Purpureocillium lavendulum YMF1.00683 strain and application thereof
By developing the YMF1.00683 strain of Purpureocillium lavendulum, the threat of chemical agents to the environment and human and animal health is solved, and an efficient and safe bionecological preparation is provided, which significantly improves the peanut root knot nematode The killing effect has achieved environmentally friendly control of plant parasitic nematodes.
Patent Information
- Application Number
- CN202410555612.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-07
- Publication Date
- 2025-01-10
AI Technical Summary
In the prior art, chemical agents are used to prevent and control plant parasitic nematodes with high toxicity, environmental pollution and potential threats to human and animal health, resulting in a gradual decrease in their application in agricultural production and a lack of environmentally friendly sustainable governance methods.
Developed a strain of Purpureocillium lavendulum YMF1.00683 from Yunnan Province. This strain has efficient nematodecidial activity and is used to develop highly efficient bionematodecidial preparations. The strain was obtained through isolation, screening and molecular biological identification. , and a biotest model was conducted to verify its nematode killing ability.
YMF1.00683 strain showed significant peanut-killing nematode activity, originated from nature, has high safety in humans and animals, and can be used to develop highly efficient bionematodetic preparations, effectively shortening the lethality and survival life of nematodes, and is suitable for environmentally friendly plants. Parasitic nematode control.
Smart Images
Figure HDA0004825941430000011 
Figure HDA0004825941430000012 
Figure HDA0004825941430000021
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of biological pesticides, and in particular relates to a Purpureocillium lavendulum YMF1.00683 strain and an application thereof. Background Art
[0002] Plant parasitic nematodes include southern root-knot nematode (Meloidogyne incongnita), peanut root-knot nematode (Meloidogyne arenaria), pine wood nematode (Bursaphelenchus xylophilus), soybean cyst nematode (Heterodera glycines), etc., which cause global food production losses of up to 157 billion US dollars each year (Abad et al., 2008). Plant parasitic nematodes have a pivotal economic and ecological position in agricultural production, and the prevention and control of plant parasitic nematodes has received extensive attention due to their wide distribution, multiple hosts, strong pathogenicity, high yield reduction rate, rapid reproduction, and easy transmission.
[0003] At present, the main method for controlling plant parasitic nematodes is to apply chemical agents (Gamalero et al., 2020). Chemical nematicides are gradually fading out of the market due to their high toxicity, environmental pollution, and potential threats to human and animal health. In order to meet the growing demand for environmentally friendly and sustainable management of plant parasitic nematodes, biological control has been widely studied and applied as a safe and effective means (Diyapoglu et al., 2022; Ismail, 2014). Biological control of plant parasitic nematodes can be achieved by using many beneficial microbial groups (Silva, 2022). At present, nematophagous fungi have attracted widespread attention due to their outstanding nematode control effects, unique nematode killing methods, no pollution to the environment, no harm to humans and animals, and long-lasting effects. They have now become the main microbial resource for biological control of nematodes and play a vital role in nematode control management (Tranier, 2014). Therefore, the isolation and research of nematophagous fungi are of great significance. Summary of the invention
[0004] In order to overcome the problems in developing nematicidal biological preparations in the background technology, the present invention provides a Purpureocillium lavendulum YMF1.00683 strain and its application. The YMF1.00683 strain of the present invention is a wild-type Purpureocillium lavendulum isolated from Yunnan Province and preserved in the Institute of Microbiology, Chinese Academy of Sciences. The strain has high nematicidal activity and can be used to develop high-efficiency biological nematicidal preparations.
[0005] To achieve the above object, the present invention is implemented through the following technical solutions:
[0006] A Purpureocillium lavendulum YMF1.00683 strain, wherein the YMF1.00683 strain is deposited in the Institute of Microbiology, Chinese Academy of Sciences, with a deposit date of January 15, 2024 and a deposit number of CGMCC No.41038.
[0007] The YMF1.00683 strain was isolated from root-knot nematode eggs in Yunnan Province. By constructing a bioassay model of peanut root-knot nematodes (Meloidogyne arenaria) under its infection, it was found that the strain had a highly effective nematicidal activity.
[0008] The YMF1.00683 strain can be used to develop highly effective biological nematicide preparations.
[0009] Beneficial effects of the invention: The YMF1.00683 strain of the invention has highly effective nematicidal activity, especially has a significant effect in killing peanut root-knot nematodes, is derived from natural bacteria, has high safety for humans and animals, and can be used to develop highly effective biological peanut root-knot nematode killing preparations. BRIEF DESCRIPTION OF THE DRAWINGS
[0010] Figure 1 This is the colony picture of YMF1.00683 bacteria on the culture medium;
[0011] Figure 2 This is a comparison chart of the survival rate of peanut root-knot nematode M.arenaria;
[0012] Figure 3 This is a comparison of the death states of the peanut root-knot nematode M.arenaria. DETAILED DESCRIPTION
[0013] Example 1
[0014] The isolation and screening of Purpureocillium lavendulum YMF1.00683 strain is as follows:
[0015] 1) Isolation of root-knot nematode egg masses: Use a sterile dissecting needle to pick up mature egg masses from the surface of the tomato root knot, place the picked egg masses in a 300-mesh sieve, then rinse with ddH2O for 5-7 times and collect them in a sterile centrifuge tube;
[0016] 2) Surface disinfection of root-knot nematode egg masses: add an appropriate amount of chlorhexidine acetate to a centrifuge tube, place it on a rotary shaker for disinfection for 24 hours, wash the root-knot nematode egg masses with saline, add an appropriate amount of mercuric chloride, place it on a rotary shaker for disinfection, wash the egg masses with saline after mercuric chloride disinfection, take the saline used for the last rinse of the egg masses, evenly spread it on MM medium without antibiotics, and culture it at a constant temperature of 28°C. If no colonies grow on the medium, it proves that the surface of the egg masses is thoroughly disinfected;
[0017] 3) Isolation and purification of fungi in egg masses: Grind the root-knot nematode egg masses surface-sterilized in the previous step into a homogenate using an electric grinder, dilute with sterile water, spread 100 μL on MM medium without antibiotics, and culture at 28°C for 2-3 days (dilution and spreading method). Find purple fungal colonies, dig out the fungal masses containing the colonies and put them in an EP tube, add 1 mL of sterile water, vortex and oscillate, spread 100 uL of the suspension on MM medium without antibiotics, and culture at 28°C for 2-3 days. Repeat this step until a single purple colony appears.
[0018] Example 2
[0019] Molecular Biological Identification of Purpureocillium lavendulum YMF1.00683
[0020] A single purple colony was inoculated into 250 mL of MM medium and cultured at 28°C and 180 rpm for 5 days. The colony morphology was as follows: Figure 1 The genomic DNA of the fungus was extracted by CTAB method, the purity and concentration of DNA were detected by NanoDrop 2000, the integrity of DNA was detected by 1% agarose gel electrophoresis, the genome was used as a template, PCR amplification was performed using ITS universal primers, the product was sent for testing, and the sequencing results were compared to identify the fungus as Purple Sporophore.
[0021] The ITS rDNA sequence of strain YMF1.00683 is as follows:
[0022] ccccgttttggaagtaaaaaagtgtaacaaggtctccgttggtgaaccagcggagggatcattaccgagttatacaactccca
[0023] aacccactgtgaacccttacctcagttgcctcggcgggaccgccccggccgccgcgcaagcggcgccggactccaaggcgcccgccgc
[0024] agggacccaaaactcttttgcattacgcccaacggcgggaatttttttctctgagtgcataagcaaaacaaatgaatcaaaactttc
[0025] aacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcg
[0026] aatctttgaacgcacattgcgcccgccagcattctggcgggcatgcctgttcgagcgtcatttcaaccctcgagccccccgggggc
[0027] ctcggtgttgggggacggcacaccagccgcccccgaaatgcagtggcgacctcgccgcagcctcccctgcgtagtagcacacacctc
[0028] gcaccggagcgcggagacggtcacgccgtaaaacgcccaacttcttagagttgacctcggatcaggtaggaatacccgctgaactta
[0029] agcatatcaataaaaccggaaggaaaaatt
[0030] Experimental analysis: Bioassay of peanut root-knot nematode M.arenaria infected with YMF1.00683 strain
[0031] The experiment was conducted with the YMF1.00683 strain infected with peanut root-knot nematode M.arenaria as the experimental group and the normally cultured peanut root-knot nematode M.arenaria as the control group. The number of nematodes surviving each day was recorded and photos were taken to record the death status of the nematodes. Figure 2-3 As shown, Figure 2 This is a comparison chart of the survival rate of peanut root-knot nematode M.arenaria. Figure 3 This is a comparison of the death states of peanut root-knot nematode M.arenaria. Figure 2-3It can be seen that the YMF1.00683 strain has nematicidal ability, and the nematode lethal time and survival life span are shortened. For M.arenaria, YMF1.00683 exhibits nematicidal activity, and its hyphae grow out of the nematode body, which is nearly 2 times higher, and its half-lethal time is advanced to the sixth day of the co-cultivation stage, indicating that the nematicidal activity of YMF1.00683 is sensitive to plant parasitic nematodes.
Claims
1. A Purpureocillium lavendulum YMF1.00683 strain, characterized in that: The YMF1.00683 strain was deposited at the Institute of Microbiology, Chinese Academy of Sciences on January 15, 2024, with the deposit number CGMCC No.41038.
2. Use of the YMF1.00683 strain described in claim 1 in highly nematocidal biological preparations.
3. The use according to claim 2, characterized in that: The application of the YMF1.00683 strain in a biological preparation with high activity in killing peanut root-knot nematodes.