sensitivity and specificity. Second, good specificity: the detection method of the present invention has good specificity for salmon alphavirus in salmon, and has no cross-reaction with other common salmon viruses such as respiratory and enteric viruses, infectious pancreatic necrosis virus, etc., avoiding the occurrence of false positive results. Third, it is simple and easy: the detection method of the present invention does not require the use of complex instruments and equipment, only a constant temperature water bath or metal bath is required, making on-site detection more convenient and easy. Fourth, low cost: the detection method of the present invention does not require the use of precision instruments such as real-time fluorescence PCR instruments, which reduces the detection cost, and can also avoid errors caused by instrument failure or operating errors. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0039] Figure 1 It is the comparative data of the cleavage activity of the Cas12a protein of the present invention provided by the present invention and other proteins.

[0040] Figure 2 It is the effect of the incubation temperature provided by the present invention on the activity of Cas12a protein.

[0041] Figure 3 It is the effect of the incubation time provided by the present invention on the activity of Cas12a protein.

[0042] Figure 4 It is the influence of the ratio of crRNA to Cas12a protein provided by the present invention on the activity of Cas12a protein.

[0043] Figure 5 It is the effect of the ssDNA reporter probe concentration provided by the present invention on the activity of Cas12a protein.

[0044] Figure 6 It is the specificity of Cas12a protein provided by the present invention and salmon alphavirus.

[0045] Figure 7 It is the standard curve of the Cas12a protein provided by the present invention for detecting salmon alphavirus. DETAILED DESCRIPTION

[0046] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0047] In a first aspect, some embodiments of the present invention provide a method for detecting salmon alphavirus in salmon based on RAA-CRISPR Cas12a, comprising the following steps:

[0048] The solution of Cas12 protein, the solution of guide RNA (crRNA), the solution of ssDNA reporter probe, ribonuclease inhibitor, nuclease-free water and RAA reactant were dispersed in a buffer, incubated, and fluorescence intensity was detected;

[0049] The amino acid sequence of the Cas12 protein is shown in SEQ ID NO.5;

[0050] The preparation method of the RAA reactant is specifically as follows:

[0051] Based on the cDNA sequence obtained by reverse transcription of the total RNA sequence of salmon alphavirus in salmon,

[0052] A RAA primer pair designed based on a cDNA sequence obtained from salmon alphavirus in salmon, the RAA primer pair comprising an upstream primer SAV-RAA-F1 and a downstream primer SAV-RAA-R1;

[0053] Upstream primer, concentration 10 μM, volume 2 μL; downstream primer, concentration 10 μM, volume 2 μL; buffer A, volume 25 μL; nuclease-free plum water, volume 13.5 μL; after mixing the above solutions in a tube of reaction dry powder, the above reaction system is divided into 5 parts, and cDNA sequence is added to each reaction system, volume 5 μL; buffer B, volume 2.5 μL.

[0054] In some embodiments, the sequence of the guide RNA is shown as SEQ ID NO.4.

[0055] In some embodiments, the nucleotide sequence of the ssDNA reporter probe is FAM-TTATT-BHQ1, wherein the N-terminus of the ssDNA reporter probe is modified with a fluorescent group, and the C-terminus of the ssDNA reporter probe is modified with a quenching group;

[0056] The fluorescent group is 5'-FAM;

[0057] The quenching group is 3'-BHQ1.

[0058] In some embodiments, the incubation temperature is 36° C.-38° C., and the incubation time is 25 min-35 min.

[0059] In some embodiments, the buffer comprises 10 mM Tris-HCl (tris(hydroxymethyl)aminomethane hydrochloride), 10 mM magnesium chloride, 10 mM sodium chloride, and 100 g / mL bovine serum albumin solution (BSA).

[0060] In some embodiments, the method for preparing the bovine serum albumin solution is specifically to disperse the bovine serum albumin solution in deionized water.

[0061] In some embodiments, the ratio of the solution of Cas12 protein, the solution of guide RNA, the solution of ssDNA reporter probe, ribonuclease inhibitor, nuclease-free water, RAA reactant and buffer is 2:2:1:1:22:10:2 by volume.

[0062] In some embodiments, the molar concentration of the solution of the Cas12a protein is 200 nM.

[0063] In some embodiments, the method for preparing the solution of the Cas12a protein is specifically to dissolve and disperse the Cas12a protein in nuclease-free water.

[0064] In some embodiments, the molar concentration of the guide RNA solution is 200 nM.

[0065] In some embodiments, the method for preparing the guide RNA solution is specifically to dissolve and disperse the guide RNA in nuclease-free water.

[0066] In some embodiments, the molar concentration of the ssDNA reporter probe solution is 200 nM.

[0067] In some embodiments, the method for preparing the ssDNA reporter probe solution is specifically to dissolve and disperse the ssDNA reporter probe in nuclease-free water.

[0068] In some embodiments, the concentration of the ribonuclease inhibitor is 40 U / μL.

[0069] In some embodiments, the fluorescence intensity is detected using an enzyme reader with an excitation wavelength of 480nm-500nm and an emission wavelength of 510nm-540nm.

[0070] In some embodiments, the cDNA sequence is shown as SEQ ID NO.1.

[0071] In some embodiments, the nucleotide sequence of the upstream primer SAV-RAA-F1 is shown as SEQ ID No.2.

[0072] In some embodiments, the nucleotide sequence of the downstream primer SAV-RAA-R1 is shown as SEQ ID No.3.

[0073] In some embodiments, the reaction temperature in the reaction system is 39° C. and the reaction time is 30 min.

[0074] In a second aspect, some embodiments of the present invention also provide the application of the RAA-CRISPR Cas12a-based method for detecting salmon alphavirus in salmon in detecting the content of salmon alphavirus in salmon.

[0075] The following is described in detail with reference to specific embodiments:

[0076] Embodiment 1:

[0077] (1) cDNA sequence design:

[0078] The salmon alphavirus gene with NO.KC122926.1 in the GenBank database was selected as the target gene fragment for identification. The conserved segments were found through GenBank analysis and BLAST comparison, and primers were designed in the conserved regions.

[0079] The total RNA extracted from salmon was reverse transcribed into cDNA by M-MLV Reverse Transcriptase. The sequence of cDNA is shown in SEQ ID NO.1:

[0080] cDNA sequence (SEQ ID NO.1):

[0081] 5'-GCAACATTGCCGATCTGAGGTGGCTTGCCCTGGGTGATACTGGCAGCCGTTAGGACTGGCTCCTCACACGTAAACGTCTGGGAGTCGCTGGTGAAAGTGACGGTTGCCAAGTCAGCGCTCTTGCATTTCTTGTCGAATTTCACTGTGGTACCAGGTGGCACCCTCACTGTGCACTGGCTGTCGTTGCATGTTACG-3'.

[0082] (2) Primer design based on salmon alphavirus conserved sequence:

[0083] In the RAA nucleic acid amplification system of the present invention, the nucleotide sequence of the upstream primer (SAV-RAA-F1) is shown in SEQ ID NO.2, and the base sequence of the downstream primer (SAV-RAA-R1) is shown in SEQ ID NO.3:

[0084] Upstream primer SAV-RAA-F1 (SEQ ID NO.2):

[0085] 5'-GCAACATTGCCGATCTGAGGTGTGG-3';

[0086] Downstream primer SAV-RAA-R1 (SEQ ID NO.3):

[0087] 5'-CGTAACATGCAACGACAGCCAGTGC-3';

[0088] (3) Design of crRNA

[0089] The corresponding crRNA was designed based on the cDNA sequence of salmon alphavirus obtained by reverse transcription and used in the detection system.

[0090] Sequence of crRNA (SEQ ID NO.4):

[0091] 5'-UAAUUUCUACUAAGUGUAGAUCUGCCAGUAUUACCCAGGGCAAG-3';

[0092] (4) Design of ssDNA reporter probe

[0093] The invention provides a specific probe base sequence for salmon alphavirus, wherein the 5' end of the ssDNA reporter probe is labeled with a FAM fluorescent reporter group, and the 3' end is labeled with a BHQ1 fluorescent quencher group.

[0094] The sequence of the ssDNA reporter probe is FAM-TTATT-BHQ1:

[0095] (5) Extraction of total RNA from salmon alphavirus:

[0096] The total RNA of salmon alphavirus was extracted using an RNA extraction kit. The entire step was performed according to the instructions of the FreeZol Reagent RNA extraction kit. The specific steps are as follows:

[0097] 1) Take 500 μL of the tissue grinding supernatant to 1.5 mL and add it into a 1.5 mL EP tube.

[0098] 2) Add 100 μL of Dilution Buffer to the EP tube, cover the tube tightly, and vortex until the solution is fully mixed to dilute the sample and make it easier for subsequent processing.

[0099] 3) Let stand at room temperature for 5 minutes to allow the solution to be fully mixed for subsequent processing.

[0100] 4) Centrifuge at 10,000 rpm for 15 minutes at room temperature. This step is to separate impurities such as proteins, DNA, and polysaccharides, so that they precipitate to the bottom of the tube, while RNA is distributed in the upper solution.

[0101] 5) Carefully remove the centrifuge tube and pipette the supernatant solution (about 500 μL) into a new 1.5 mL centrifuge tube to collect the upper solution containing RNA.

[0102] 6) Add an equal volume of isopropanol to the supernatant solution, mix thoroughly by inverting, and let stand at room temperature for 10 minutes to promote RNA precipitation.

[0103] 7) Centrifuge at 10,000 rpm for 10 minutes. After centrifugation, white gel-like precipitate can be seen on the side and bottom of the tube. Carefully discard the supernatant without losing the precipitate, and collect the RNA precipitate.

[0104] 8) Add 1 mL of 75% ethanol, flick the bottom of the tube to suspend the precipitate, and invert it upside down several times to wash the RNA precipitate and remove residual impurities.

[0105] 9) Centrifuge at 9000rpm for 3min, discard the supernatant, do not lose the precipitate, and collect the RNA precipitate again.

[0106] 10) Repeat steps 6) and 7) and discard the supernatant to ensure the purity of the RNA precipitate.

[0107] 11) Leave at room temperature for 1 min, add 20-100 μL RNase-free dd H2O, and vortex for 3 min at room temperature to fully dissolve the RNA precipitate for subsequent experiments.

[0108] (6) Synthesis of cDNA

[0109] The extracted salmon alphavirus total RNA was prepared into a reaction system according to Table 1. The reaction procedure was 37°C for 1 h or 72°C for 15 min. The product was directly used in subsequent experiments or stored at -80°C for future use.

[0110] Table 1 Components of the reverse transcription system kit

[0111]

[0112] (7) Establishment of RAA reaction system

[0113] Use the basic RAA nucleic acid amplification kit and prepare the reaction system according to the kit instructions (Table 2). Mix the reaction solution in a tube of reaction dry powder and react at 39°C for 30 minutes.

[0114] Table 2 RAA nucleic acid amplification system

[0115]

[0116] (8) Selection of Cas12a protein:

[0117] Amino acid sequence of Cas12a protein (SEQ ID NO.5):

[0118]

[0119] (9) Determination of CRISPR / Cas12a detection system

[0120] According to Table 3, nuclease-free water, Cas12a protein solution, 1× buffer, ssDNA reporter probe solution, ribonuclease inhibitor (concentration of 40U / μL), and crRNA solution were added to the reaction tube in sequence, and the mixture was mixed by low-speed rotation on a vortex instrument and reacted at 37°C for 20 min. The fluorescence value of the reacted system was measured in a multifunctional microplate reader with an excitation wavelength of 480-500nm and an emission wavelength of 510-540nm to detect the fluorescence value of the sample to be tested.

[0121] The buffer may be 1×NE Buffer 2.1 buffer, and the formula of 1×NE Buffer 2.1 is: 10 mM Tris-HCl, 10 mM magnesium chloride, 10 mM sodium chloride, and 100 g / mL bovine serum albumin (BSA).

[0122] Table 3 CRISPR / Cas12a reaction system

[0123]

[0124] Results and Analysis:

[0125] The cleavage activities of different Cas12a proteins were compared, and LbCas12a (commercially available), Cas12a protein (i.e. Figure 1 The BaCas12a) and AsCas12a (commercially available) in the CRISPR-Cas12a detection system were used, and the reaction temperature was set to 37°C. The plates were transferred to the ELISA plate after being in a water bath at the set temperature for 20 min. The fluorescence intensity values ​​with an excitation wavelength of 494 nm and an emission wavelength of 525 nm were determined using an ELISA instrument. The cleavage activity of different Cas12a proteases was judged based on the obtained fluorescence values.

[0126] The results are as follows Figure 1 As shown, the cleavage activity of different Cas12a proteins of the invention is different, and the cleavage activity of the Cas12a protease in the present invention is significantly better than that of other Cas12a proteins.

[0127] The incubation temperature during the detection process will affect the cleavage activity of the Cas12a protein. When the incubation temperature is too high or too low, it will cause the denaturation or inactivation of the Cas12a protein. Therefore, the appropriate incubation temperature is the basis for the Cas12a protein to exert its cleavage activity. Set the incubation temperatures to 25°C, 30°C, 37°C, 40°C, and 45°C. Configure the CRISPR-Cas12a detection system, transfer it to the ELISA plate after 20 minutes of water bath at the set temperature, and use an ELISA instrument to measure the fluorescence intensity value with an excitation wavelength of 494nm and an emission wavelength of 525nm.

[0128] The results are as follows Figure 2 As shown (in Figure 2 In the figure, the ordinate is the relative fluorescence intensity, which is obtained by setting the highest fluorescence value to 100%, and calculating the rest according to the percentage of the highest fluorescence value. Figure 2 a, b, and c represent the significance of the data). The relative fluorescence intensity value of Cas12a protein continues to rise in the temperature range of 25°C-37°C, and the cutting activity slowly increases; it reaches the highest point at 37°C, and the cutting activity is the largest; after 37°C, the relative fluorescence intensity value begins to decline, and begins to decline sharply between 40°C-45°C, and the cutting activity also continues to decrease. Therefore, it is further preferred that the optimal reaction temperature of Cas12a protein is 37°C.

[0129] In the detection system, incubation time that is too long or too short will affect the function of Cas12a protein, resulting in poor gene editing effect; appropriate incubation time can ensure that Cas12a protein is fully expressed and correctly folded, and improve the efficiency of cutting fluorescent reporter probes. Set the incubation time to 10min, 20min, 30min, 40min, and 50min respectively. Configure the CRISPR-Cas12a detection system, and use a microplate reader to measure the fluorescence intensity value after the incubation time set in a 37°C water bath.

[0130] The results are as follows Figure 3 As shown ( Figure 3 a, b, and c represent the significance of the data). As the incubation time increases, the relative fluorescence intensity value of Cas12a protein also increases continuously. When the incubation time is 50 min, the relative fluorescence intensity value is the largest, and the Cas12a protein cutting activity is the largest. When the incubation time of Cas12a protein is within 20 min, it has an obvious cutting effect. The side proves that the Cas12a protein in the present invention has a higher activity, can reduce the incubation time, and thus improve the detection efficiency. The incubation time is not less than 20 min, and it is further preferred that the incubation time is 20 min-50 min; further preferably, the incubation time is 20 min.

[0131] crRNA and Cas12a protein form a complex that can recognize specific target gene sequences and guide Cas12a protein to perform precise ssDNA reporter probe cutting. If the ratio of crRNA to Cas12a protein is too high, it may cause excessive competition of crRNA, reduce the efficiency of Cas12a protein binding to target gene sequence, and thus reduce cutting activity; on the contrary, if the ratio is too low, it may cause Cas12a protein to fail to be effectively activated, which will also affect its cutting activity. In order to achieve the best Cas12a protein cutting activity, it is necessary to optimize the ratio of crRNA:Cas12a protein in the experimental design to ensure that enough crRNA is used to recognize the target sequence and effectively activate the Cas12a protein, while avoiding excessive use of crRNA to cause competition effects, so as to maximize the cutting efficiency of Cas12a protein.

[0132] The ratio of crRNA:Cas12a protein was optimized, and the volume ratios of crRNA:Cas12a were set to 0.5:1, 0.75:1, 1:1, 1:1.5, and 2:1. The CRISPR-Cas12a detection system was configured, and the fluorescence intensity value was measured using an ELISA instrument after incubation at 37°C for 20 minutes.

[0133] Depend on Figure 4 It can be seen that ( Figure 4 a, b, and c represent the significance of the data). As the ratio of crRNA:Cas12a increases, the relative fluorescence intensity value also increases. When crRNA:Cas12a is 1:1, the relative fluorescence intensity value is the largest, and the Cas12a protein cleavage activity is the largest. Then, as the ratio of crRNA:Cas12a increases, the relative fluorescence intensity value continues to decrease. Further preferably, the volume ratio of crRNA:Cas12a is 1:1.

[0134] Generally speaking, when the concentration of ssDNA reporter probe increases, the rate and affinity of Cas12a protein binding to target DNA can be promoted, thereby enhancing the cutting activity of Cas12a protein. Because ssDNA reporter probe can act as an auxiliary factor to help Cas12a protein stabilize the binding of target DNA to itself, making it easier for Cas12a protein to complete cutting. When ssDNA reporter probe is added to a certain amount, its promoting effect on Cas12a protein reaches a balance, and more addition can only increase the cost of detection.

[0135] The concentration of the ssDNA reporter probe was optimized. The cDNA of salmon alphavirus was used as the target DNA, and the concentration of the ssDNA reporter probe was set to 100nM, 150nM, 200nM, 250nM, and 300nM. The CRISPR-Cas12a detection system was configured, and the fluorescence intensity value was measured using an enzyme reader after incubation at 37°C for 20 minutes.

[0136] Depend on Figure 5 It can be seen that ( Figure 5 a, b, and c represent the significance of the data). As the concentration of the ssDNA reporter probe increases, the relative fluorescence intensity value also increases. When the concentration of the ssDNA reporter probe is 300 nM, the relative fluorescence intensity value is the largest. More preferably, the concentration of the ssDNA reporter probe is 200 nM.

[0137] In order to verify the specificity of crRNA of salmon alphavirus cDNA, specificity detection was carried out. Three common viruses in salmon were selected, namely salmon alphavirus, infectious salmon anemia virus and infectious pancreatic necrosis virus, and four systems were set up for CRISPR-Cas12a detection. The first was a blank group, the second was the RAA amplification system with only salmon alphavirus added, the third system was the RAA amplification system with only infectious salmon anemia virus added, and the fourth system was the RAA amplification system with only infectious pancreatic necrosis virus added. After incubation in a 37°C water bath for 20 minutes, the cells were transferred to an ELISA plate and the fluorescence intensity values ​​with an excitation wavelength of 494nm and an emission wavelength of 525nm were measured using an ELISA instrument. Figure 6 As shown, only when the crRNA corresponding to the salmon alphavirus exists can the Cas12a protein in the system be activated to produce trans-cutting activity and emit fluorescence, while other virus systems cannot be activated.

[0138] The salmon alphavirus detection method based on RAA combined with CRISPR / Cas12a established in this experiment has good specificity and can be used to specifically detect salmon alphavirus.

[0139] The preparation methods of the RAA amplification system of infectious salmon anemia virus and the RAA amplification system of infectious pancreatic necrosis virus adopt the preparation method in the kit of the present invention, the cDNA sequence of infectious salmon anemia virus is SEQ ID NO.6, and the cDNA sequence of infectious pancreatic necrosis virus is SEQ ID NO.7;

[0140] SEQ ID NO.6:

[0141] 5'-CCAGAAGGGAAAATGGTGAAAGTCAAAACCTTGAACCAATTGGTGAACGGAATGATCAGTCGAGCGACGATGACTCTCTACTGTGTGATGAAAGATCCACCGTCTGGAAGCATGGCGACACTGATGAG-3';

[0142] SEQ ID NO.7:

[0143] TCCAAAGCTCCACACTACCGGCCGGTCTCTATGCTCTGAACGGGACGCTCAACGCTGCCACCTTCGAAGGCAGTCTGTCTGAGGTGGA.

[0144] The detection limit of salmon alphavirus was determined, and salmon alphavirus RAA reactants with different concentrations were prepared. The concentrations of salmon alphavirus RAA reactants were 0 fg / μL, 5 fg / μL, 10 fg / μL, 20 fg / μL, 50 fg / μL, 100 fg / μL, 150 fg / μL, and 200 fg / μL. The detection was performed according to the method of the present invention, and then a linear fitting graph was performed with the concentration of salmon alphavirus RAA reactant as the abscissa and the fluorescence intensity as the ordinate, as shown in FIG. Figure 7 As shown, the linear curve is y=50.77x+158.47, R 2 =0.9986, and the minimum detection limit of salmon alphavirus is calculated to be 1.53 fg / μL. The salmon alphavirus RAA reactant with a known concentration of 65 fg / μL is detected by the method of the present invention, and the fluorescence intensity is measured to be 3458 a.u., which is brought into the linear curve of the present invention, and the concentration of salmon alphavirus in the salmon alphavirus RAA reactant is calculated to be 64.98 fg / μL. It can be seen that the present invention can accurately detect salmon alphavirus.

[0145] It should be noted that the terms used in the present invention are only for describing specific embodiments, rather than limiting the scope of the present application. As shown in the present specification, unless the context clearly indicates an exception, the words "one", "a", "a kind of" and / or "the" do not specifically refer to the singular, but may also include the plural. The terms "include", "comprise" or any other variant thereof are intended to cover non-exclusive inclusion, so that the process, method or device including a series of elements includes not only those elements, but also includes other elements not explicitly listed, or also includes elements inherent to such process, method or device. In the absence of more restrictions, the elements defined by the sentence "include one..." do not exclude the presence of other identical elements in the process, method or device including the elements.

[0146] It should also be noted that the terms "center", "up", "down", "left", "right", "vertical", "horizontal", "inside", "outside", etc., indicating the orientation or positional relationship, are based on the orientation or positional relationship shown in the drawings, and are only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as a limitation on the present invention. Unless otherwise clearly specified and limited, the terms "installed", "connected", "connected", etc. should be understood in a broad sense, for example, it can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be a direct connection, or it can be an indirect connection through an intermediate medium, or it can be a connection between the two elements. For those of ordinary skill in the art, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.

[0147] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the technical solutions of the embodiments of the present invention.

Claims

1. An application of a reagent for detecting salmon alphavirus in salmon based on RAA-CRISPRCas12a in the preparation of a product for detecting the content of salmon alphavirus in salmon, characterized in that: The steps include: The solution of Cas12 protein, the solution of guide RNA, the solution of ssDNA reporter probe, ribonuclease inhibitor, nuclease-free water and RAA reactant are dispersed in a buffer, incubated, and fluorescence intensity is detected; The amino acid sequence of the Cas12 protein is shown in SEQ ID NO.5; The preparation method of the RAA reactant is specifically as follows: Based on the cDNA sequence obtained by reverse transcription of the total RNA sequence of salmon alphavirus in salmon, A RAA primer pair designed based on a cDNA sequence obtained from salmon alphavirus in salmon, the RAA primer pair comprising an upstream primer and a downstream primer; Upstream primer, concentration 10 μM, volume 2 μL; downstream primer, concentration 10 μM, volume 2 μL; buffer A, volume 25 μL; nuclease-free water, volume 13.5 μL; cDNA sequence, volume 5 μL; buffer B, volume 2.5 μL; mix the above solutions in a tube of reaction dry powder and react at a reaction temperature of 39°C for 30 min, and divide the solution after the completion of the above reaction into 5 equal parts.

2. The use according to claim 1, characterized in that: The ratio of Cas12 protein solution, guide RNA solution, ssDNA reporter probe solution, ribonuclease inhibitor, nuclease-free water, RAA reactant and buffer was 2:2:1:1:22:10:2 by volume; The molar concentration of the solution of the Cas12 protein is 200nM; The molar concentration of the guide RNA solution is 200 nM; The molar concentration of the ssDNA reporter probe solution is 200 nM; The concentration of the ribonuclease inhibitor is 40 U / μL.

3. The use according to claim 1, characterized in that: The sequence of the guide RNA is shown in SEQ ID NO.

4.

4. The use according to claim 1, characterized in that: The ssDNA reporter probe is FAM-TTATT-BHQ1.

5. The use according to claim 1, characterized in that: The incubation temperature is 36°C-38°C, and the incubation time is 25min-35min; The fluorescence intensity was detected using an enzyme marker, with an excitation wavelength of 480nm-500nm and an emission wavelength of 510nm-540nm.

6. The use according to claim 1, characterized in that: The cDNA sequence is shown as SEQ ID NO.

1.

7. The use according to claim 1, characterized in that: The nucleotide sequence of the upstream primer is shown as SEQ ID No.

2.

8. The use according to claim 1, characterized in that: The nucleotide sequence of the downstream primer is shown in SEQ ID No.3.

Images