Wild type paenibacillus, high-efficiency electroporation transformation system thereof and application of wild type paenibacillus

Abstract

The invention discloses a wild type paenibacillus, an efficient electroporation transformation system and application thereof, and belongs to the technical field of paenibacillus and gene editing. The invention provides a novel wild type paenibacillus P.elgii 219, the sequence of 16S rDNA of the novel wild type paenibacillus P.elgii 219 is shown as SEQ ID NO.1, the novel wild type paenibacillus P.elgii 219 is preserved in the China General Microbiological Culture Collection Center on November 1, 2024, and the preservation number is CGMCC No.32461; the invention provides an efficient electroporation transformation system aiming at P.elgii 219, so that the electroporation transformation efficiency reaches 1.25 * 10 < 6 > transformant / mu g DNA, and the result represents the highest electroporation efficiency of paenibacillus reported so far; by adopting the efficient electroporation transformation system aiming at the P.elgiii 219, provided by the invention, a gene editing system which is suitable for the P.elgiii 219 and based on a type II intron is established for the first time, a gene editing plasmid pDX4383 can be introduced into the P.elgii219, and a glycosyl transferase gene gene4383 in the P.elgii219 is successfully knocked out, so that the efficient electroporation transformation system aiming at the P.elgiii 219, provided by the invention, is proved to be effective.

Description

Technical Field

[0001] The present invention relates to the field of Paenibacillus and gene editing technology, and in particular to a wild-type Paenibacillus, a high-efficiency electroporation transformation system and application thereof. Background Art

[0002] As a treasure trove of potential bioactive substances, Paenibacillus bacteria have attracted much attention for decades. A large number of studies have revealed their wide application potential in agriculture, food, chemical industry and biomedicine, especially the use of bacterial lipopeptides. As a cell factory, Paenibacillus elgii 219 (P.elgii219) has shown great value in the production of a variety of important substances. However, the uncharacterized sticky exopolysaccharides (EPSs) produced by P.elgii 219 strain make it easy to adhere to the culture container, limiting its growth and production efficiency. Therefore, it is particularly important to further explore the biosynthesis mechanism of EPSs in P.elgii219. Although the general synthesis pathway of heterologous exopolysaccharides is relatively clear, the function of specific glycosyltransferases in the assembly of repeating units remains to be clarified. Analyzing the function of individual glycosyltransferases through gene knockout strategy is an effective way to deeply understand the EPS biosynthesis pathway, which requires the establishment of efficient gene editing tools and DNA transformation methods.

[0003] Electroporation is considered one of the best methods for introducing exogenous DNA into host cells due to its high repeatability and wide applicability. This method has a strong transformation ability and is particularly suitable for strains that are difficult to transform, which is of great significance to bacterial genetic engineering. Although Bacillus species have successfully achieved exogenous DNA integration and stable inheritance through electroporation, transformation still faces challenges for wild-type strains, especially when plasmids are used to express different proteins and the number of bases increases. Therefore, it is necessary to systematically evaluate and optimize the transformation scheme for specific wild-type strains to improve the efficiency of exogenous DNA transformation.

[0004] In recent years, the widespread application of gene editing tools in bacterial genetic engineering has greatly improved production capacity and provided the possibility for industrial-scale production. However, there are limited reports on Paenibacillus gene editing systems. Currently, there are only reports on CRISPR-Cas9 for genome editing of Paenibacillus polymyxa and thymidylate synthase-based knockout systems for P. elgii B69. Therefore, it is of great significance to develop new gene editing tools for Paenibacillus. Targetron, as a gene targeting technology based on the type II intron system, recognizes double-stranded genomic DNA target sites through base complementarity and uses the "homing" mechanism promoted by reverse transcriptase to achieve specific insertion, thereby inactivating DNA. This technology is simple in design and effective in operation. It has been widely used in gene editing of prokaryotes such as Lactococcus lactis, Clostridium and Escherichia coli, but no successful cases have been seen in Paenibacillus. Summary of the invention

[0005] The purpose of the present invention is to provide a wild-type Paenibacillus, its efficient electroporation transformation system and application, to provide a new wild-type Paenibacillus P.elgii 219, to provide an efficient electroporation transformation system for Paenibacillus, and to establish a type II intron-based gene editing system suitable for P.elgii 219.

[0006] To achieve the above-mentioned purpose, the present invention provides a wild-type Paenibacillus elgii 219, which was deposited in the China General Microbiological Culture Collection Center (CGMCC) on November 1, 2024, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No.32461.

[0007] Preferably, the sequence of 16S rDNA of Paenibacillus elgii 219 is shown as SEQ ID NO.1.

[0008] The high-efficiency electroporation transformation system of wild-type Paenibacillus elgii 219 described above has the following steps:

[0009] S1. Cultivate Paenibacillus elgii 219 overnight in NB medium, take the culture medium to new King broth medium for expansion, and then add cell wall weakening agent to continue culturing;

[0010] S2, cool the culture medium on ice for 15 minutes, collect the cells by centrifugation, wash with electroporation buffer, prepare the cell concentrate with electroporation buffer, and then mix with plasmid and incubate on ice for 10 minutes;

[0011] S3, adding the incubated mixed solution into the electric shock cup, and applying an electric pulse of 14-16 kV / cm;

[0012] S4. After adding King broth medium to dilute the cells, shake them at 37°C and 220 r / min for 3 h, then inoculate them on NB agar plates. After incubation at 37°C for 36 h, count the transformants and calculate the transformation efficiency.

[0013] Preferably, in step S1, the culture conditions of Paenibacillus elgii 219 are: KB medium is selected, at 37° C., 220 r / min, the volume ratio of the culture medium to the new culture system is 4%, and the new culture system is King broth medium with overnight culture medium added.

[0014] Preferably, in step S1, the cell wall weakening agent is glycine, the inoculation amount is 6%, and the culture is continued for 1 hour after the cell wall weakening agent is added.

[0015] Preferably, in step S2, the cells are collected by centrifugation at 4° C. and 4000×g for 15 min, the electroporation buffer is SM buffer, and the volume mass ratio of the concentrate to the plasmid is 1 μL:2.5 ng.

[0016] Preferably, in step S4, the NB agar plate contains 25 μg / mL erythromycin; and the transformation efficiency is the number of transformants / μg DNA.

[0017] Paenibacillus elgii 219 electrocompetent cells were prepared using the high-efficiency electroporation transformation system for wild-type Paenibacillus elgii 219 as described above.

[0018] The application of the high-efficiency electroporation transformation system of wild-type Paenibacillus elgii 219 as described above in foreign DNA transformation.

[0019] Therefore, the wild-type Paenibacillus strain, the efficient electroporation transformation system and application thereof provided by the present invention have the following specific technical effects:

[0020] (1) The present invention provides a new wild-type Paenibacillus elgii 219, the sequence of its 16S rRNA is shown in SEQ ID NO. 1, which was deposited in the China General Microbiological Culture Collection Center (CGMCC) on November 1, 2024, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 32461;

[0021] (2) The present invention provides a high-efficiency electroporation transformation system for P.elgii 219, which can achieve an electroporation transformation efficiency of 1.25×10 6 transformants / μg DNA, a result that represents the highest electroporation efficiency reported to date for Paenibacillus spp.;

[0022] (3) Using the efficient electroporation transformation system for P.elgii 219 provided by the present invention, a type II intron-based gene editing system suitable for P.elgii 219 was established for the first time. The gene editing plasmid pDX4383 can be introduced into P.elgii 219, and the glycosyltransferase gene gene_4383 in P.elgii 219 can be successfully knocked out, proving that the efficient electroporation transformation system for P.elgii 219 provided by the present invention is effective. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0024] Figure 1 The evolutionary tree constructed in Example 1 of the present invention;

[0025] Figure 2 The growth curve of P.elgii 219 grown in NB medium in Example 3 of the present invention (A) and the transformation efficiency of P.elgii 219 electrocompetent cells prepared in different culture media (B); the blue and red lines represent the growth curves of P.elgii 219 when the inoculation amount (v / v) is 2% and 4%, respectively; the maximum OD of P.elgii 219 grown in different culture media 600 Value(C);

[0026] Figure 3 The growth curve of P.elgii 219 in KB medium in Example 4 of the present invention (A); the transformation efficiency of electrocompetent cells prepared by P.elgii 219 in the early, middle and late logarithmic growth phase (B); the transformation efficiency of electrocompetent cells prepared by P.elgii 219 in the early logarithmic growth phase (C); the effect of different inoculation amounts of P.elgii 219 on the transformation efficiency of preparing competent cells in NB medium (D); the effect of different inoculation amounts of P.elgii 219 on the transformation efficiency of preparing electrocompetent cells in KB medium (E);

[0027] Figure 4The effect of the electric field strength on the electroporation transformation efficiency of P.elgii 219 in Example 5 of the present invention;

[0028] Figure 5 The effects of different electroporation buffers on electroporation transformation efficiency in Example 6 of the present invention (A); the effects of sucrose and magnesium chloride concentrations on transformation efficiency (B); the effects of glycerol and cryopreservation time on electroporation transformation efficiency (C);

[0029] Figure 6 The effect of different recovery medium and recovery time on electroporation transformation efficiency in Example 7 of the present invention;

[0030] Figure 7 The effect of the amount of plasmid DNA added on the electroporation transformation efficiency in Example 8 of the present invention;

[0031] Figure 8 The effect of different cell wall weakening agents on the electroporation efficiency of P.elgii 219 in Example 9 of the present invention; wherein A is the transformation efficiency of adding ampicillin; B is the transformation efficiency of adding glycine; C is the transformation efficiency of adding isoniazid; D is the transformation efficiency of adding Tween 80; and E is the transformation efficiency of adding threonine;

[0032] Fig. 9 is the OD of the fermentation liquid of P.elgii 219 after adding different cell wall weakening agents and continuing to culture for 1 hour in Example 9 of the present invention 600 value;

[0033] Fig.10 The Targetron knockout plasmid pDX4383 insertion position information (C), the electrophoresis gel image of the monoclonal PCR product (A), and the fermentation culture photos of the wild type and mutant strains (B) in Example 10 of the present invention are shown;

[0034] Fig.11 1 is a structural diagram of the pWAe plasmid used in Example 9 of the present invention (A) and a structural diagram of the pDX4383 vector used in Example 10 (B);

[0035] Fig.12 is the electroporation transformation efficiency of the wild-type P.elgii 219 and the Δ4383 mutant in Example 11 of the present invention in the electroporation transformation system before (A) and after (B) optimization in Example 2;

[0036] Fig.13 It is a growth curve diagram of P.elgii 219Δ4383 in NB (A) and KB medium (B) in Example 11 of the present invention. DETAILED DESCRIPTION

[0037] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0038] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0039] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels.

[0040] Embodiment 1

[0041] Paenibacillus elgii 219 (P.elgii 219) was deposited in the China General Microbiological Culture Collection Center (CGMCC) on November 1, 2024. The deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 32461. The 16S rDNA sequence of the strain is shown in SEQ ID NO. 1, and the evolutionary tree constructed based on it is shown in Figure 1 shown.

[0042] SEQ ID NO.1:

[0043]

[0044] Embodiment 2

[0045] The obtained P.elgii 219 strain was used to construct an electroporation transformation system. The steps of the preliminary experiment (initial plan) are as follows:

[0046] Pick a single colony of P.elgii 219 from the plate and inoculate it into nutrient broth (NB) medium, culture it at 37℃, 220r / min overnight (16h), and the next day, transfer 1mL of the bacterial solution to 50mL of fresh nutrient broth medium for expansion culture (37℃, 220r / min, 24h). Pipette 1mL of the bacterial solution into 50mL of fresh NB medium, and culture it at 37℃, 220r / min until the optical density (OD) at 600nm reaches 0.7 (OD 600 =0.7, detected by spectrophotometer). The cells were cooled on ice for 15 min, and then centrifuged at 4°C, 4000×g for 15 min to collect the cells. All subsequent competent cell preparation operations were strictly performed on ice.

[0047] The cells were washed three times with ice-cold electroporation buffer (containing 10% sucrose, 1 mmol magnesium chloride, SM solution) containing 1 times, 1 / 2 times or 1 / 4 times the volume of the original culture medium, and then resuspended with 1 / 100 of the original culture volume (i.e., concentrated 100 times) to obtain competent cells. 100 μL of competent cells was mixed with 100 ng of plasmid (100 ng / μL) and incubated on ice for 10 min. Then, the mixture was transferred to a 1 mm electric shock cup (Bio-Rad, Hercules, California, USA) and an electric pulse of 18 kV / cm was applied. The cells were immediately diluted with 900 μL NB culture medium, shaken and cultured for 3 hours at 37°C and 220 r / min, and then harvested and plated on NB agar plates containing 25 μg / mL erythromycin. After static culture at 37°C for 36 hours, the transformants were counted and the transformation efficiency (number of transformants / μg DNA) was calculated.

[0048] The conversion rate is 0.22×10 2 transformants / μg DNA, therefore, the obtained P.elgii 219 strain can be used to construct an electroporation transformation system.

[0049] Embodiment 3

[0050] Determine the medium most suitable for the growth of P.elgii 219 as follows:

[0051] S31. Inoculate a single colony of P.elgii 219 into nutrient broth (NB) medium and culture it overnight (16 hours) at 37°C and 220 r / min. The next day, transfer 1 mL of the bacterial solution to 50 mL of fresh nutrient broth medium for expansion culture (37°C, 220 r / min, 24 hours). The growth curve of P.elgii 219 in NB medium is shown in Figure 1. Figure 2 As shown in Part A of FIG. 1 mL (2% inoculum) of bacterial solution was respectively pipetted into fresh nutrient broth (NB), Luria-Bertani broth (LB), brain heart infusion (BHI, purchased from Beijing Solebow Technology Co., Ltd., China), King broth (KB, composed of 20 g / L tryptone, 1.15 g / L potassium dihydrogen phosphate, 1.5 g / L magnesium sulfate·7 hydrate and 1.5% glycerol), and Muller-Hinton broth (MH, purchased from Beijing Solebow Technology Co., Ltd., China) culture medium, and cultured at 37°C and 220 r / min until the optical density (OD) at 600 nm reached 0.7 (OD 600 =0.7, detected by spectrophotometer). The cells were cooled on ice for 15 min, and then centrifuged at 4°C, 4000×g for 15 min to collect the cells.

[0052] S32. All subsequent competent cell preparation operations were strictly performed on ice. The cells were washed three times with ice-cold electroporation buffer (containing 10% sucrose, 1 mmol magnesium chloride, SM solution) containing 1 times, 1 / 2 times or 1 / 4 times the volume of the original culture medium, and then resuspended in 1 / 100 of the original culture medium volume (i.e., concentrated 100 times) to obtain competent cells.

[0053] S33, 100 μL competent cells were mixed with 100 ng plasmid (100 ng / μL) and incubated on ice for 10 min. Then, the mixture was transferred to a 1 mm electric shock cup (Bio-Rad, Hercules, California, USA) and an electric pulse of 18 kV / cm was applied. The cells were immediately diluted with 900 μL NB medium, shaken and cultured for 3 h at 37 ° C and 220 r / min, then harvested and inoculated on NB agar plates containing 25 μg / mL erythromycin. After static culture at 37 ° C for 36 h, the transformants were counted and the transformation efficiency was calculated.

[0054] The results of the experiment repeated 3 times are as follows Figure 2 As shown in Part B, the transformation efficiency of NB as a standard medium is relatively low, at 0.22×10 2 transformants / μg DNA, while bacteria cultured in BHI and MH broth had higher transformation efficiencies, which were 2.94×10 2transformants / μg DNA and 4.08×10 2 When King broth (KB) was used, the transformation efficiency was significantly increased, exceeding 1.27×10 3 transformants / μg DNA.

[0055] The growth of P.elgii 219 in different culture media is shown in Figure 2 As shown in Figure 3C, P.elgii 219 had the highest OD value when grown in KB, followed by BHI and MH broth. In contrast, the OD values ​​were lower when grown in NB and LB.

[0056] Therefore, KB was considered to be a suitable growth medium for P. elgii 219 and was used to prepare electrocompetent cells in subsequent experiments.

[0057] Embodiment 4

[0058] The effects of different collection stages and different inoculation amounts on the transformation efficiency of electrocompetent cells were investigated. The specific steps are as follows:

[0059] S41. Using the culture method in Example 3, P.elgii 219 was cultured in King broth (KB medium). The growth curve of P.elgii 219 in KB medium is as follows: Figure 3 As shown in part A, the OD 600 The cells were collected when the growth phases reached 1.5, 3 and 4 (early, middle and late logarithmic growth phases), and then electrocompetent cells were prepared according to the method described in Example 3, and the transformation efficiency was calculated.

[0060] The results are as follows Figure 3 As shown in part B, the logarithmic growth phase is early, middle and late (OD 600 Electrocompetent cells prepared from P. elgii 219 with 1.5, 3 and 4), respectively, yielded only a limited number of transformants.

[0061] Therefore, in OD 600 The cells were harvested at 0.1, 0.3, 0.5, 0.7 and 0.9 to prepare electrocompetent cells. Figure 3 As shown in Part C, when P.elgii 219 grows to OD 600 When the conversion efficiency was 0.5 (i.e., the early logarithmic growth stage), the transformation efficiency was significantly improved (increased to 2.59×10 4 transformants / μg DNA), while the efficiency at other growth stages was lower.

[0062] S42. Using NB medium, according to the method in Example 3, after overnight culture, 1 mL (2% inoculation amount) and 2 mL (4% inoculation amount) of culture fluid were respectively inoculated into fresh KB medium. The growth curves of P.elgii 219 with different inoculation amounts in KB medium are shown in FIG. Figure 3 As shown in part A, different inoculum sizes had a significant effect on the growth rate of P.elgii 219.

[0063] Therefore, the effect of different inoculation amounts of P.elgii 219 on the transformation efficiency of competent cells was investigated. Figure 3 As shown in part D of FIG, cells harvested from a 4% (v / v) inoculum had higher transformation efficiency in both nutrient broth (NB) and King broth (KB).

[0064] Embodiment 5

[0065] Optimize the electric field strength of P.elgii 219 as follows:

[0066] KB medium, 4% inoculation volume, OD 600 The cells were harvested when the electric field strength was 0.5, and the electrocompetent cells were prepared using electric field strengths of 9, 12, 15, 18, 21 and 24 kV / cm, respectively. The other steps were the same as in Example 3. The conversion efficiency calculation results are shown in FIG. Figure 4 As shown, the optimal electric field strength is 15 kV / cm, at which the conversion efficiency can reach 6.02×10 4 Transformants / μg DNA, increasing or decreasing the electric field strength will lead to a significant decrease in electroporation transformation efficiency.

[0067] Therefore, the electric field strength was 15 kV / cm in the subsequent experiments.

[0068] Embodiment 6

[0069] Optimize the electroporation buffer as follows:

[0070] KB medium, 4% inoculation volume, OD 600 When the value was 0.5, the cells were harvested, the electric field strength was 15 kV / cm, the electroporation buffers were the buffers shown in Table 1, and the other steps were the same as in Example 3.

[0071] Table 1

[0072] Buffer Components SM <![CDATA[10% sucrose + 1 mM MgCl2]]> SC <![CDATA[10% sucrose + 1 mM CaCl2]]> Sucrose 10% sucrose SMG SM+10% glycerol SMH SM + 1 mM HEPES SMP SM + 1 mM PBS (pH = 7.2-7.4) SMAG 0.5Msorbitol+0.5Mmannitol+10%glycerol SMHP <![CDATA[0.25% M sucrose + 1 mM MgCl2 + 1 mM HEPES + 10% glycerol]]> 10％G 10% Glycerin S5M <![CDATA[5% sucrose + 1 mM MgCl2]]> S15M <![CDATA[15% sucrose + 1 mM MgCl2]]> SM2 <![CDATA[10% sucrose + 2 mM MgCl2]]> S 10% sucrose

[0073] The results are as follows Figure 5 As shown in Part A of the Figure 3, the highest transformation efficiency was obtained using SM solution (containing 10% sucrose and 1 mM MgCl2).

[0074] The effect of sucrose and magnesium chloride concentration on transformation efficiency. Figure 5 As shown in part B of . When the sucrose concentration dropped from 10% to 5% (SM vs. S5M), the transformation efficiency decreased significantly, while increasing the sucrose concentration (S15M) slightly improved the transformation efficiency, but there was no significant difference. In addition, the sucrose solution without magnesium chloride (SM0) failed to produce transformants, and increasing the magnesium chloride concentration (SM2) was not conducive to electroporation.

[0075] Electrocompetent cells prepared using SM solution and buffer with glycerol added (SMGG) were frozen and stored at -80°C. Figure 5 As shown in Part C of Figure 3, the addition of glycerol can prolong the transformation capacity of electrocompetent cells, but the transformation capacity decreases significantly with the extension of freezing time. No transformants were obtained from competent cells stored at -80°C for one month.

[0076] Embodiment 7

[0077] The optimal recovery medium and recovery time were investigated as follows:

[0078] KB medium, 4% inoculation volume, OD 600 The cells were harvested when the electric field intensity was 0.5, the electric field intensity was 15 kV / cm, and SM solution was used as the electroporation buffer. The other steps were the same as those in Example 3. After the electroporation, 900 μL of recovery culture medium were added: NB, LB, KB, MH, BHI, SOC and TSB, and the recovery culture was performed for 1 h, 3 h, and 6 h, respectively.

[0079] The results are as follows Figure 6 As shown, KB is also the best recovery medium for preparing P. elgii 219 electrocompetent cells, with a transformation efficiency of 1.25 × 10 5 The best transformation rate was obtained when the recovery time was 3 h, while the number of positive clones obtained when the recovery time was 1 h and 16 h was less.

[0080] Embodiment 8

[0081] The effect of the amount of plasmid DNA added on the electroporation transformation efficiency was investigated. Figure 7 As shown, compared with the optimal conditions obtained in Example 7, when 250 ng of plasmid was added, the number of positive transformants increased to 2.13×10 5 Transformants / μg DNA.

[0082] Embodiment 9

[0083] The effect of cell wall weakening on the electroporation transformation efficiency of P.elgii 219 was investigated as follows:

[0084] Four cell wall weakening agents were used to prepare competent cells.

[0085] The results are as follows Figure 8 As shown in the figure, the electroporation efficiency was improved after using ampicillin, glycine, threonine and isoniazid. Specifically, 10 μg / mL ampicillin, 6% threonine and 0.6% isoniazid obtained 4.20×10 5 Transformants / μg DNA, 3.44×10 5 transformants / μg DNA and 2.76×10 5 The transformation efficiency of transformants / μg DNA was the best when 6% glycine was used, reaching 1.25×10 6 transformants / μg DNA. However, the addition of Tween 80 significantly reduced the electroporation efficiency. However, the use of cell wall weakening agents inhibited the growth of P. elgii 219 (see Fig. 9 ).

[0086] In summary, the optimal process was as follows: P.elgii 219 was cultured in KB medium until OD 600 When the concentration of KB reached 0.5, the culture medium was added to new KB medium with an inoculum of 4% (v / v), and then 6% glycine was added and cultured for 1 h. The cells were harvested and washed with SM solution, concentrated to 1 / 100 of the initial volume, and incubated with 250 ng of pWAe plasmid (the structure of the plasmid is shown in the figure). Fig.11 After mixing with 15 kV / cm electric pulse, the cells were revived in KB medium at 37°C and 220 r / min for 3 h, and then plated on NB agar plates containing 25 μg / mL erythromycin. The optimized conditions are shown in Table 2.

[0087] Table 2

[0088]

[0089] The results showed that the electroporation efficiency increased from 0.22×10 2 The number of transformants / μg DNA increased to 1.25×10 6 transformants / μg DNA.

[0090] Embodiment 10

[0091] Verify the validity of the obtained electroporation protocol as follows:

[0092] Studies have shown that the guide glycosyltransferase (accession WP_054974698) in Paenibacillus sp. A3 is a key gene that exhibits adhesion during shake flask fermentation. Its sequence was homologously aligned to P.elgii219, and the results are shown in Table 3. The gene with the highest similarity (highest score) is gene_4383 in P.elgii 219.

[0093] Table 3

[0094] Comparison gene number Gene_No. Identity(%) Coverage(34.7) Evalue Score WP_054974698 4383 99 99.5 7.47E-152 1084 0055 44.2 84.6 8.01E-37 333 5312 36.7 88.5 8.22E-37 335

[0095] The Targetron knockout plasmid pDX4383 was constructed using the Targetron method. The vector structure is as follows Fig.11 As shown in B. P.elgii 219 (Δ4383 mutant) with gene_4383 knocked out was obtained, and the mutation position information is shown in Fig.10 As shown in part C.

[0096] The mutant strain Δ4383 was obtained as follows: Using the optimal electroporation method obtained in Example 9, the Targetron knockout plasmid pDX4383 was transferred into P.elgii 219 and spread onto a NB plate containing erythromycin (25 μg / mL). A single colony was picked from the plate to 3 mL of NB liquid culture medium containing erythromycin (25 μg / mL), and cultured overnight (16 h) at 37°C and 220 rpm. The next day, 200 μL of the bacterial solution was pipetted into 2 mL of fresh NB liquid culture medium (containing erythromycin 25 μg / mL).

[0097] The Δ4383 mutant was spread on NB plates, and a single colony was picked and placed in NB medium. The culture was continued at 37°C and 220 rpm until the middle of the logarithmic growth phase (OD 600 =0.5), and then incubated at 48°C for an additional 1 h before dilution and plating on plates containing erythromycin (25 μg / mL). 14 single clones were randomly selected for PCR verification.

[0098] By using specific primers P7 (sequence as shown in SEQ ID NO.2) and P8 (sequence as shown in SEQ ID NO.3) for PCR verification, the theoretical fragment size of wild-type P.elgii 219 is 520 bp, and the theoretical fragment size of the Δ4383 mutant is 1433 bp. Fig.10 As shown in part A of , the PCR products of monoclonal clones 4, 7, 11, 12, 13, and 14 are 1433 bp, indicating that the intron sequence has been inserted into the target site of gene_4383 in monoclonal clones 4, 7, 11, 12, 13, and 14. Fig.10Part B is a photograph of the culture flask after 24 hours of culture. It can be seen that compared with the wild-type P.elgii219, the Δ4383 mutant did not show adhesion and did not produce flocculent precipitation during the shake flask fermentation in NB medium.

[0099] SEQ ID NO.2:CGCGGACCGATAAAGCTCATGTC

[0100] SEQ ID NO.3:CTACCGTGGAATACGCGCTAAG

[0101] Embodiment 11

[0102] Studies have shown that deleting the exopolysaccharide gene can improve transformation efficiency. Therefore, the difference in electroporation transformation efficiency between the wild-type P.elgii219 and the Δ4383 mutant was investigated.

[0103] The results are as follows Fig.12 As shown, whether the electroporation transformation system before optimization in Example 2 (A) or the optimized electroporation transformation system obtained in Example 8 (B) is used, the mutant strain with exopolysaccharide deleted can achieve higher transformation efficiency compared with the wild-type strain. After removing exopolysaccharide, P.elgii 219Δ4383 has a higher transformation efficiency in NB ( Fig.13 Part A) and KB medium ( Fig.13 The growth rate in the B part of the experiment was increased and a higher OD was reached. 600 value.

[0104] Therefore, the present invention provides a new wild-type Paenibacillus sp. P.elgii 219, whose 16SrDNA sequence is shown in SEQ ID NO.1; and provides an efficient electroporation transformation system for P.elgii 219, which enables the electroporation transformation efficiency to reach 1.25×10 6 transformants / μg DNA, which represents the highest electroporation efficiency reported so far for the genus Bacillus; using the high-efficiency electroporation transformation system for P.elgii 219 provided by the present invention, a type II intron-based gene editing system suitable for P.elgii 219 was established for the first time, and the gene editing plasmid pDX4383 can be introduced into P.elgii 219, and the glycosyltransferase gene gene_4383 in P.elgii 219 can be successfully knocked out, proving that the high-efficiency electroporation transformation system for P.elgii 219 provided by the present invention is effective.

[0105] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. A wild-type Paenibacillus elgii 219 was deposited in the China General Microbiological Culture Collection (CGMCC) on November 1, 2024. The deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 32461.

2. The wild-type Paenibacillus elgii219 according to claim 1, characterized in that: The sequence of 16S rDNA of Paenibacillus elgii 219 is shown as SEQ ID NO.

1.

3. The high-efficiency electroporation transformation system of wild-type Paenibacillus elgii219 according to claim 1 or 2, characterized in that: Here are the steps: S1. Cultivate Paenibacillus elgii 219 overnight in NB medium, take the culture fluid to new KB medium for expansion, and then add cell wall weakening agent to continue culturing; S2, cool the culture medium on ice for 15 minutes, collect the cells by centrifugation, wash with electroporation buffer, prepare the cell concentrate with electroporation buffer, and then mix with plasmid and incubate on ice for 10 minutes; S3, adding the incubated mixed solution into the electric shock cup, and applying an electric pulse of 14-16 kV / cm; S4. After adding King broth medium to dilute the cells, shake and culture them at 37°C and 220 r / min for 3 h, then inoculate them on NB agar plates. After incubation at 37°C for 36 h, count the transformants and calculate the transformation efficiency.

4. The high-efficiency electroporation transformation system of wild-type Paenibacillus elgii 219 according to claim 3, characterized in that: In step S1, the culture conditions of Paenibacillus elgii219 are: KB medium is selected, at 37° C., 220 r / min, the volume ratio of the culture medium to the new culture system is 4%, and the new culture system is King broth medium added with overnight culture medium.

5. The high-efficiency electroporation transformation system of wild-type Paenibacillus elgii 219 according to claim 3, characterized in that: In step S1, the cell wall weakening agent is glycine, and the final concentration is 6%. After adding the cell wall weakening agent, the culture is continued for 1 hour.

6. The high-efficiency electroporation transformation system of wild-type Paenibacillus elgii 219 according to claim 3, characterized in that: In step S2, the cells were collected by centrifugation at 4°C and 4000×g for 15 min. The electroporation buffer was SM buffer, and the volume mass ratio of the concentrate to the plasmid was 1 μL:2.5 ng.

7. The high-efficiency electroporation transformation system of wild-type Paenibacillus elgii 219 according to claim 3, characterized in that: The NB agar plate in step S4 contained 25 μg / mL erythromycin; the transformation efficiency was the number of transformants / μg DNA.

8. Paenibacillus elgii 219 electrocompetent cells prepared by the high-efficiency electroporation transformation system of wild-type Paenibacillus elgii 219 according to any one of claims 3 to 7.

9. Use of the high-efficiency electroporation transformation system of wild-type Paenibacillus elgii219 according to any one of claims 3 to 7 in exogenous DNA transformation.

Images