Brown planthopper n1cp6 protein and its coding gene in regulating plant resistance to brown planthopper

By silencing or overexpressing the NlCP6 gene of the brown planthopper in rice, RNA interference technology was used to enhance rice's resistance to the brown planthopper, solving the problems of pesticide resistance and environmental pollution, and achieving effective biological control.

CN119285733BActive Publication Date: 2026-06-26WUHAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411585069.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-07
Publication Date
2026-06-26
Estimated Expiration
2044-11-07

Smart Images

  • Figure CN119285733B_ABST
    Figure CN119285733B_ABST
Patent Text Reader

Abstract

The application discloses a kind of Nilaparvata lugens NlCP6 proteins and its coding gene in the application of regulating plant resistance to Nilaparvata lugens, it is related to the genetic engineering prevention and control technical field of rice Nilaparvata lugens.The application can significantly inhibit the growth and development of Nilaparvata lugens by inhibiting the expression of the coding gene of NlCP6 protein in Nilaparvata lugens;in view of the overexpression of Nilaparvata lugens NlCP6 gene, the overexpression vector of the gene is constructed and is transferred into rice plant, so that the resistance of the plant to Nilaparvata lugens is greatly improved, and the weight gain and survival rate of Nilaparvata lugens after feeding the transgenic plant are significantly reduced.The application method provided by the application shows that Nilaparvata lugens NlCP6 gene plays a very important role in improving the Nilaparvata lugens resistance of rice and inhibiting the growth and development of Nilaparvata lugens, and has wide application prospect;it has great application value for reducing pesticide use, maintaining ecological balance and sustainable development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering control technology for rice brown planthopper, and particularly to the application of the brown planthopper NlCP6 protein and its encoding gene in regulating plant resistance to brown planthopper. Background Technology

[0002] Brown planthoppers, belonging to the family Plantipodidae in the order Hemiptera, are one of the major pests of rice. They are monophagous pests whose piercing-sucking mouthparts can penetrate the plant to feed on the phloem sap, causing a reduction in the number of panicles and grains. Severe infestations can lead to large-scale rice death, a phenomenon known as "planthopper fire," resulting in complete crop failure. Brown planthoppers cause an annual reduction of approximately 1 to 1.5 billion kilograms of rice yield, equivalent to billions of yuan in economic losses. Currently, insecticides are commonly used to control brown planthoppers; however, the extensive use of pesticides has led to the development of pesticide resistance (Nagata, 1982; Lakshmi et al., 2010). Furthermore, pesticide spraying is not only harmful to humans and livestock but also causes serious environmental pollution. Therefore, actively developing and applying biological control technologies for brown planthoppers is of great significance for the scientific and effective control of their damage and for ensuring food and environmental safety.

[0003] RNA interference (RNAi) refers to the phenomenon of efficient and specific degradation of homologous mRNA mediated by double-stranded RNA. Since its discovery, it has rapidly developed into an effective tool for gene function research and is now widely used in insect gene research. Microinjection is a method that uses a microinjector to inject in vitro synthesized dsRNA into specific sites on insects. This method allows for precise control of the injection volume and enables specific observation of the effects of reduced expression levels of specific genes on the brown planthopper. It is one of the most widely used introduction methods (Ober and Jockusch, 2006). Using genetic engineering technology to enhance rice resistance to brown planthoppers is of great significance for the breeding and cultivation of new rice varieties resistant to brown planthoppers. Summary of the Invention

[0004] This invention is the first to discover the important role of the NlCP6 protein in regulating plant resistance to brown planthoppers and inhibiting their growth, and provides the application of the NlCP6 protein and its encoding gene in regulating plant resistance to brown planthoppers. Inhibiting the expression of the NlCP6 gene in brown planthoppers can effectively reduce their survival ability, while overexpressing the NlCP6 gene in plants can effectively improve plant resistance to brown planthoppers. This is achieved through the following techniques.

[0005] In a first aspect, the present invention provides the application of the brown planthopper NlCP6 protein or its encoding gene in improving brown planthopper resistance in rice, wherein the amino acid sequence of the brown planthopper NlCP6 protein is as shown in SEQ ID NO.1, or is an amino acid sequence of the amino acid sequence shown in SEQ ID NO.1 with one or more amino acids substituted, deleted and / or added, and having the same function as the protein composed of the amino acid sequence shown in SEQ ID NO.1.

[0006] Furthermore, a method to improve the resistance of rice to brown planthoppers is to overexpress the gene encoding the NlCP6 protein of the brown planthopper in the rice.

[0007] In a second aspect, the present invention provides the application of an inhibitory factor in inhibiting the growth of brown planthoppers, wherein the inhibitory factor is a dsRNA that inhibits the expression of the gene encoding the NlCP6 protein of the brown planthopper, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.2.

[0008] Furthermore, the method of inhibiting the growth of brown planthoppers is as follows: inhibiting the expression of the gene encoding the brown planthopper NlCP6 protein; the amino acid sequence of the brown planthopper NlCP6 protein is as shown in SEQ ID NO.1, or is an amino acid sequence of the amino acid sequence shown in SEQ ID NO.1 with one or more amino acids substituted, deleted and / or added, and having the same function as the protein composed of the amino acid sequence shown in SEQ ID NO.1.

[0009] A third aspect of the present invention provides a method for improving the resistance of rice to brown planthoppers by overexpressing the gene encoding the NlCP6 protein of the brown planthopper in the rice.

[0010] In a fourth aspect, the present invention provides a method for inhibiting the growth of brown planthoppers by inhibiting the expression of the gene encoding the NlCP6 protein of the brown planthopper, wherein the amino acid sequence of the NlCP6 protein of the brown planthopper is as shown in SEQ ID NO.1, or is an amino acid sequence of the amino acid sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more amino acids, and having the same function as the protein composed of the amino acid sequence shown in SEQ ID NO.1.

[0011] Furthermore, the nucleotide sequence of the gene encoding the brown planthopper NlCP6 protein is as shown in SEQ ID NO.3, or is a nucleotide sequence of SEQ ID NO.3 with one or more amino acids substituted, deleted and / or added, and which encodes a protein with the same function as the nucleotide sequence of SEQ ID NO.3.

[0012] In a fifth aspect, the present invention provides a repressor for inhibiting the expression of the gene encoding the NlCP6 protein in the brown planthopper, said repressor being dsRNA, the nucleotide sequence of said dsRNA being shown in SEQ ID NO.2.

[0013] Adding dsNlCP6 (dsRNA) to the solvent can reduce pesticide use; transferring dsNlCP6 into rice can effectively inhibit brown planthopper feeding.

[0014] In a sixth aspect, the present invention provides a biological material, said biological material being an expression cassette, a vector, or a transgenic cell; said biological material comprising a gene encoding the NlCP6 protein of the brown planthopper, or comprising dsRNA.

[0015] In a seventh aspect, the present invention provides a method for preparing transgenic rice resistant to brown planthoppers, wherein the transgenic rice resistant to brown planthoppers is obtained by using the above-described method for improving the brown planthopper resistance of rice.

[0016] Compared with existing technologies, the advantages of this invention are: This invention is the first to discover a significant correlation between the encoding gene of the NlCP6 protein in brown planthoppers and their growth and development. By inhibiting the expression of the NlCP6 protein encoding gene in brown planthoppers, the growth and development of brown planthoppers can be significantly suppressed. Specifically, based on the cDNA sequence of the NlCP6 protein encoding gene in brown planthoppers, RNAi technology using microinjection of dsRNA is employed to silence the NlCP6 gene, resulting in a lethal effect in brown planthoppers, with the survival rate decreasing over time.

[0017] This invention also targets the overexpression of the NlCP6 gene in brown planthoppers. An overexpression vector for this gene was constructed and transformed into rice plants, significantly improving the plants' resistance to brown planthoppers. The weight gain and survival rate of brown planthoppers after feeding on these transgenic plants were significantly reduced.

[0018] The above findings and their applications in related technological fields demonstrate that the NlCP6 gene of the brown planthopper plays a very important role in improving the resistance of the brown planthopper in rice and inhibiting its growth and development, and has broad application prospects; it also has significant application value in reducing pesticide use, maintaining ecological balance and sustainable development. Attached Figure Description

[0019] Figure 1 The image shows the cloning results of the NlCP6 gene provided in Example 1 of this invention; wherein, the first lane is the marker, the second lane is the NlCP6 ORF, and the third lane represents the NlCP6 ORF sequence after removing the signal peptide.

[0020] Figure 2This is an agarose gel electrophoresis image of dsNlCP6 and dsGFP provided in Example 2 of the present invention.

[0021] Figure 3 The results of the relative expression of the NlCP6 gene after microinjection provided in Example 3 of the present invention are shown; where CK is the uninjected brown planthopper, dsGFP is the brown planthopper injected with dsGFP, and 1-5 are brown planthoppers injected with NlCP6 for different days; different lowercase letters indicate P<0.05, which is a significant difference.

[0022] Figure 4 The results of the analysis of survival rate and weight gain of brown planthoppers after microinjection provided in Example 4 of the present invention are as follows: A is the result of the survival rate of brown planthoppers placed on rice after microinjection and counted daily; B is the result of the weight gain of female brown planthoppers after they emerge as adults and weigh them over two days.

[0023] Figure 5 The brown planthoppers fed on Nipponbare and Nipponbare were used as control groups in Example 6 of this invention. NlCP6 Phenotypic analysis results of plants; where A represents wild-type Nipponbare and Nipponbare. NlCP6 Analysis results of NlCP6 expression in plants: B shows the seedling resistance identification results of NlCP6 overexpressing transgenic T2 generation positive lines against brown planthopper; C shows the transgenic parent plants Nipponbare and Nipponbare feeding on the brown planthopper. NlCP6 Analysis of the weight gain of the transgenic plants two days after insect infestation. D represents the brown planthoppers feeding on the transgenic parent plants Nipponbare and Nipponbare. NlCP6 Results of brown planthopper survival rate analysis within ten days after transgenic plants. Detailed Implementation

[0024] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] Example 1: Cloning of the NlCP6 gene in brown planthopper

[0026] Twenty brown planthoppers of biotype 1 were collected, and total RNA was extracted and reverse-engineered into cDNA.

[0027] Primers were designed based on the cDNA sequence, and the 5' and 3' end sequences of the candidate gene were obtained using the TaKaRa 5' and 3' RACE kit. The transcription start and termination sites of the candidate gene were determined, and the full-length cDNA sequence of the gene was assembled.

[0028] Primers NlCP6-F and NlCP6-R were resynthesized based on the full-length cDNA sequence, and the full-length cDNA of NlCP6 was amplified, as follows: Figure 1 As shown. Figure 1 In the diagram, the first lane is the marker, the second lane is the NlCP6 ORF, and the third lane represents the NlCP6 ORF sequence after removing the signal peptide. ORF sequencing was performed, and the nucleotide sequence is shown in SEQ ID NO.1.

[0029] The gene sequence encoding the NlCP6 protein is shown in SEQ ID NO.3.

[0030] Primer NlCP6-F: 5'-atgagaggaattcaactagt-3', as shown in SEQ ID NO.4.

[0031] Primer NlCP6-R: 5'-tagttctggttgttcctcag-3', as shown in SEQ ID NO.5.

[0032] Example 2: Preparation of dsRNA (dsNlCP6) for silencing the NlCP6 gene in brown planthoppers, and dsGFP gene for control.

[0033] 1. Using the cDNA obtained in Example 1 as a template, PCR amplification was performed using the following primers dsNlCP6-F and dsNlCP6-R to obtain the PCR amplification product.

[0034] Forward primer dsNlCP6-F: 5'-taatacgactcactatagggagaagcccagcaccctcggcagga-3', as shown in SEQ ID NO.6.

[0035] The reverse primer dsNlCP6-R: 5'-taatacgactcactatagggagagttgttcctcagtttctccac-3', as shown in SEQ ID NO.7.

[0036] The region containing the sequence “taatacgactcactatagggaga” is the T7 RNA polymerase promoter sequence.

[0037] 2. Using a GFP-containing plasmid as a template, perform PCR amplification with the following primers dsGFP-F and dsGFP-R to obtain the PCR amplification product.

[0038] Forward primer dsGFP-F: 5'-taatacgactcactatagggcggact-3', as shown in SEQ ID NO.8.

[0039] Reverse primer dsGFP-R: 5'-taatacgactcactatagggcgatgc-3', as shown in SEQ ID NO.9.

[0040] The region containing the sequence “taatacgactcactataggg” is the T7 RNA polymerase promoter sequence.

[0041] 3. Recover the two amplification products described above, add primer A, and ligate them into the pMD18-T (TAKARA) vector. Send positive clones for sequencing and screen to obtain the correct clone plasmid. Use this clone plasmid as a template to amplify the product again using the primers described above. Purify and concentrate the amplification product to a concentration of 1 μg / μL. This product serves as the template for dsRNA synthesis.

[0042] 4. Add the reagents from Table 1 below to a 200 μL centrifuge tube according to the specified proportions; gently tap to mix, then centrifuge briefly. Place in a PCR instrument for amplification. The amplification program is: 37℃, 4 h; 75℃, 5 min; store at 16℃. Aspirate 1 μL and perform gel electrophoresis. Once the target band is detected, proceed to the next step.

[0043] Table 1

[0044]

[0045] 5. Add the reagents shown in Table 2 below to the centrifuge tubes to remove DNA and ssRNA.

[0046] Table 2

[0047]

[0048] Mix thoroughly, centrifuge briefly, and place in a PCR instrument at 37°C for 30 min. Then remove and add 1 μL of EDTA (Fementas), return to the PCR instrument, and incubate at 65°C for 5 min to terminate the reaction. Aspirate 1 μL, dilute 10-fold, and take 2 μL for gel electrophoresis. Measure the concentration of another 2 μL using a Nanodrop UV spectrophotometer.

[0049] If the detection band is a very single, bright band, such as Figure 2As shown, if the OD260 / 280 ratio is between 1.8 and 2.0, it indicates that the dsRNA is of good quality and can proceed to the next step. The nucleotide sequence of the dsRNA (dsNlCP6) used to silence the NlCP6 gene in the brown planthopper is shown in SEQ ID NO.2.

[0050] 6. Perform routine phenol-chloroform extraction to remove proteins. Adjust the concentration of dsRNA to 5 μg / μL, aliquot into 10 μL tubes, and store at -80℃.

[0051] Example 3: Microinjection of dsNlCP6 and dsGFP and effect detection

[0052] 1. Brown planthopper preparation: Take 30 females and 10 males and place them in a cup containing TN1 seedlings. After 24 hours, remove the adults. Let them hatch; after 20 days, they will become fourth instar nymphs, which can then be injected.

[0053] 2. Plate preparation: Weigh 1.5 g of agar powder and add it to 100 ml of water, boil, pour into a glass petri dish, and let it solidify for later use.

[0054] 3. Injection: Place 5-8 similarly sized worms in a test tube and anesthetize them with CO2 for 20 seconds. Then, pour the worms onto a 1.5% agar plate, abdomen facing upwards. Inject using a Nanoliter 2010 microinjector according to the instructions. The injection site is between the anterior and mesothorax. The injection volume is 46 nl (5 μg / μL).

[0055] 4. After injecting brown planthoppers with dsRNA, samples were taken starting from the first day after injection, with three samples taken each day for ten days; at the same time, uninjected brown planthoppers and those injected with dsGFP were taken as controls.

[0056] To verify changes in gene expression levels using qRT-PCR, the specific procedure was as follows: After sampling, RNA was extracted and reversed using the TAKARA PrimeScript RT reagent Kit with gDNA Eraser (catalog number RR047A) according to the instructions to obtain the reversed product. 5 μL of the obtained cDNA was diluted 10-fold with TE buffer and then subjected to real-time quantitative PCR as shown below. The PCR reaction was performed on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad) instrument, following the reaction system shown in Table 3 below.

[0057] Table 3

[0058]

[0059] Reaction conditions: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 5-10 s, TM (55-65℃) annealing extension for 30 s, repeat the last two steps for 40 cycles; finally, 65℃-95℃, increasing by 0.5℃ for 5 s, perform melting curve analysis to determine the specificity of the amplified product. Three technical replicates were performed for each sample, and amplification efficiency was measured for each PCR plate.

[0060] The results were analyzed using Bio-Rad CFX Manager. First, melting curves and QC (quality control) were analyzed to remove unqualified data. Gene expression analysis was performed using the software's built-in Gene Study function (1+E). -ΔΔCt Algorithm analysis.

[0061] internal reference gene actin primers:

[0062] Actin-F: 5'-gacaggatgcagaaggaaatca-3', as shown in SEQ ID NO.10.

[0063] Actin-R: 5'-gactcgtcgtactcctgctttg-3', as shown in SEQ ID NO.11.

[0064] NlCP6 quantitative primers:

[0065] NlCP6-1F: 5'-atcaacgaagtcccgccttt-3', as shown in SEQ ID NO.12.

[0066] NlCP6-1R: 5'- ggctggagtattgctcggtt-3', as shown in SEQ ID NO.13.

[0067] 5. Results are attached. Figure 3 As shown in the figure, compared with uninjected brown planthoppers and the control group injected with dsGFP, the relative expression level of the NlCP6 gene in the microinjected dsNlCP6 experimental group was significantly reduced from the first day of injection, showing a significant difference compared with the control (P<0.05). This indicates that microinjection of dsNlCP6 can induce the RNAi effect of the salivary gland secretion gene NlCP6 in brown planthoppers, leading to a significant decrease in gene expression.

[0068] Example 4: Phenotypic detection of brown planthopper after microinjection

[0069] 1. Survival rate test of brown planthopper in this embodiment

[0070] Brown planthoppers were divided into three groups: uninjected, injected with dsGFP, and injected with dsNlCP6. After revival, they were released back onto the rice plants. Ten planthoppers were tested each time, and the experiment was repeated five times.

[0071] The test results are as follows Figure 4 As shown in Figure A, it can be seen that after injection of dsNlCP6, the survival rate of brown planthoppers was significantly lower than that of brown planthoppers injected with dsGFP and those not injected, starting from the third day after injection.

[0072] 2. Survival rate test of brown planthopper in this embodiment

[0073] After injecting the three groups of brown planthoppers, place them back on the rice plants and wait for them to emerge. Weigh each brown planthopper that emerged on the first day, and then place it in a wax bag tied to the rice seedling. Two days later, remove the surviving brown planthoppers and weigh them again. The difference between the two weights is recorded as the planthopper's weight gain. Repeat this process with ten planthoppers each time, five times in total.

[0074] The test results are as follows Figure 4 As shown in Figure B, the weight gain of newly emerged brown planthoppers within 48 hours was analyzed. It was observed that the weight gain decreased after injection of dsNlCP6. This indicates that the reduced expression of the dsNlCP6 gene after injection affected the feeding of brown planthoppers, thus impacting their survival rate.

[0075] Example 5: Construction of a genetic transformation vector for overexpressing the NlCP6 gene in brown planthoppers

[0076] 1. ORF sequence amplification (removal of the signal peptide region): using the high-fidelity enzyme KOD Plus Neo (TOYOBO) and primer NlCP6. -SP -F and NlCP6 -SP -R, the template is a plasmid containing the NlCP6 gene, amplifying the ORF sequence of the NlCP6 gene.

[0077] Primer NlCP6 -SP -F: 5'-atgagcccagcaccctcggc-3', as shown in SEQ ID NO.14.

[0078] Primer NlCP6 -SP -R: 5'-gttctggttgttcctcagtt-3', as shown in SEQ ID NO.15.

[0079] 2. After PCR, take 2 μL for agarose gel electrophoresis. If the band is single, recover it directly; if there are extraneous bands, cut the gel and recover the fragment of the target size, approximately 0.7 kb. Since the KOD PLUS NEU amplification fragment does not have an A tail at the end, an A tail needs to be added before ligation into the vector.

[0080] 3. The pCXUN vector was digested and recovered using Xcm I enzyme to form T-termini, which were then ligated with the A-added product at 16°C overnight. Transformation was performed, and single clones were selected. The vector primers were UBIS and UBIA. PCR was used to verify the insert size; fragments approximately 1 kb in size were sent to the sequencing company.

[0081] Primer UBIS: 5'-tgtttcttttgtcgatgctcaccc-3', as shown in SEQ ID NO.16.

[0082] Primer UBIA: 5'-ttctatcgcggcttaacgtaattca-3', as shown in SEQ ID NO.17.

[0083] 4. Transform the correctly sequenced vector plasmid into Agrobacterium strain EHA105 using conventional electroporation.

[0084] Example 6: Functional verification of transgenic structures after NlCP6 overexpression

[0085] 1. Obtaining transgenic plants overexpressing NlCP6 mediated by Agrobacterium tumefaciens

[0086] The above-mentioned NlCP6 overexpression genetic transformation vector was introduced into Nipponbare rice using Agrobacterium EHA105-mediated genetic transformation (Hiei et al., 1994, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal 6:271-282).

[0087] 2. Brown planthoppers feeding on Japanese scorching sun NlCP6 Phenotypic verification of transgenic plants

[0088] After harvesting the seeds, the T2 generation homozygous transgenic plants of Nipponbare were subjected to... NlCP6 , Nipponbare NlCP6 The expression of the NlCP6 gene was detected by quantitative PCR using primers NlCP6-1F and NlCP6-1R, with Osactin as the internal control using primers Osactin-F and Osactin-R. Results are as follows: Figure 5 As shown in Figure A, the NlCP6 gene accumulates in large quantities in the transgenic plant.

[0089] Primer NlCP6-1F: 5'-gtgtgggaatgtcatctg-3', as shown in SEQ ID NO.18.

[0090] Primer NlCP6-1R: 5'-gctgctgtaatcactatca-3', as shown in SEQ ID NO.19.

[0091] Primer Osactin-F: 5'-gatcactgccttggctccta-3', as shown in SEQ ID NO.20.

[0092] Primer Osactin-R: 5'-gtactcagccttggcaatcc-3', as shown in SEQ ID NO.21.

[0093] The resistance of positive transgenic lines to brown planthoppers was identified using the seedling group method. Results are as follows: Figure 5 As shown in Figure B, 10 days after inoculation with brown planthoppers, the control variety Nipponbare died completely, while the transgenic positive lines overexpressing the NlCP6 vector still survived. This indicates that the NlCP6 gene has the function of enhancing rice resistance to brown planthoppers. Therefore, the brown planthopper gene NlCP6 can be applied in rice to breed rice varieties with resistance to brown planthoppers.

[0094] Twenty second-instar brown planthoppers of biotype I fed on Nipponbare and Nipponbare. NlCP6 The survival rate of the insects was determined by the number of days, and the experiment was repeated five times. The results are as follows: Figure 5 As shown in C, due to the transgenic plant Nipponbare... NlCP6 Increased resistance affected the feeding of brown planthoppers, significantly reducing their survival rate on day 9.

[0095] Newly emerged female brown planthoppers of biotype I were reared in Nipponbare. NlCP6 and Nippon Haru NlCP6 Two days later, weigh the worms, 10 worms each time. Repeat three times. Results are as follows. Figure 5 As shown in Figure D, the weight of brown planthoppers was also significantly reduced. These findings indicate that PIB14 can improve rice's resistance to brown planthoppers.

[0096] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. The application of the brown planthopper NlCP6 protein or its encoding gene in improving brown planthopper resistance in rice, characterized in that, The amino acid sequence of the NlCP6 protein of the brown planthopper is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The method to improve the resistance of rice to brown planthopper is to overexpress the gene encoding the NlCP6 protein of the brown planthopper in the rice.

3. The application of an inhibitory factor in inhibiting the growth of brown planthoppers, characterized in that, The inhibitor is a dsRNA that inhibits the expression of the gene encoding the NlCP6 protein of the brown planthopper, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.

2.

4. A method for improving the resistance of rice to brown planthoppers, characterized in that, The gene encoding the NlCP6 protein of the brown planthopper was overexpressed in the rice, and the amino acid sequence of the NlCP6 protein of the brown planthopper is shown in SEQ ID NO.

1.

5. A method for inhibiting the growth of brown planthoppers, characterized in that, The expression of the gene encoding the NlCP6 protein of the brown planthopper was suppressed, and the amino acid sequence of the NlCP6 protein of the brown planthopper is shown in SEQ ID NO.

1.

6. The method for inhibiting the growth of brown planthoppers according to claim 5, characterized in that, The nucleotide sequence of the gene encoding the NlCP6 protein of the brown planthopper is shown in SEQ ID NO.

3.

7. A method for preparing transgenic rice resistant to brown planthoppers, characterized in that, Using the method for improving brown planthopper resistance in rice as described in claim 4, transgenic rice with brown planthopper resistance was bred.