A method for constructing a visual mouse model for real-time monitoring of lung adenocarcinoma ferroptosis process and application

By constructing a visualized mouse model, the process of ferroptosis in lung adenocarcinoma can be monitored in real time, solving the problem of the inability to dynamically monitor ferroptosis in existing technologies, revealing the mechanism of ferroptosis, and providing new ideas and tools for drug development and tumor treatment.

CN119278901BActive Publication Date: 2026-03-17SHANGHAI CHEST HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-08
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient for real-time monitoring of dynamic changes in ferroptosis during lung adenocarcinoma. Traditional methods can only provide static data, which cannot meet the needs of in-depth research on the mechanisms of ferroptosis.

Method used

A visual mouse model was constructed to monitor ferroptosis in lung adenocarcinoma in real time through genetic engineering and fluorescent labeling techniques combined with in vivo imaging. This involved mating Acsl4IRES-LUC/+ mice, Hba1IRES-eGFP/+ mice, KrasLSL-G12D/+; p53LSL-R172H/+ mice, and lung-specific Sftpc-Cre mice to form Acsl4IRES-LUC/+; Hba1IRES-eGFP/+; KrasLSL-G12D/+; p53LSL-R172H/+; Sftpc-Cre mice (AHKPC mice). Fluorescent and luminescent labeling were implemented to observe ferroptosis-related factors in real time.

Benefits of technology

This study enabled real-time monitoring of ferroptosis in lung adenocarcinoma, revealed the mechanism of action of ferroptosis-related factors, provided tools for ferroptosis mechanism research and new drug development, and expanded the possibilities of tumor treatment, especially personalized treatment for lung adenocarcinoma.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119278901B_ABST
    Figure CN119278901B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of lung adenocarcinoma ferroptosis visualization, in particular to a method for constructing a visual mouse model for real-time monitoring of lung adenocarcinoma ferroptosis process and application. The present application discloses a method for constructing a mouse model carrying exogenous Luciferase (LUC) and eGFP fragments, using live imaging technology to monitor the changes of key markers of ferroptosis in lung adenocarcinoma cells in real time, revealing the dynamic changes of cell signaling network in the process of ferroptosis, and evaluating the influence of different interventions on ferroptosis. The visual mouse model for real-time monitoring of lung adenocarcinoma ferroptosis process provided by the present application can not only deeply explore the sensitivity and resistance mechanism of lung adenocarcinoma cells to ferroptosis, provide theoretical basis and technical support for the development of new therapies based on ferroptosis, but also evaluate the influence of different drugs on ferroptosis, providing a new idea for the treatment of lung adenocarcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of visualization technology for ferroptosis in lung adenocarcinoma, and in particular to a method for constructing and applying a visualized mouse model for real-time monitoring of the ferroptosis process in lung adenocarcinoma. Background Technology

[0002] Lung cancer is one of the leading causes of cancer death worldwide, with lung adenocarcinoma being its primary subtype, boasting consistently high incidence and mortality rates globally. Despite significant improvements in lung cancer treatment over the past decade, the five-year survival rate for lung adenocarcinoma patients remains only between 10% and 20%. The high mortality rate of lung adenocarcinoma is related to multiple factors, and its pathogenesis is complex, involving both genetic and environmental factors. With a deeper understanding of the biological behavior of lung adenocarcinoma, it has become clear that in addition to traditional chemotherapy, radiotherapy, and surgery, new therapeutic targets are needed to improve treatment efficacy.

[0003] In recent years, with a deeper understanding of cell death patterns, ferroptosis, as a novel iron-dependent regulated cell death mechanism, has attracted attention due to its association with the non-mutagenic mechanisms of lung adenocarcinoma development. Ferroptosis was first defined by Dixon et al. in 2012 as a novel cell death mechanism distinct from apoptosis and necrosis. Ferroptosis is closely related to elevated intracellular iron levels. Excessive iron ions catalyze intracellular lipid peroxidation, producing large amounts of lipid reactive oxygen species (ROS), which disrupt cell membrane integrity and ultimately lead to cell death. Furthermore, ferroptosis is also closely related to the activity of glutathione peroxidase 4 (GPX4), an important antioxidant enzyme. Decreased GPX4 activity leads to lipid ROS accumulation, thereby triggering ferroptosis. Ferroptosis's unique metabolic characteristics and biochemical mechanisms give it great potential for application in cancer treatment. Enhanced cellular metabolic activity can promote the production of more lipid peroxides in tumor cells; therefore, the induction of ferroptosis in tumor cells, especially in lung adenocarcinoma, has become a new hot topic in cancer research. Thus, ferroptosis may become a new therapeutic strategy, especially for patients who do not respond well to traditional treatments. However, to achieve this goal, we need to gain a deeper understanding of the specific mechanisms of ferroptosis in lung adenocarcinoma.

[0004] Although ferroptosis shows great potential in the treatment of lung adenocarcinoma, its specific mechanisms still require further investigation. Traditional ferroptosis research methods, such as cell viability assays and flow cytometry, can only provide static data and are difficult to monitor the dynamic changes during the ferroptosis process in real time. Therefore, it is particularly important to establish a model that can monitor the ferroptosis process in real time. Summary of the Invention

[0005] To address the aforementioned problems, the present invention aims to provide a method and application for constructing a visualized mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma. This invention employs a series of advanced molecular biology and biomedical techniques, including genetic engineering, cell culture, animal model construction, advanced fluorescent labeling techniques, and in vivo imaging techniques, to construct a visualized mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma. This model not only allows for real-time monitoring of the occurrence and development of ferroptosis but also assesses the influence of different factors on ferroptosis, providing a powerful tool for research on ferroptosis mechanisms and new drug development.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] The first objective of this invention is to provide a method for constructing a visualized mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma, comprising the following steps:

[0008] (S1) Connect Acsl4 (long-chain fatty acid coenzyme A ligase 4) IRES-LUC / + Mice were mated with wild-type mice to produce positive heterozygous mice;

[0009] (S2) Hba1 (hemoglobin subunit α1) IRES-eGFP / + Mice were mated with the positive heterozygous mice obtained in step (S1) to obtain Acsl4. IRES-LUC / + Hba1 IRES-eGFP / + Mice: AH mice;

[0010] (S3) Kras (Kirsten rat sarcoma virus oncogene homolog) LSL-G12D / + p53 LSL-R172H / + Mice were mated with AH mice prepared in step (S2) to obtain Acsl4. IRES-LUC / + Hba1 IRES-eGFP / + Kras LSL-G12D / + p53 LSL -R172H / + Mice: AHKP mice;

[0011] (S4) The lung-specific Sftpc-Cre mice (a transgenic mouse model in which Cre recombinase is inserted into the alveolar surfactant protein C gene locus) were mated with the AHKP mice prepared in step (S3) to obtain Acsl4 mice. IRES-LUC / + Hba1 IRES-eGFP / + Kras LSL-G12D / + p53 LSL-R172H / + Sftpc-Cre mice: AHKPC mice.

[0012] In one embodiment of the present invention, in step (S1), Acsl4 IRES-LUC / +In mice, the 3' end of the Acsl4 gene stop codon is inserted with a fluorescent reporter gene-LUC, and the 5' end of the fluorescent reporter group has an IRES site.

[0013] In one embodiment of the present invention, in step (S1), Acsl4 IRES-LUC / + The mice were F0 generation Acsl4 IRES-LUC / + Mice.

[0014] In one embodiment of the present invention, in step (S2), Hba1 IRES-eGFP / + In mice, the 3' end of the stop codon of the Hba1 gene is inserted with the fluorescent reporter gene -eGFP, and the 5' end of the fluorescent reporter group is equipped with an IRES site.

[0015] In one embodiment of the present invention, in step (S2), male Hba1 is selected. IRES-eGFP / + Mice were mated with female positive heterozygous mice.

[0016] In one embodiment of the present invention, the female positive heterozygous mouse is a 6-8 week old F1 generation female positive heterozygous mouse.

[0017] In one embodiment of the present invention, in step (S2), the AH mouse is a 6-8 week old F1 generation AH mouse.

[0018] In one embodiment of the present invention, lung adenocarcinoma is spontaneously generated in AHKPC mice under lung-specific Cre recombinase expression.

[0019] The second objective of this invention is to provide an application of a visualized mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma in the study of ferroptosis mechanisms in lung adenocarcinoma. The visualized mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma is constructed using the method described above.

[0020] The third objective of this invention is to provide an application of a visualized mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma in the development of new drugs for the treatment of lung adenocarcinoma. The visualized mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma is constructed by the method described above.

[0021] This invention can reveal the role of ferroptosis-related factors in ferroptosis in lung adenocarcinoma and provide new ideas for the study of ferroptosis mechanisms and the development of new drugs. At the same time, it can explore more ferroptosis regulatory factors, which will not only help to understand the complexity of lung adenocarcinoma, but also provide more possibilities for tumor treatment and new ideas for personalized treatment of lung adenocarcinoma.

[0022] In this invention, Acsl4 IRES-LUC / +A mouse (referred to as "A mouse") is a transgenic mouse in which a fluorescent reporter group -LUC (Luciferase) is added to the 3' end of the stop codon of the Acsl4 gene and an IRES (Internal Ribosome Entry Site, which can be used to connect two genes so that they can be translated independently on the same mRNA molecule) site is set before the 5' end of the fluorescent reporter gene.

[0023] Hba1 IRES-eGFP / + The mouse (referred to as "H mouse") is a transgenic mouse obtained by adding the luminescent reporter group -eGFP to the 3' end of the stop codon of the mouse Hba1 gene and setting the IRES site before the 5' end of the luminescent reporter gene.

[0024] Acsl4 IRES-LUC / + Hba1 IRES-eGFP / + AH mice are transgenic mice obtained by simultaneously adding a fluorescent reporter group -LUC (Luciferase) to the 3' end of the stop codon of the mouse Acsl4 gene and setting an IRES site before the 5' end of the fluorescent reporter gene; and adding a luminescent reporter group -eGFP to the 3' end of the stop codon of the mouse Hba1 gene and setting an IRES site before the 5' end of the luminescent reporter gene.

[0025] Kras LSL-G12D / + p53 LSL-R172H / + The mouse (referred to as "KP mouse") is a transgenic mouse obtained by simultaneously performing a G12D point mutation in the Kras gene (G12D point mutation means that glycine (G) at the 12th amino acid position of the Kras gene is replaced by aspartic acid (D)) and inserting LSL sequences (Lox-Stop-Lox sequences) at both ends of the gene; and performing an R172H point mutation in the p53 gene (R172H point mutation means that arginine (R) at the 172nd amino acid position of the p53 gene is replaced by histidine (H)) and inserting LSL sequences at both ends of the gene.

[0026] Acsl4 IRES-LUC / + Hba1 IRES-eGFP / + Kras LSL-G12D / + p53 LSL-R172H / +AHKP mice are transgenic mice obtained by simultaneously adding a fluorescent reporter group -LUC to the 3' end of the stop codon of the mouse Acsl4 gene and setting an IRES site before the 5' end of the fluorescent reporter gene; adding a luminescent reporter group -eGFP to the 3' end of the stop codon of the mouse Hba1 gene and setting an IRES site before the 5' end of the luminescent reporter gene; performing a G12D point mutation on the mouse Kras gene and inserting LSL sequences at both ends of the gene; and performing an R172H point mutation on the mouse p53 gene and inserting LSL sequences at both ends of the gene.

[0027] Lung-specific Sftpc-Cre mice are transgenic mice obtained by inserting Cre recombinase into the promoter region of the Sftpc gene (encoding surfactant protein C), thereby achieving specific expression of Cre recombinase in alveolar epithelial cells type II (ATII).

[0028] Acsl4 IRES-LUC / + Hba1 IRES-eGFP / + Kras LSL-G12D / + p53 LSL-R172H / + Sftpc-Cre mice (abbreviated as "AHKPC mice") are transgenic mice obtained by simultaneously adding a fluorescent reporter group -LUC to the 3' end of the stop codon of the mouse Acsl4 gene and setting an IRES site before the 5' end of the fluorescent reporter gene; adding a fluorescent reporter group -eGFP to the 3' end of the stop codon of the mouse Hba1 gene and setting an IRES site before the 5' end of the fluorescent reporter gene; performing a G12D point mutation on the mouse Kras gene and inserting LSL at both ends of the gene; performing an R172H point mutation on the mouse p53 gene and inserting LSL sequences at both ends of the gene; and inserting Cre recombinase into the promoter region of the mouse Sftpc gene.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] This invention aims to reveal the role of ferroptosis-related factors in ferroptosis in lung adenocarcinoma by constructing a visualized mouse model for real-time monitoring of ferroptosis, and to provide new ideas for ferroptosis mechanism research and new drug development. Further optimization of the visualization model can expand its application in other types of tumors, while exploring more ferroptosis regulatory factors. This will not only help understand the complexity of lung adenocarcinoma, but also provide more possibilities for tumor treatment and new ideas for personalized treatment of lung adenocarcinoma. Attached Figure Description

[0031] Figure 1Figure 1 shows the relationship between HBA1 / Hba1 and ACSL4 / Acsl4 gene expression and ferroptosis. A: HBA1 / Hba1 and ACSL4 / Acsl4 mRNA expression in human lung adenocarcinoma H1299 cells and mouse lung adenocarcinoma LLC cells are positively correlated with erastin concentration. B: HBA1 / Hba1 and ACSL4 / Acsl4 mRNA expression in human lung adenocarcinoma H1299 cells and mouse lung adenocarcinoma LLC cells are positively correlated with RSL3 concentration. C: Hba1 mRNA expression in mouse lung adenocarcinoma LLC cells is time-dependent on erastin. D: Acsl4 mRNA expression in mouse lung adenocarcinoma LLC cells is time-dependent on erastin. E: Hba1 mRNA expression in mouse lung adenocarcinoma LLC cells is time-dependent on RSL3. F: Acsl4 mRNA expression in mouse lung adenocarcinoma LLC cells is time-dependent on RSL3.

[0032] Figure 2 Figure 1 shows the relationship between HBA1 / Hba1 and ACSL4 / Acsl4 promoter activities and ferroptosis regulation. A: HBA1 / Hba1 and ACSL4 / Acsl4 promoter activities in human lung adenocarcinoma H1299 cells and mouse lung adenocarcinoma LLC cells are positively correlated with erastin concentration. B: HBA1 / Hba1 and ACSL4 / Acsl4 promoter activities in human lung adenocarcinoma H1299 cells and mouse lung adenocarcinoma LLC cells are positively correlated with RSL3 concentration. C: Hba1 promoter activity in mouse lung adenocarcinoma LLC cells is time-dependent on erastin. D: Acsl4 promoter activity in mouse lung adenocarcinoma LLC cells is time-dependent on erastin. E: Hba1 promoter activity in mouse lung adenocarcinoma LLC cells is time-dependent on RSL3. F: Acsl4 promoter activity in mouse lung adenocarcinoma LLC cells is time-dependent on RSL3.

[0033] Figure 3 This diagram illustrates the fluorescence and luminescence intensity results of control mice and AH mice; AB: In vivo imaging of mice showing the fluorescence intensity (A) of Luciferase (LUC) and the luminescence intensity (B) of GFP in control mice and AH mice; the mouse on the left is the control group, and the mouse on the right is Acsl4 with IRES-LUC. IRES-LUC / + and Hba1 with IRES-eGFP IRES-eGFP / + (AH) mice.

[0034] Figure 4Schematic diagram showing the macroscopic and fluorescence and luminescence intensity results of lung tissues from control mice and AHKPC mice; A: Macroscopic photographs of lung tissues, with the left side showing lung tissues from control mice and the right side showing macroscopic photographs from AHKPC mice, scale bar: 1cm; B: In vivo imaging of mice showing the fluorescence intensity of Luciferase (LUC) in lung tissues from control mice and AHKPC mice; C: In vivo imaging of mice showing the GFP luminescence intensity in lung tissues from control mice and AHKPC mice.

[0035] Figure 5 This is a schematic diagram showing the fluorescence and luminescence intensity of AHKPC mice before and after ferroptosis induction; AB: In vivo imaging of mice showing the fluorescence intensity (A) of Luciferase (LUC) and the luminescence intensity (B) of GFP in AHKPC mice before and after IKE treatment; the left side shows the fluorescence and luminescence of mice without IKE treatment, and the right side shows the fluorescence and luminescence of mice after IKE treatment.

[0036] Where *p < 0.05, **p < 0.01. Detailed Implementation

[0037] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0038] In the following embodiments, the specific steps of in vivo imaging and dissection of mice and collection of mouse lung tissue are as follows:

[0039] (1) Mouse in vivo imaging:

[0040] 1) Animal anesthesia: Mice were placed in an anesthesia induction chamber and anesthetized by inhalation with isoflurane at an initial concentration of approximately 4% and a maintenance concentration of approximately 2%. The respiratory rate of the mice was observed to ensure that an appropriate level of anesthesia was achieved.

[0041] 2) Imaging reagent injection: Administer an appropriate amount of D-luciferin (150 mg / kg) to mice via intraperitoneal injection. Allow 10-15 minutes after injection to allow the substrate to diffuse fully and be absorbed by the cells. For imaging preparation, carefully place the anesthetized mouse on the sample stage of the imaging system, ensuring it maintains its natural posture. Use a masking material to cover areas that do not need imaging to reduce background noise.

[0042] 3) Imaging: Adjust instrument parameters and set appropriate exposure time and wavelength range to obtain clear luminescence / fluorescence images. Begin data acquisition and record the distribution of luminescence / fluorescence signals within the mouse.

[0043] 4) Post-experimental treatment: After imaging, immediately return the mice to their cages and observe their recovery until they are fully awake. Clean the lab bench and disinfect all used equipment.

[0044] (2) Dissect and collect mouse lung tissue

[0045] 1) Animal preparation: Select healthy mice of the same age and sex, and AHKPC mice. Hold the mouse's torso firmly with your hand and quickly and decisively stretch the mouse's neck to dislocate the cervical spine. Ensure that the action is quick and forceful to ensure that the mouse immediately loses consciousness and avoids pain.

[0046] 2) Dissection: Clean the skin of the mouse's chest and abdomen with alcohol swabs to reduce the risk of infection. Make a small incision along the midline of the mouse's abdomen to expose the abdominal cavity. Carefully separate the abdominal muscles with surgical scissors to expose the diaphragm. Carefully cut the diaphragm to open the thoracic cavity, revealing the heart and lungs on both sides.

[0047] 3) Tissue Collection: Carefully separate the lung tissue using forceps and surgical scissors, taking care not to damage the lungs. Cut the trachea near the larynx to facilitate lung tissue removal. Gently remove the lung tissue from the thoracic cavity and place it on a sterile dissecting tray. Rinse the surface of the lung tissue with sterile saline to remove blood and other impurities.

[0048] 4) Fixation: The lung tissue is placed in a fixative (4% paraformaldehyde) to ensure that the tissue is completely immersed, which facilitates subsequent processing.

[0049] 5) Observation and recording: Use the naked eye to observe and photograph the appearance characteristics, including color, texture, shape, etc.

[0050] 6) Post-experiment handling: After ensuring the mice are lifeless, place the carcasses in a designated waste bag and dispose of them according to relevant regulations. Thoroughly clean the dissection area, disinfect all used instruments, and place discarded surgical materials and specimen bottles in designated waste bins.

[0051] Unless otherwise specified, all reagents used in the following embodiments are commercially available reagents, and all detection methods and techniques used are conventional detection methods and techniques in the art.

[0052] Example 1

[0053] This embodiment provides preliminary research on indicators of ferroptosis levels: ACSL4 and HBA1 can be used as indicators of ferroptosis levels.

[0054] Long-chain fatty acid coenzyme A ligase 4 (ACSL4) is an important enzyme that plays a central role in fatty acid metabolism. It catalyzes the conversion of fatty acids to acyl-CoA, a step crucial for fatty acid β-oxidation and biomembrane construction. ACSL4 plays an irreplaceable role, particularly in the CoA synthesis of long-chain polyunsaturated fatty acids (LC-PUFAs). Recent studies have also shown that ACSL4 plays a significant role in ferroptosis. ACSL4 expression levels are positively correlated with cellular sensitivity to ferroptosis, thus ACSL4 can serve as a potential biomarker for monitoring ferroptosis. Another important gene is HBA1, which encodes the hemoglobin α-chain. Although its primary function is related to oxygen transport, it has also shown some association in ferroptosis studies. HBA1 is considered an important downstream target of HIC1 (a known transcriptional repressor), which is activated under ferroptotic conditions and promotes the transcription of ferroptosis-related genes, including HBA1. HBA1 expression levels were also positively correlated with the progression of ferroptosis, which further supports the idea that HBA1 may serve as a biomarker for ferroptosis.

[0055] To verify whether ACSL4 and HBA1 can serve as effective indicators of ferroptosis, researchers conducted experiments to observe changes in the expression of these genes in human lung adenocarcinoma H1299 and mouse lung adenocarcinoma LLC cells after treatment with ferroptosis inducers such as erastin (which induces ferroptosis by inhibiting System Xc-) and RSL3 (which induces ferroptosis by directly inhibiting glutathione peroxidase 4). The results showed that the expression of both ACSL4 / ACSL4 and HBA1 / Hba1 mRNA exhibited concentration-dependent effects on erastin and RSL3 treatment. Figure 1 This finding (A-1B) suggests that the expression levels of these two genes during ferroptosis may be proportional to the degree of intracellular ferroptosis. Furthermore, in mouse lung adenocarcinoma LLC cells, the expression of Hba1 and Acsl4 mRNA also showed a time-dependent relationship with erastin and RSL3 treatment. Figure 1 (C-1F). This phenomenon suggests that, in addition to concentration effects, time factors may also influence the performance of these two genes as biomarkers of ferroptosis. These data collectively support the potential of ACSL4 and HBA1 as biomarkers in the process of ferroptosis.

[0056] Therefore, based on the investigation of changes in ACSL4 / Acsl4 and HBA1 / Hba1 mRNA expression, the promoter activities of these genes were further explored to better understand their potential roles in ferroptosis. Experimental results showed that in human lung adenocarcinoma H1299 cells and mouse lung adenocarcinoma LLC cells, the promoter activities of ACSL4 / Acsl4 and HBA1 / Hba1 genes increased with increasing concentrations of the ferroptosis inducers erastin and RSL3. Figure 2 (A-2B). This finding provides molecular-level evidence that the enhanced transcription initiation activity of these genes under ferroptosis conditions may be due to certain regulatory elements in the promoter regions responding to changes in intracellular signaling pathways, leading to enhanced binding of transcription enhancers or transcription factors. Furthermore, in mouse lung adenocarcinoma LLC cells, the promoter activity of the Hba1 and Acsl4 genes also showed a significant time-dependent effect after different time periods of exposure to erastin and RSL3. Figure 2 (C-2F). This means that the activity of the promoter regions of these genes gradually increases with prolonged exposure to ferroptosis inducers, consistent with previously observed time-dependent mRNA expression levels. These results suggest that, at the transcriptional level, increased expression levels of ACSL4 / Acsl4 and HBA1 / Hba1 can reflect the occurrence and development of ferroptosis to some extent. Specifically, changes in promoter activity may reflect early events in the cellular response to ferroptosis inducers, while subsequent changes in mRNA expression levels represent the sustained effects of this response. Therefore, ACSL4 / Acsl4 and HBA1 / Hba1 are not only potential biomarkers of ferroptosis but may also be involved in the regulatory mechanisms of ferroptosis.

[0057] Example 2

[0058] This embodiment provides a method for constructing a visualized mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma.

[0059] (S1) Commissioned Nanmo Biotechnology to construct Acsl4 IRES-LUC / + Mouse (Mouse A);

[0060] Among them, Acsl4 IRES-LUC / + A mouse (referred to as "A mouse") is a transgenic mouse obtained by adding a fluorescent reporter group -LUC to the 3' end of the stop codon of the Acsl4 gene and setting an IRES site before the 5' end of the fluorescent reporter gene.

[0061] Nanmo Biotechnology was commissioned to construct Hba1 IRES-eGFP / + Mice (H mice);

[0062] Hba1 IRES-eGFP / +The mouse (referred to as "H mouse") is a transgenic mouse obtained by adding the luminescent reporter group -eGFP to the 3' end of the stop codon of the mouse Hba1 gene and setting the IRES site before the 5' end of the luminescent reporter gene.

[0063] In this study, mice A and H were heterozygous, retaining wild-type alleles while inserting the exogenous reporter gene. Furthermore, the fluorescent insertion site was located at the 3' end of the stop codons of the Acsl4 and Hba1 genes, with an IRES site preceding the 5' end of the fluorescent reporter gene. This design aimed to ensure that the translation of Acsl4 and Hba1 mRNA would not be affected while the endogenous promoters of Acsl4 and Hba1 functioned normally, thereby minimizing the impact on mouse development, growth, and ferroptosis itself.

[0064] (S2) F0 generation A mice were mated with wild-type mice to obtain positive heterozygous mice;

[0065] (S3) Cross the H mice (male) from step (S1) with the positive heterozygous mice (female) from step (S2) to obtain mice carrying Acsl4. IRES-LUC / + and Hba1 IRES-eGFP / + Acsl4 IRES-LUC / + Hba1 IRES-eGFP / + Mice (AH mice) (6-8 week old F1 generation mice were used for subsequent experiments);

[0066] In this study, AH mice were observed using a mouse in vivo imaging system. In AH mice, significantly increased LUC fluorescence intensity and GFP luminescence intensity were observed compared to the control group (wild-type mice). Figure 3 (A-3B) This indicates that a model for visualizing whole-organ ferroptosis using a bioluminescent / fluorescent dual-label has been successfully constructed. This model allows researchers to monitor changes in ferroptosis-related biomarkers throughout the entire organ in real time.

[0067] (S4) Combine the AH mice obtained in step (S3) with the stably established Kras mice. LSL-G12D / + p53 LSL-R172H / + Acsl4 was obtained by crossbreeding mice (KP mice, purchased from the Jackson Laboratory in the United States). IRES-LUC / + Hba1 IRES-eGFP / + Kras LSL-G12D / + p53 LSL -R172H / + (AHKP) mice (due to the presence of the "Stop" sequence, the Kras strain is commonly used) LSL-G12D and p53 LSL-R172H (It cannot produce effector proteins in the absence of Cre recombinase);

[0068] (S5) The AHKP mice obtained in step (S4) were crossed with lung-specific Sftpc-Cre mice (transgenic mice obtained by inserting Cre recombinase into the mouse alveolar surfactant protein C gene locus; purchased from Shanghai Southern Model Biotechnology Co., Ltd.; catalog number NM-KI-18020) to obtain Acsl4. IRES-LUC / + Hba1 IRES-eGFP / + Kras LSL-G12D / + p53 LSL-R172H / + Sftpc-Cre mice (AHKPC mice).

[0069] These mice spontaneously developed lung adenocarcinoma under lung-specific Cre recombinase expression. Researchers compared lung tissue from control groups (wild-type mice) and AHKPC mice, finding that the lungs of AHKPC mice were firmer, had irregular borders, an uneven surface, and prominent nodules. Figure 4 A), indicating that lung cancer had already occurred in AHKPC mice. Figure 4 A). Furthermore, compared to the control group, the fluorescence intensity of Luciferase (LUC) and the luminescence intensity of GFP in the lung tissue of AHKPC mice were significantly increased ( Figure 4 B-4C) further confirmed the successful construction of the AHKPC model and its application value in subsequent visual monitoring of ferroptosis levels.

[0070] To further validate the effectiveness of the constructed visualized mouse model (AHKPC) for real-time monitoring of ferroptosis in lung adenocarcinoma, researchers treated mice with the in vivo ferroptosis-inducing drug IKE and observed the fluorescence intensity of LUC and GFP using in vivo imaging. Compared with mice not treated with IKE, the fluorescence intensity of LUC and GFP in IKE-treated AHKPC mice was significantly increased. Figure 5 (A-5B). This demonstrates that the AHKPC model can indeed effectively monitor the level of ferroptosis and provides a powerful tool for studying the mechanisms of ferroptosis and its application in tumor treatment.

[0071] The establishment of a visualized mouse model of ferroptosis in lung adenocarcinoma (AHKPC) not only has significant scientific value—by monitoring the dynamic changes of ferroptosis in lung adenocarcinoma in real time, we can gain a deeper understanding of the mechanisms of ferroptosis and its role in lung cancer development, providing new targets for clinical treatment—but also possesses significant clinical translational potential. Using this model for screening ferroptosis-related drugs can accelerate the discovery of potential effective treatments and shorten the time cycle from basic research to clinical application. Furthermore, this invention demonstrates the advantages of multidisciplinary collaboration, combining knowledge from molecular biology, genetics, and imaging, promoting interdisciplinary cooperation and development. Using the AHKPC mouse model constructed through CRISPR / Cas9 technology and an ES cell targeting strategy, researchers can monitor the occurrence and development of ferroptosis in real time in vivo using bioluminescence and fluorescence imaging techniques, providing an unprecedented opportunity to study the role of ferroptosis in tumor progression.

[0072] It should be noted that, in this invention, the nucleotide sequence of Acsl4 is specifically referenced from NCBI ReferenceSequence:NM_019477.3;

[0073] For the specific nucleotide sequence of Hba1, please refer to NCBI Reference Sequence: NM_008218.2;

[0074] For the specific nucleotide sequence of p53, please refer to NCBI Reference Sequence: NM_011640.4;

[0075] For the specific nucleotide sequence of Kras, please refer to NCBI Reference Sequence: NM_001403240.1;

[0076] For the specific nucleotide sequence of Sftpc, please refer to NCBI Reference Sequence: NM_011359.2;

[0077] The nucleotide sequence of EGFP is shown in SEQ ID NO.1 (5'-3'):

[0078] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

[0079] The nucleotide sequence of LUC is shown as SEQ ID NO.2 (5'-3'):

[0080]

[0081] The nucleotide sequence of IRES is shown in SEQ ID NO.3(5'-3'):

[0082] GCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCCTGGCCCTGTCTTCTTGACGA GCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACA GGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGA AGGTACCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACC

[0083] The nucleotide sequence of lox is shown in SEQ ID NO.4 (5'-3'):

[0084] ATAACTTCGTATAGCATACATTATACGAAGTTAT

[0085] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the interpretation of the present invention, without departing from the scope of the invention, should be within the protection scope of the present invention.

Claims

1. A method for constructing a visual mouse model for real-time monitoring of lung adenocarcinoma ferroptosis process, characterized by, The method comprises the following steps: (S1) Acsl4 IRES-LUC / + The mice were mated with wild-type mice to obtain positive heterozygous mice. (S2) breeding the Hba1 IRES-eGFP / + The mice obtained in step (S1) are mated with the positive heterozygous mice to obtain Acsl4 IRES -LUC / + ; Hba1 IRES-eGFP / + Mice: AH mice; (S3) breeding the Kras LSL-G12D / + ; p53 LSL-R172H / + mice with the AH mice prepared in step (S2) to obtain Acsl4 IRES-LUC / + ; Hba1 IRES-eGFP / + ; Kras LSL-G12D / + ; p53 LSL-R172H / + mice: AHKP mice (S4) Breeding the lung-specific Sftpc-Cre mice with the AHKP mice prepared in step (S3) to obtain Acsl4 IRES -LUC / + ; Hba1 IRES-eGFP / + ; Kras LSL-G12D / + ; p53 LSL-R172H / + ; Sftpc-Cre mice: AHKPC mice.

2. The method for constructing a visual mouse model for monitoring the ferroptosis process of lung adenocarcinoma in real time according to claim 1, wherein, In step (S1), Acsl4 IRES-LUC / + In mice Acsl4 A fluorescent reporter gene-LUC was inserted 3' to the gene stop codon, and an IRES site was placed 5' to the fluorescent reporter.

3. The method for constructing a visual mouse model for monitoring the ferroptosis process of lung adenocarcinoma in real time according to claim 1, wherein, In step (S1), Acsl4 IRES-LUC / + Mice were F0 generation Acsl4 IRES-LUC / + Mice.

4. The method for constructing a visual mouse model for monitoring the ferroptosis process of lung adenocarcinoma in real time according to claim 1, characterized in that, In step (S2), Hba1 IRES-eGFP / + In mice Hba1 A luminescent reporter gene, eGFP, was inserted 3' to the stop codon of the gene, and an IRES site was placed 5' to the luminescent reporter.

5. The method for constructing a visual mouse model for monitoring the ferroptosis process of lung adenocarcinoma in real time according to claim 1, wherein, In step (S2), male Hba1 IRES-eGFP / + Mice were mated with female positive heterozygous mice.

6. The method for constructing a visual mouse model for monitoring the ferroptosis process of lung adenocarcinoma in real time according to claim 3, wherein, The female positive heterozygote mice are 6-8-week-old F1 generation female positive heterozygote mice.

7. The method for constructing a visual mouse model for monitoring the ferroptosis process of lung adenocarcinoma in real time according to claim 1, wherein, In step (S2), the AH mice are 6-8-week-old F2 generation AH mice.

8. The method according to claim 1, wherein, The AHKPC mice spontaneously produce lung adenocarcinoma under the expression of lung-specific Cre recombinase.

9. The application of a visual mouse model for real-time monitoring of lung adenocarcinoma ferroptosis process in the research of lung adenocarcinoma ferroptosis mechanism. The visual mouse model for monitoring the ferroptosis process of lung adenocarcinoma in real time is constructed by the method in any one of claims 1-8.

10. The use of a visual mouse model for real-time monitoring of the ferroptosis process of lung adenocarcinoma in the development of new drugs for the treatment of lung adenocarcinoma, characterized by, The visual mouse model for monitoring the ferroptosis process of lung adenocarcinoma in real time is constructed by the method in any one of claims 1-8.

Citation Information

Patent Citations

  • Application of ferroptosis inducer in preparation of KRAS G12C inhibitor drug-resistant tumor treatment drug

    CN117582503A

  • Application method of circular RNA in gastric cancer metastasis prediction and treatment

    CN118272528A