A CYP6CW1 mutant and its application

Abstract

The present invention relates to a CYP6CW1 mutant and an application thereof. By constructing a transgenic insect expressing a brown planthopper CYP6CW1 mutant, a TARGET-GAL4 / UAS binary expression and temperature control system is used to stably over-express different mutants, and the mutants can be used for screening unknown compounds and investigating whether the control effects of existing insecticides on brown planthoppers are affected. CYP6CW1 The functions affected by gene mutations can help in the screening and development of new insecticides.

Description

Technical Field

[0001] The present application relates to the fields of molecular biology, animal model construction and pest control, and specifically, to a CYP6CW1 mutant and its application. Background Art

[0002] Brown planthopper ( Nilaparvata lugens ) is an important pest in rice production, widely distributed in Southeast Asia, Northeast Asia and South Asia, including China. It not only causes direct damage by feeding on rice sap, but also spreads viral diseases such as Rice grassy stunt virus (RGSV) and Rice ragged stunt virus (RRSV), resulting in serious reduction in rice production. Brown planthopper is a monophagous pest of rice, a typical r-strategist with extremely high intrinsic growth rate and environmental adaptability, and is prone to outbreaks. Until now, brown planthoppers have also caused huge economic losses to rice production every year.

[0003] For a long time, the control of brown planthoppers has mainly relied on chemical agents. However, resistance or decreased sensitivity to insecticides has gradually emerged. In order to overcome the resistance of brown planthoppers to insecticides such as imidacloprid, phenylpyrazole (fenpro) insecticides such as fipronil and ethiprole, which target the γ-aminobutyric acid (GABA)-gated chloride ion channels of the insect central nervous system, have been widely used for the control of brown planthoppers. However, it has been reported that field populations in China have developed moderate resistance to fipronil (23.8-43.3 times resistance) and cross-resistance to ethiprole (47.1-100.9 times) (References 1-2). In 2013, Thailand reported a high level of resistance to ethiprole (308.5 times) (Reference 3). Subsequently, the widespread use of other neonicotinoid insecticides in the field has gradually reduced the use of fipronil and ethiprole. For example, from 2012 to 2014, field-collected brown planthopper populations in eight provinces of China showed high-level resistance to imidacloprid and thiamethoxam, moderate resistance to clothianidin and dinotefuran, but still moderate resistance to ethiprole (resistance multiple = 11.5-71.8) (Reference 4).

[0004] In addition, in recent years, resistance or decreased sensitivity to other types of insecticides have also been found in field resistant populations. Although flupyrazone, a new type of neonicotinoid insecticide, is different from traditional neonicotinoid insecticides such as imidacloprid, studies have shown that field populations of brown planthoppers in 10 regions of China showed low to moderate resistance to flupyrazone in 2017. Brown planthoppers may have cross-resistance to these neonicotinoid insecticides due to a common resistance mechanism; it is not clear whether the phenomenon of brown planthoppers being resistant to multiple insecticides found in field populations is related to a certain resistance mechanism. The ambiguity of the molecular mechanism of resistance is a bottleneck in resistance management and rational use of drugs.

[0005] Cytochrome P450 monooxygenase is a superfamily with many genes, which plays a vital role in the detoxification metabolism of exogenous substances such as pesticides and plant toxins. In insects, P450 monooxygenase-mediated detoxification metabolism is one of the main mechanisms of insecticide resistance. It is reported that the molecular mechanism of the metabolic resistance of brown planthoppers to imidacloprid is related to the overexpression of P450 genes, including CYP6ER1, CYP6AY1, CYP4CE1 and CYP6CW1 (Reference 5). Among them, CYP6CW1 The gene is a P450 gene from the brown planthopper. CYP6CW1 The expressed protease can metabolize imidacloprid into other low-toxic substances.

[0006] Drosophila is easy to raise, has a short life cycle, reproduces quickly, and is easy to genetically manipulate. It is one of the most important model organisms in the field of life sciences. Its Gal4-UAS-driven expression system can quickly obtain overexpression of specific genes. This feature has been used by researchers to establish many drug screening models. In addition, the PhiC31 integrase-mediated site-specific transgenic system is a system that applies the integration principle of bacteriophage PhiC31 in Drosophila to construct transgenic strains at specific sites. PhiC31 integrase recognizes the characteristic sequences attP (bacteriophage binding site) and attB (bacterial binding site), which promotes efficient and irreversible integration between the two sequences. The plasmid containing the attB sequence is injected into the Drosophila embryo containing the attP sequence at a specific site, and a transgenic strain is obtained under the action of the PhiC31 integrase. The target fragment is located between attL and attR.

[0007] Currently, in response to the increasing resistance of brown planthoppers to existing compounds, there is an urgent need to develop an insect tool model for screening new compounds.

[0008] Non-patent literature:

[0009] Literature 1: Wang YH., Wu CX, Zhao XP, Chen LP, Yu RX, Cang T, Wu SG, Wang Q. 2009. Current status of the pest resistance to pronil. Chin. Bull. Entomol. 46: 846-854.

[0010] Literature 2: Zhao X, Ning Z, He Y, Shen J, Su J, Gao C et al, Differential resistance and cross-resistance to three phenylpyrazole insecticides in the planthopper Nilaparvata lugens (Hemiptera: Delphacidae). J Econ Entomol 104: 1364–1368 (2011).

[0011] Literature 3: Punyawattoe P, Han ZJ, Sriratanasa W, Arunmit S, Chaiwong J and Bullangpoti V, Ethiprole resistance in Nilaparvata lugens (Hemiptera: Delphacidae): possible mechanisms and cross-resistance. Appl Entomol Zool 48: 205–211 (2013).

[0012] Literature 4: Zhang X, Liao X, Mao K, Zhang K, Wan H, Li J. Insecticide resistance monitoring and correlation analysis of insecticides in field populations of the brown planthopper Nilaparvata lugens (stål) in China 2012 - 2014. Pestic Biochem Physiol. 2016 132:13-20.

[0013] Literature 5: Zhang YX, Yang YX, Sun HH, Liu (2016) Metabolic imidaclopridresistance in the brown planthopper, Nilaparvata lugens, relies on multipleP450 enzymes. Insect Biochem Mol Biol, 79: 50-56. Summary of the invention

[0014] This application is to construct an insect model expressing CYP6CW1 protein mutants for screening unknown compounds and investigating whether the control effects of existing insecticides on brown planthoppers are affected. CYP6CW1 The function affected by the gene mutation. Specifically,

[0015] In a first aspect of the present invention, a CYP6CW1 protein mutant is provided, wherein the mutant comprises a mutant of SEQ ID NO: 1, wherein the mutant comprises any one or a combination of two or more mutations of T110I, V371A or S414F of SEQ ID NO: 1;

[0016] It is further preferred that the mutant comprises the following mutation of SEQ ID NO: 1:

[0017] A) T110I;

[0018] B) V371A;

[0019] C) S414F;

[0020] D) T110I and V371A;

[0021] E) T110I and S414F;

[0022] F) V371A and S414F; or,

[0023] G) T110I, V371A and S414F.

[0024] Preferably, the amino acid sequence of the mutant comprises an amino acid sequence as shown in any one of SEQ ID NOs: 2-8 or an amino acid sequence having 70%, 75%, 80%, 85%, 90%, 95% or 99% identity with the amino acid sequence as shown in any one of SEQ ID NOs: 2-8.

[0025] The second aspect of the present invention provides a nucleic acid encoding the above-mentioned CYP6CW1 protein mutant.

[0026] The third aspect of the present invention provides a vector, wherein the vector comprises the above-mentioned nucleic acid. Preferably, the vector comprises a plasmid, and more preferably, the plasmid comprises an attB sequence.

[0027] The fourth aspect of the present invention provides a cell, wherein the cell comprises the above-mentioned nucleic acid or the above-mentioned vector.

[0028] A fifth aspect of the present invention provides a method for constructing a transgenic insect, wherein the insect expresses the above-mentioned CYP6CW1 protein mutant.

[0029] Preferably, the construction method comprises introducing the above-mentioned nucleic acid.

[0030] Preferably, the construction method further comprises using the TARGET-GAL4 / UAS system and / or the PhiC31 site-directed recombinase system.

[0031] Preferably, the insect is a Diptera insect; further preferably, the Diptera insect is a fruit fly.

[0032] Preferably, the insect overexpresses the CYP6CW1 protein mutant.

[0033] Preferably, the construction method comprises:

[0034] 1) preparing a recombinant plasmid containing the nucleic acid of the CYP6CW1 protein mutant, injecting the recombinant plasmid into Drosophila embryos, and obtaining red-eyed transgenic Drosophila after the embryos develop into adults;

[0035] 2) Elimination of PhiC31 integrase and corpus luteum in red-eyed transgenic flies;

[0036] In a specific embodiment, step 1) in the construction method comprises:

[0037] 1-1), hybridizing fruit flies with PhiC31 integrase with fruit flies with attP characteristic sequence to obtain P0 generation fruit flies containing both PhiC31 integrase and attP characteristic sequence; preferably, PhiC31 integrase is located on chromosome I, and attP characteristic sequence is located on chromosome II.

[0038] 1-2) will include CYP6CW1 The target genes of different mutants are connected to plasmid vectors (preferably, the plasmid includes attB sequence), and then microinjected into P0 generation fruit fly embryos. The P0 generation embryos injected with plasmids hatch and grow into adult P0 generation;

[0039] Preferably, the step 2) comprises:

[0040] 2-1) Cross the P0 generation of transgenic fruit flies with wild-type fruit flies to obtain the F1 generation;

[0041] 2-2) The F1 generation is crossed with the first balanced strain, and the obtained F2 generation individuals are self-fertilized to obtain the F3 generation;

[0042] 2-3) F4 generation obtained by further crossing F3 generation fruit flies with the second balanced strain;

[0043] 2-4) The F4 generation is crossed with the third balancer strain into which the GAL element has been introduced, and then the obtained F5 generation is self-pollinated to remove the balancer, thereby obtaining the F6 generation of target fruit flies.

[0044] Further preferably, the first balanced strain is Bc / CyO, the second balanced strain is [Sp / CyO; TM2 / TM6B], and the third balanced strain is [Sp / CyO; Tub-GAL4, Tub-GAL80ts].

[0045] Further preferably, the F1 generation is a UAS-target gene individual, the F2 generation is a UAS-target gene / CyO individual, the F3 generation is a UAS-target gene / UAS-target gene individual, the F4 generation is a [UAS-target gene / CyO; TM2 / TM6B] individual, the F5 generation is a [UAS-target gene / CyO; Tub-GAL4, Tub-GAL80ts / TM6B] individual, and the F6 generation is a [UAS-target gene / UAS-target gene; Tub-GAL4, Tub GAL80ts / Tub-GAL4, Tub-GAL80ts] individual.

[0046] In one embodiment, the step 2) includes

[0047] 2-1) Cross the P0 generation of transgenic male fruit flies with wild-type fruit flies to obtain the F1 generation;

[0048] 2-2) Male F1 is crossed with Bc / Cy virgin females to obtain F2 generation UAS-target gene / CyO individuals, and UAS-target gene / CyO individuals are self-fertilized to obtain F3 generation UAS-target gene / UAS-target gene fruit flies;

[0049] 2-3) Cross the F3 generation UAS-target gene / UAS-target gene fruit flies with the fruit flies of the genotype [Sp / CyO; TM2 / TM6B] to obtain the F4 generation males [UAS-target gene / CyO; TM2 / TM6B];

[0050] 2-4) The obtained F4 generation males [UAS-target gene / CyO; TM2 / TM6B] were hybridized with virgin females [Sp / CyO; Tub-GAL4, Tub-GAL80ts] to obtain the F5 generation [UAS-target gene / CyO; Tub-GAL4, Tub-GAL80ts / TM6B] line, and finally self-pollinated to remove the balancer to obtain the F6 generation [UAS-target gene / UAS-target gene; Tub-GAL4, TubGAL80ts / Tub-GAL4, Tub-GAL80ts] line.

[0051] The sixth aspect of the present invention provides a method for screening insecticides, comprising: using the transgenic insects obtained by the above-mentioned construction method, administering a candidate substance to the transgenic insects; and detecting the mortality rate of the transgenic insects.

[0052] Preferably, the candidate substance having the ability to kill transgenic insects is a target insecticide.

[0053] Preferably, the target insecticide has a killing effect on brown planthoppers that are resistant to other existing insecticides. More preferably, the other existing insecticides include ethidium bromide and neonicotinoids. Alternatively, the target insecticide can reduce the resistance level of brown planthoppers to other existing insecticides, such as reducing the resistance level of brown planthoppers to ethidium bromide and neonicotinoids.

[0054] More preferably, the neonicotinoid agents include imidacloprid, cycloheximide, and the like.

[0055] Preferably, the target pesticide cannot be metabolized by the CYP6CW1 protein mutant.

[0056] In a seventh aspect, the present invention provides the use of the mutant, the nucleic acid, the vector, the cell or the transgenic insect obtained by the construction method, wherein the use includes:

[0057] (1) Study the application of mutation in insect resistance;

[0058] (2) Application in screening of pesticides.

[0059] Preferably, the target insecticide is a brown planthopper insecticide. Further preferably, the target insecticide has a killing effect on brown planthoppers that are resistant to other existing insecticides. More preferably, the other existing insecticides include ethidium bromide and neonicotinoids. Alternatively, the target insecticide can reduce the resistance level of brown planthoppers to other existing insecticides, such as reducing the resistance level of brown planthoppers to ethidium bromide and neonicotinoids.

[0060] More preferably, the neonicotinoid agents include imidacloprid, cycloheximide, and the like.

[0061] Preferably, the target pesticide cannot be metabolized by the CYP6CW1 protein mutant.

[0062] Preferably, the target pesticide cannot be metabolized by the CYP6CW1 protein mutant comprising the S414F mutation.

[0063] The technical effects of the present invention are:

[0064] 1. The present invention provides a method for preparing various mutants of P450 genes in Drosophila transgenic. The method utilizes transgenic technology to transform brown planthopper CYP6CW1 Different variants of the gene were transferred into the genome of chromosome II of Drosophila. At the same time, the TARGET-GAL4 / UAS binary system and overexpression homozygotes were constructed to achieve the brown planthopper CYP6CW1 Rapid high expression of genes in Drosophila results in different variants CYP6CW1 The gene was stably inherited in the homozygous strain of transgenic fruit flies, which not only overcomes the problems of insolubility, lack of post-translational modification, reduced activity, and insufficient spatial folding of insect P450 recombinant proteins expressed in vitro, but also makes up for the difficulties in investigating the expression of P450 proteins in brown planthoppers using RNAi interference technology and CRISPR / Cas9 gene editing technology. CYP6CW1 The relationship between amino acid mutations in genes and pesticides is time-consuming, costly, and has the risk of off-target effects in both technologies. The resulting series of strains can be used as tool fruit flies, which are easy to raise, reproduce quickly, and take a short time to complete a generation. CYP6CW1 The relationship between the gene and its amino acid mutation and the pesticide is not needed to cross with Tub-GAL4 transgenic population, and it can be used to screen unknown compounds and investigate whether the control effect of existing pesticides on brown planthopper is affected. CYP6CW1 The advantages of studying the functions affected by gene mutations are obvious to this field.

[0065] 2. The present invention confirms the association between existing insecticide resistance and CYP6CW1 protease. CYP6CW1 protease can increase the metabolism of existing insecticides in the body, thereby improving the resistance of brown planthoppers to the above-mentioned insecticides, including ethiprole, neonicotinic acid insecticides such as imidacloprid and cycloheximide. CYP6CW1 When the gene mutates, the metabolic activity of CYP6CW1 protease to insecticides increases, resulting in varying degrees of resistance to existing insecticides. In particular, mutants carrying the S414F mutation can significantly increase the resistance of brown planthoppers to existing insecticides and can be used to screen insecticides for brown planthoppers.

[0066] The above merely summarizes some aspects of the present invention and is not and should not be considered to limit the present invention in any aspect.

[0067] All patents and publications mentioned in this specification are incorporated herein by reference as a whole. Those skilled in the art will recognize that certain changes may be made to the present invention without departing from the concept or scope of the present invention. The following examples further illustrate the present invention in detail and should not be considered to limit the scope of the present invention or the specific methods described herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein:

[0069] Figure 1 Is the CYP in the field population 6CW1 Three amino acid mutation sites of the gene, among which the black box indicates the predicted CYP6CW1 protein substrate recognition site SRS1-6.

[0070] Figure 2 is the pJFRC28-10XUAS-IVS-GFP-p10 plasmid map, used to construct CYP6CW1-F11 Take genetically modified fruit flies as an example.

[0071] Figure 3 This is a flowchart for screening and obtaining homozygous transgenic fruit flies. CYP6CW1 Represents CYP6CW1 Wild type and different mutants of the gene.

[0072] Figure 4 This is the working principle of the TARGET-GAL4 / UAS (tub-gal4, tub-gal80ts / UAS) system.

[0073] Figure 5 It is quantitatively verified by driving overexpression in various transgenic flies CYP6CW1 The result diagram of the gene, Figure A is the verification of the present invention CYP6CW1 Gene in tub-gal4, tub-gal80ts / UAS system CYP6CW1 Figure B is the full-length clone of the gene; Figure B is the verification CYP6CW1 Different variants of genes in transgenic lines CYP6CW1 The expression level difference of genes, where M is the DL 2000 DNA molecular weight standard; GFP is the transgenic fruit fly strain with GFP gene; GAL4 is the transgenic fruit fly strain with genotype [Sp / CyO; tub-gal4, tub-gal80ts] without the target gene; F11, B1, B2, B3, B4, B5 and B6 are CYP6CW1 Each mutant transgenic line.

[0074] Figure 6 Overexpression CYP6CW1Sensitivity test of Drosophila with different gene variants to imidacloprid and cycloheximide, where A is the result of imidacloprid, B is the result of cycloheximide, and different letters represent significant differences at P<0.05; Indicates that the treatment groups with the same concentration have significant differences at P < 0.05 compared with the control GAL4 strain. Indicates that the treatment groups with the same concentration are significantly different from the control GAL4 strain at P<0.01. Indicates that the treatment groups with the same concentration were significantly different from the control GAL4 strain at the P<0.001 level.

[0075] Figure 7 It is the peak time of chromatographic detection of ethiprole and imidacloprid standards.

[0076] Figure 8 These are the chromatographic peaks after the microsomal proteins of different transgenic strains metabolize ethidium and imidacloprid. DETAILED DESCRIPTION

[0077] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0078] Example 1 CYP6CW1 Acquisition of different gene variants and construction of vectors

[0079] Brown Planthopper CYP6CW1 There are three amino acid variations in the gene coding region. Figure 1 As shown, for field populations CYP6CW1 The deduced amino acid sequences of the 10 clones of the gene were compared and mainly divided into two types: variants carrying (I110+A371+F414) amino acids and variants carrying (T110+ V371+S414). The black line box indicates the predicted CYP6CW1 protein substrate recognition site SRS1-6.

[0080] 1. Therefore, in order to complete the present invention, it is first necessary to obtain CYP6CW1 The complete open reading frame (ORF) of different variants of the gene. The amino acid sequence of the wild-type CYP6CW1 protein is shown in SEQ ID NO: 1, and the amino acid sequences of the mutant proteins are shown in SEQ ID NO: 2-8.

[0081] First, find the CYP6CW1The nucleotide sequence of the transcript (KM217022.1) was then used to design a pair of amplification primers covering the entire ORF using the primer design website (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). The primer sequences are as follows:

[0082] Nl CYP6CW1 -F:5'-ATGCTCGGGCTGATAGTGACAGG-3' (SEQ ID NO:9)

[0083] Nl CYP6CW1 -R:5'-CTATACTTTTCTTGGCTCGAAGTGCAGCC-3' (SEQ ID NO:10)

[0084] The gene was then cloned and extracted from the brown planthopper. CYP6CW1 Nucleotide sequence.

[0085] The specific steps are as follows:

[0086] According to the experimental purpose, 30 brown planthopper nymphs were taken and placed in a 1.5 mL EP tube, 2 stainless steel balls were placed, 1 mL of TRIzol reagent was added, and the insect body was immediately ground with a fully automatic sample rapid grinder (Tissuelyser-48), and the homogenized sample was shaken and mixed. The TRIzol total RNA extraction kit of Invitrogen was used as described in the instructions. After the total RNA was extracted, the concentration and purity of the extraction were determined by an ultraviolet spectrophotometer (Thermo Nanodrop 1000), and the samples that met the quality requirements for synthesized cDNA were stored at -80°C;

[0087] The synthesis method of single-stranded cDNA was carried out according to the instructions of Transcriptor First Stand CDNA Syntheise Kit (Roche); 2x Phusion master Mix thermo scientific (Thermo Fisher Scientific) high-fidelity enzyme was used for gene cloning, and the reaction system and reaction conditions were all according to the reagent instructions;

[0088] The PCR product was identified by agarose gel electrophoresis, and then the bright band of the correct size was extracted and recovered using the EZNATM Gel Extraction Kit from OMEGA. The method was referred to the instructions of the recovery kit.

[0089] The recovered target gene was connected to the vector using the P-Easy-T cloning kit of Quanshijin Biotechnology Co., Ltd., and then the T vector connected with the target gene was transferred into DH5α competent cells. After the transformation was completed, 500ul of culture medium without AMP was added and revived in a shaker at 37°C, 180rpm / min for 1h, and then evenly spread on LB culture medium containing AMP antibiotics, and the plate was placed in an incubator at 37°C and inverted for 16h; then a single white spot was picked and placed in 1mL of LB liquid culture medium containing AMP, and propagated in a shaker at 37°C, 180rpm / min for 2h.

[0090] Take 1 μL of bacterial solution and add it to 20 μL PCR reaction system (including 10 μL 2×Taq Plus MasterMix (Dye), 1 μL M13F, 1 μL M13R, 8 μL ddH2O) for amplification, and then send the correct bacterial solution to a universal sequencing company for sequencing after electrophoresis detection;

[0091] Nilaparvata lugens CYP6CW1 The full-length nucleotide sequence of the gene was compared with that on Genebank CYP6CW1v2 The nucleotide sequence of the open reading frame (KM217022.1) was aligned, and the similarity was 98.5%, proving that the cloned sequence was the brown planthopper P450 CYP6CW1 cDNA sequence. Determine the correct sequence, expand the corresponding bacterial culture, use Tiangen's high-purity plasmid extraction kit to extract the plasmid, sequence and verify, and store at 4℃ for later use.

[0092] According to the above sequencing results, two main sequences were obtained, one of which was CYP6CW1 -F11 sequence (T110+V371+S414) (SEQ ID NO: 1), another sequence CYP6CW1 -B4 has mutations at amino acid positions 110, 371 and 414 (I110+A371+F414) (SEQ ID NO: 2).

[0093] Therefore, in order to study which mutation point of these three mutations will CYP6CW1 The gene protein structure changes, thus changing the sensitivity to pesticides, and further use CYP6CW1 -F11 sequence as a template, several other mutants were obtained by site-directed mutagenesis, and mutant plasmids with single mutations at position 110 (I110), 371 (A371), and 414 (F414) were obtained, respectively. CYP6CW1 -B1 (SEQ ID NO: 3), CYP6CW1 -S1 (SEQ ID NO: 4) and CYP6CW1-B2 (SEQ ID NO: 5); obtained mutant plasmids with combinations of mutations at positions 110 and 414 (I110 + F414), 110 and 371 (I110 + A371), and 371 and 414 (A371 + F414), respectively named: CYP6CW1 -B3 (SEQ ID NO: 6), CYP6CW1 -B5 (SEQ ID NO: 7), CYP6CW1 -B6 (SEQ ID NO: 8).

[0094] 2. Construction of vector:

[0095] (1) The vector plasmid selected in the present invention is: pJFRC28-10XUAS-IVS-GFP-p10, and the NotI and XbaI sites on the plasmid are selected as the insertion sites of the target gene. According to these two restriction sites and the instructions of the ClonExpress MultiS One Step Cloning Kit, a pair of primers with plasmid homology arms are designed, and the primer sequences are as follows:

[0096] IVS-NotI- CYP6CW1 -F: 5'-tcttatcctttacttcaggcGGCCGCAAAATGCTCGGGCTGATAGTGACAG -3' (SEQ ID NO: 11)

[0097] P10-XbaI- CYP6CW1 -R:

[0098] 5'- GTTATTTTAAAAAACGATTCATTCTAGACTATACTTTTCTTGGCTCGAAG -3' (SEQ ID NO: 12)

[0099] Using the plasmid saved in step 1 as a template, use the high-fidelity enzyme of Novozyme 2XPhanta to amplify the homology arms CYP6CW1 The open reading frame sequence of the transcript was identified by agarose gel electrophoresis, and then the bright band of the correct size was cut and recovered using the EZNATM Gel Extraction Kit from OMEGA and stored in the same manner as the above gene cloning steps;

[0100] (2) Using a fast-cutting enzyme that can uniquely recognize two restriction sites, NotI and XbaI, the circular plasmid is cut into a linearized plasmid, and the desired plasmid fragment is recovered and purified by gel electrophoresis. The restriction method is referred to the instructions of the corresponding endonuclease, and the gel recovery method is the same as above;

[0101] (3) Use the recombinase to connect the target gene with homology arms in step (1) and the linearized plasmid in step (2) using the ligase NEBuilder ® HiFi DNA Assembly Master Mix E2621S was used for homologous recombination, and the successfully recombined vector was propagated by Escherichia coli. Then, the plasmid was extracted and verified and stored using QIAGEN Plasmid Midi Kits (12143) purification kit according to the instructions.

[0102] For subsequent construction CYP6CW1-F11 Take transgenic fruit flies as an example. The plasmid obtained is as follows Figure 2 shown.

[0103] Example 2 Preparation of transgenic fruit flies

[0104] The steps for preparing transgenic fruit flies are as follows:

[0105] 1. Hybridize a fruit fly with PhiC31 integrase on chromosome I with a fruit fly with attP characteristic sequence on chromosome II to obtain a P0 generation fruit fly containing both PhiC31 integrase and attP characteristic sequence ["y1w67c23; PattP40 25C6", "1; 2']. CYP6CW1 The target genes of different mutants were connected to the plasmid vector pJFRC28-10XUAS-IVS-GFP-p10 (Addgene 36431) to obtain the pJFRC28-10XUAS-IVS-GFP-p10-CYP6CW1 plasmid. The pJFRC28-10XUAS-IVS-GFP-p10-CYP6CW1 plasmid was microinjected into Drosophila embryos with the genotype ["y1w67c23;P attP40 25C6","1;2']. Under the action of PhiC31 integrase, the attB sequence on the plasmid specifically recognized the attP sequence in Drosophila, and the target gene was inserted into Drosophila chromosome II in a single copy. The P1 generation of Drosophila with successful transgenic results (UAS-vA-CYP6CW1) will have red compound eyes.

[0106] 2. The genetic background of the fruit fly of the present invention is that the genome does not contain PhiC31 integrase and the corpus luteum is removed. Therefore, the PhiC31 integrase needs to be removed by hybridization.

[0107] First, the phenotype of yellow-bodied red fluorescent eyes was selected from the P1 generation of fruit flies that were injected with the plasmid and successfully ecloded. Then, a single pair of crosses were performed with fruit flies of the genotype w

[1118] to obtain the F1 generation. Male adults with yellow-bodied red fluorescent eyes (mini-white) were selected from the F1 generation and crossed with virgin females of the genotype Bc / Cy (Bc / CyO) to obtain the F2 generation. DNA molecular detection was used to screen out the F2 generation with red eyes and the integration of the target gene. The final genotype was UAS-target gene / CyO curled-wing individuals (UAS-vA-CYP6CW1 / CyO). By self-pollination of UAS-target gene / CyO, fruit flies with straight-winged red fluorescent eyes were selected to obtain homozygous UAS- CYP6CW1 F3 generation (including 8 types CYP6CW1 Mutant type of the gene, UAS-vA-CYP6CW1 / UAS-vA-CYP6CW1).

[0108] Continue to cross with fruit flies of genotype: [Sp / CyO; TM2 / TM6B] to obtain the F4 generation, and breed the red-eyed, curled-winged, black-bodied males [UAS- CYP6CW1 / CyO; TM2 / TM6B] were crossed with virgin females [Sp / CyO; Tub-GAL4, Tub-GAL80ts] to obtain short and thick pupae with red eyes, curled wings and abnormal shoulder hair phenotype [UAS- CYP6CW1 / CyO; Tub-GAL4, Tub-GAL80ts / TM6B] strain F5 generation.

[0109] Finally, the balancer was removed by self-pollination, and the red-eyed, flat-winged, and side-shoulder hairs were obtained with a normal genotype of [UAS- CYP6CW1 / UAS- CYP6CW1; Tub-GAL4, Tub GAL80ts / Tub-GAL4, Tub-GAL80ts] strain F6 generation. This strain is overexpressed CYP6CW1 The transgenic homozygous and stably inherited temperature-controlled strain (including its different variants) does not need to be hybridized with the Gal4 strain. Under the condition of 37°C heat shock, gal4 is highly expressed in this strain; under the normal feeding condition of 25°C, gal4 is normally expressed; under the slightly low temperature feeding condition of 22°C, gal4 is lowly expressed; under the low temperature feeding condition of 18°C, gal4 is not expressed. This strain is cultured and passaged in an 18°C ​​incubator to prevent GAL4-mediated UAS transgenic transcriptional activation. This strain is the final tool fruit fly in the present invention, and its specific preparation and screening scheme refers to Figure 3 .

[0110] Finally, 8 homozygous transgenic fruit flies were screened, and their genotypes were: [UAS- CYP6CW1-F11 / UAS-CYP6CW1-F11; Tub-GAL4, Tub-GAL80ts / Tub-GAL4, Tub-GAL80ts], referred to as F11 CYP6CW 1 Wild type (T110+ V371+S414); [UAS- CYP6CW1-B1 / UAS-CYP6CW 1-B1; Tub-GAL4, Tub-GAL80ts / Tub-GAL4, Tub-GAL80ts], referred to as B1 CYP6CW 1 mutant (I110); [UAS- CYP6CW1-B2 / UAS- CYP6CW 1-B2; Tub-GAL4, Tub-GAL80ts / Tub-GAL4, Tub-GAL80ts], referred to as B2 CYP6CW 1 mutant (F414); [UAS- CYP6CW1-B3 / UAS-CYP6CW 1-B3; Tub-GAL4, Tub-GAL80ts / Tub-GAL4, Tub-GAL80ts], referred to as B3 CYP6CW 1 mutant (I110+F414); [UAS- CYP6CW1-B4 / UAS-CYP6CW 1-B4; Tub-GAL4, Tub-GAL80ts / Tub-GAL4, Tub-GAL80ts], referred to as B4 CYP6CW 1 mutant (I110+A371+F414); [UAS- CYP6CW1-B5 / UAS-CYP6CW 1-B5; Tub-GAL4, Tub-GAL80ts / Tub-GAL4, Tub-GAL80ts], referred to as B5 CYP6CW 1 mutant (I110+ A371); [UAS- CYP6CW1-B6 / UAS-CYP6CW 1-B6; Tub-GAL4, Tub-GAL80ts / Tub-GAL4, Tub-GAL80ts], referred to as B6 CYP6CW 1 mutant (A371+F414); [UAS- CYP6CW1-S1 / UAS-CYP6CW 1-S1; Tub-GAL4, Tub-GAL80ts / Tub-GAL4, Tub-GAL80ts], referred to as S1 CYP6CW 1 mutant (A371).

[0111] Example 3: Expression of target gene by Gla4 / UAS binary expression system

[0112] [UAS-CYP6CW1 / UAS- CYP6CW1; Tub-GAL4, Tub GAL80ts / Tub-GAL4, Tub-GAL80ts] strains were used as experimental groups, [Sp / CyO; Tub-GAL4, Tub-GAL80ts] and [UAS-GFP / UAS-GFP ; The experimental group contained the complete Drosophila Gla4 / UAS binary expression drive system, and its working principle is as follows: Figure 4 As shown, based on the TARGET GAL4 / UAS system, the temperature-sensitive GAL80 protein (GAL80ts) is inhibited at 30°C, which makes it possible to experimentally drive Gla4-driven CYP6CW1 High gene expression. [UAS- GFP / UAS- GFP ; Tub-GAL4, Tub GAL80ts / Tub-GAL4, Tub-GAL80ts] control strains drive high expression of the GFP gene under 30°C heat shock conditions, but the protein theoretically does not metabolize compounds; the other control strain [Sp / CyO; Tub-GAL4, Tub-GAL80ts] does not have a Gla4 / UAS binary expression drive system. In the present invention, fluorescence quantitative PCR and RT-PCR full-length amplification were used to determine the experimental group and the two control groups. CYP6CW1 Effects on gene expression.

[0113] 1. Fluorescence quantitative PCR identification CYP6CW1 Gene expression

[0114] (1) First, refer to the literature (Zhang YX, Yang YX, Sun HH, Liu. 2016. Metabolicimidacloprid resistance in the brown planthopper, Nilaparvata lugens, relies on multiple P450 enzymes. Insect biochemistry and molecular biology, 79: 50-56) CYP6CW1 The primer sequences for qPCR of the gene, the Drosophila internal reference gene selected the ribosomal protein L11 gene (RPL11) (GenBank: NM_001299685.1), and the primer sequences are:

[0115] q-CYP6CW1 -F:5'-CCTTCCTACCACCAGGATCGATC-3' (SEQ ID NO:13)

[0116] q- CYP6CW1 -R:5'-CCGTTAGACTGGCCAGGCTGCTCC-3' (SEQ ID NO:14)

[0117] q- RPL11 -F:5'-TCTGCACATCCGCAAACTCT-3' (SEQ ID NO:15)

[0118] q- RPL11 -R:5'-CGATCTTCTCGTTACGGCGA-3' (SEQ ID NO:16)

[0119] (2) The [UAS-CYP6CW1 / UAS-CYP6CW1; Tub-GAL4, Tub GAL80ts / Tub-GAL4, Tub-GAL80ts] strain of fruit flies was used as the treatment, and the [Sp / CyO; Tub-GAL4, Tub-GAL80ts] and [UAS-GFP / UAS-GFP; Tub-GAL4, Tub GAL80ts / Tub-GAL4, Tub-GAL80ts] strains were used as the control. RNA was extracted from fruit flies that were heat-shocked at 30°C for 4 hours one day after eclosion using the Trizol kit (Invitrogen). Six fruit flies were taken from each treatment, and four biological replicates were set up. The total amount of RNA was uniformly set to 500 ng. The synthesized cDNA was then diluted to 500 ng and stored at -20°C for later use. The specific operation steps were referred to the instruction manual of the Takara PrimeScriptTMRT reagent Kit with gDNA Eraser (Perfect RealTime)cDNA synthesis kit.

[0120] (3) The reaction system of qPCR was 20uL, with 1uL template added. In addition, it contained 0.4uL of upstream and downstream specific primers with a concentration of 10uM, 10uL of TB Premix Ex Taq (Tli RNaseH Plus), 0.4uL of ROX ReferenceDye Ⅱ, and 7.8μluL of ddH20. The reaction process of qPCR adopted the following procedure: pre-denaturation at 95℃ for 30 s, and the cycle reaction was denaturation at 95℃ for 5s, annealing and extension at 60℃ for 34s, for a total of 40 cycles. The kit used for qPCR was TB Green Premix Ex Taq (Takara, Tli RNaseH Plus), and the instrument used was Applied Biosystems 7500 Real-Time PCR System.

[0121] (4) Comparison Methods The relative mRNA expression of the target gene was analyzed. The expression level of each gene in this study was expressed as the mean ± standard deviation (SE) of the relative expression, and the significance test was performed using GraphPad Prism 6.0 software.

[0122] The results are as follows Figure 5 As shown, in the present invention, the homozygous strain of Gal4-driven tool fruit flies CYP6CW1 The expression level increased significantly, and the constructed CYP6CW1 In each mutant fruit fly CYP6CW1 There was no significant difference in gene expression.

[0123] 2. RT-PCR Identification CYP6CW1 In each mutant fruit fly CYP6CW1 Full-length gene amplification

[0124] (1) RT-PCR amplification of the [UAS-CYP6CW1 / UAS-CYP6CW1;Tub-GAL4,Tub GAL80ts / Tub-GAL4,Tub-GAL80ts] strain of Drosophila CYP6CW1 Full-length gene sequence, detection CYP6CW1 Whether the gene is expressed completely and correctly. Negative control strain: [Sp / CyO; Tub-GAL4, Tub-GAL80ts], experimental group: [UAS-CYP6CW1 / UAS-CYP6CW1; Tub-GAL4, Tub GAL80ts / Tub-GAL4, Tub-GAL80ts] amplification CYP6CW1Full-length gene sequence; positive control strain: [UAS-GFP / UAS-GFP; Tub-GAL4, Tub-GAL80ts / Tub-GAL4, Tub-GAL80ts], detect the open reading frame sequence of the GPF gene. The extraction of total RNA and the synthesis of cDNA of Drosophila refer to the previous section "Fluorescence quantitative PCR identification CYP6CW1 Gene expression".

[0125] (2) In fruit flies CYP6CW1 and GFP The full-length amplification primer sequences of the genes are:

[0126] CYP6CW1 - Full length F: 5'-ATGCTCGGGCTGATAGTGACAGG-3' (SEQ ID NO: 17)

[0127] CYP6CW1 -Full-length-R: 5'-CTATACTTTTCTTGGCTCGAAGTGCAGCC-3' (SEQ ID NO: 18)

[0128] GFP-full-length-F: 5'-atgtccaaaggtgaagaactg-3' (SEQ ID NO: 19)

[0129] GFP-full-length-R: 5'-ttacttgtagagctcatccatgc-3' (SEQ ID NO:20)

[0130] Results CYP6CW1 The full-length sequence of the gene is 1623 bp, and the full-length sequence of GFP is 717 bp.

[0131] Example 4: Determination of sensitivity of transgenic fruit flies to pesticides and application in screening of compounds

[0132] 1. Determination of sensitivity of transgenic fruit flies to ethiprole

[0133] (1) Transgenic [UAS- CYP6CW1 / UAS- CYP6CW1 ;Tub-GAL4,Tub GAL80ts / Tub-GAL4,Tub-GAL80ts] strains were placed in a fruit fly food tube at a ratio of 1 to 1.5:1 to mate and lay eggs; similarly, the negative control strain: [Sp / CyO; Tub-GAL4, Tub-GAL80ts] strains were placed in a fruit fly egg-laying plate at a ratio of 1 to 1.5:1 to mate and lay eggs; the positive control strain: [UAS- GFP / UAS- GFPMale and female fruit flies of the [Tub-GAL4, Tub-GAL80ts / Tub-GAL4, Tub-GAL80ts] strain were placed in a fruit fly egg-laying plate at a ratio of 1 to 1.5:1 to mate and lay eggs.

[0134] (2) Drosophila culture tube (10 cm high, 2.5 cm in diameter). The Drosophila food formula is described using 100 mL as an example: agar powder (2% X100 = 2 g), sucrose (3% X100 = 3 g), fruit juice (40% X100 = 40 mL), and water (make up to 100 mL). Pour the melted agar matrix evenly into the plate in a microwave oven. After about 2 mm, the matrix solidifies and the prepared Drosophila can be inoculated.

[0135] (3) Remove the fruit flies 24 hours after egg laying. After about 15-20 days, when the fruit flies in the tube have emerged as adults, remove the adults and place them in a new fruit fly food tube for later use. Heat shock the one-day-old adults for 4 hours (30°C) before the bioassay. After the heat shock, select the females on the fruit fly coma plate for toxicity determination. Each insecticide concentration has 5 concentrations, 4 replicates per concentration, and 15 test insects per tube per replicate. Check the mortality rate every 24 hours, and the ethiprole toxicity test is checked up to 48 hours. Compare the overexpression by mortality rate. CYP6CW1 Changes in resistance to ethidium bromide in transgenic fruit flies with different gene variants; [Sp / CyO; Tub-GAL4, Tub-GAL80ts] strains and [UAS-GFP / UAS-GFP;Tub-GAL4,Tub-GAL80ts / Tub-GAL4,Tub-GAL80ts] were used as controls.

[0136] (4) The screening of other compounds and new compounds was also carried out according to the above method.

[0137] The results are shown in Table 1. CYP6CW1 The resistance of transgenic fruit fly homozygous strains with different gene mutations to ethidium is different, showing a certain pattern: that is, the strains without T110I, V371A or S414F mutations CYP6CW1 The gene was very sensitive to ethidium bromide, with almost no difference in sensitivity between the control GAL4 strain and the GFP overexpression strain; however, mutants with single-point mutations T110I (group B1), V371A (group S1) or S414F (group B2) showed different degrees of resistance to ethidium bromide, among which the mutants with single-point mutation S414F showed different levels of resistance to ethidium bromide. CYP6CW1The transgenic fruit flies with gene mutations were more resistant than those with other single point mutations. Different mutation combinations showed different levels of resistance to ethidium bromide. The transgenic fruit flies with the combination of S414F point mutation (such as B3 and B6 groups) were more resistant to ethidium bromide than those without S414F mutation (such as B5 group). The transgenic fruit flies with the combination of T110I, V371A and S414F mutations (B4 group) were more resistant to ethidium bromide than those without S414F mutation (such as B5 group). CYP6CW1 The transgenic fruit flies had the highest resistance to ethidium bromide (178 times), indicating that the three single-point mutations all contributed to the resistance to ethidium bromide, among which the S414F mutation contributed the most. When the three mutations occurred simultaneously, CYP6CW1 The gene has the strongest resistance to ethiprole. The resistance level of the brown planthopper population screened by ethiprole is 10 times that of the population before screening, and the S414F mutation frequency increased from 50% to 95%, which is completely consistent with the results of transgenic fruit flies, indicating that the tool fruit flies in the present invention can be fully used to determine the resistance of brown planthoppers. CYP6CW1 The relationship between gene mutation and insecticide resistance is accurate.

[0138] Table 1 Overexpression CYP6CW1 Toxicity test of transgenic fruit flies with different mutation combinations to ethiprole

[0139]

[0140] RR a : Resistance ratio = LC of each transgenic line 50 LC of the / [Sp / CyO; Tub-GAL4, Tub-GAL80ts] strain 50

[0141] RR b : Resistance ratio = LC of each mutant strain 50 (B1, S1, B2, B3, B5, B6, B4) / LC of wild-type strain F11 50

[0142] 2. Other pesticides and CYP6CW1 Gene mutation association

[0143] In addition, the tool fruit flies of the present invention were used to detect other CYP6CW1 Pesticides associated with gene mutations include imidacloprid and cycloheximide. Figure 6 As shown, overexpression CYP6CW1Fruit flies with different genetic mutants showed different sensitivities to imidacloprid and cycloheximidine. Mutants containing the S414F mutation also showed a low level of resistance to imidacloprid and cycloheximidine. The combination of T110I, V371A and S414F mutations had a higher tolerance to high concentrations of imidacloprid and cycloheximidine than other single-point mutations or other mutation combinations. This indicates that transgenic fruit flies with T110I, V371A and S414F mutations not only have a greatly increased level of resistance to ethioprin (178 times), but may also have a slightly increased resistance to other neonicotinoid insecticides. Therefore, when selecting pesticides for the control of brown planthoppers in the field, ethioprin should be avoided from being mixed with neonicotinoids such as imidacloprid and cycloheximidine. In addition, if overexpression CYP6CW1 Drosophila with T110I, V371A and S414F mutations CYP6CW1 Genetically wild-type fruit flies have increased sensitivity to a certain compound, suggesting CYP6CW1 The combination of gene T110I, V371A and S414F mutations in brown planthoppers does not contribute much to the detoxification of this agent, and can be used to control brown planthoppers that are resistant to the above-mentioned agents, reducing the occurrence of brown planthoppers in the population. CYP6CW1 The frequency of gene T110I, V371A and S414F mutations is reduced, thereby reducing the population's resistance to ethidium and neonicotinoids, achieving the purpose of resistance management. CYP6CW1 The toxicity of various pesticides, especially new pesticides, is tested on genetically wild-type fruit flies and various mutant fruit flies, and agents are screened for the control of brown planthoppers that are resistant to ethidium and neonicotinoid insecticides.

[0144] Example 5: Identification of the metabolic efficiency of ethiprole in transgenic fruit flies

[0145] In addition, the present invention detected the metabolic effects of Drosophila overexpressing different mutants of the CYP6CW1 gene on insecticides such as ethiprole, thereby further proving that the combination of T110I, V371A and S414F mutations increases CYP6CW1 The gene has the ability to metabolize ethidium bromide, resulting in transgenic fruit flies showing a high level of resistance to ethidium bromide.

[0146] (1) Extraction of microsomal proteins: Female transgenic flies of the control transgenic strain GFP, the wild-type strain F11 (T110 / V371 / S414) of the CYP6CW1 gene, and the three mutant combination strains B4 (I110 / A371 / F414) were collected one day after eclosion, with 100 females from each population. The protease solution was extracted after heat shock at 30°C for 4 hours. 100 females from each population were placed in a 10mL glass grinding tube, and 4mL of lysis buffer (0.1 M phosphate buffer pH 7.4, 1.0 mM EDTA, 150mMNaCl, 10% Glycerol and 0.5 mM PMSF) was added for grinding, and ultrasonication was performed for 10s. The homogenate was centrifuged at 8000×g for 10min at 4°C, and the supernatant was taken. Then, it was ultracentrifuged at 100,000×g for 90min at 4°C. The supernatant was discarded and the microsomal pellet was dissolved in suspension buffer (0.1M phosphate buffer pH 7.4, 20% Glycerol buffer, 1mM EDTA, 0.1mM DTT, 1mM PMSF).

[0147] (2) PNOD activity assay:

[0148] P450 activity was measured by determining p-nitroanisole (PNOD) activity using p-nitroanisole (p-NA) as a substrate. Fifteen transgenic flies per line were homogenized on ice with 1 ml of buffer (0.1 M PBS, pH 7.5, 1 mM DTT, 1 mM PTU, 1 mM PMSF, 1 mM EDTA, and 10% glycerol) and then centrifuged at 14,000 g for 20 min at 4°C. The supernatant was collected and used for P450 activity assay. The enzyme reaction system included 5-10 μL of enzyme solution, phosphate buffer (0.1 M, pH 7.5), a final concentration of 0.2 mM p-NA, and 9.6 mM NADPH in a total reaction volume of 100 uL and incubated at 30°C for 30 min. The production of p-nitrophenol (p-NP) was determined by measuring the absorbance at 405 nm (OD405) of each well in a full-wavelength microplate (Biotek) and comparing it with a p-NP standard curve. The total protein content of the enzyme solution was determined using the method of Bradford (1976) and the absorbance of the samples was measured at 595 nm by a microplate reader.

[0149] (3) Metabolic determination of ethiprole and imidacloprid:

[0150] Ethiopromide or imidacloprid was dissolved in acetone to prepare a 100 μM solution. The in vitro enzyme metabolic reaction system contained: 4 μM ethipromide or 4 μM imidacloprid, 2 mg microsomal protein, 0.25 mM MgCl2, 1 mM NADPH, and a total volume of 700 μL. After incubation at 30°C for 2 hours, 700 μl acetonitrile or acetone was added to stop the reaction, shaken for 20 minutes, and finally centrifuged at 16000×g for 10 min to precipitate microsomal protein. The supernatant was filtered with a 0.22 μM filter membrane for HPLC analysis. The experiment was repeated three times. The peak area of ​​the residual ethipromide or imidacloprid in the in vitro enzyme metabolic reaction system was used to compare the metabolic capacity of different transgenic lines for ethipromide or imidacloprid.

[0151] Chromatographic conditions: Eclipse Plus C18 column (2.1 mm × 50 mm, 1.8 μm); flow rate of 0.3 ml / min; column temperature of 40 °C, injection volume of 1 μL; mobile phase A was 0.1% formic acid water, B was methanol, gradient elution, elution time was 5 min. Figure 7 The chromatographic peaks are ethidium and imidacloprid respectively.

[0152] Table 2 Mobile phase parameters

[0153]

[0154] Mass spectrometry conditions: electrospray ionization source (ESI + ); multiple reaction monitoring mode (MRM); drying gas temperature was 320°C, drying gas flow rate was 6 L / min, nebulizer gas pressure was 50 psi, sheath gas temperature was 350°C, sheath gas flow rate was 11 L / min, capillary voltage was 3500 V, nozzle voltage was 500 V, the qualitative ion pair of ethiprole was 395>250 (m / z), fragmentor voltage was 120 V, and collision energy was 30 V; the quantitative ion pair was 395>330.6 (m / z), fragmentor voltage was 120 V, and collision energy was 10 V. The qualitative ion pair of imidacloprid was 256>209 (m / z), fragmentor voltage was 90 V, and collision energy was 10 V; the quantitative ion pair was 256>175.1 (m / z), fragmentor voltage was 90 V, and collision energy was 30 V.

[0155] (4) The results showed that the activity of transgenic P450 enzymes of each strain was measured using p-nitroanisole (PNA) as a substrate, and the GFP-transgenic strain was used as a negative control. The results are shown in Table 3. Among them, the specific activities of F11 and B4 were 2.09 times and 2.18 times higher than those of the GFP strain, respectively. There was no significant difference in the PNOD activity between F11 and B4. This proves that the combination of T110I, V371A and S414F mutations did not change the catalytic activity of CYP6CW1 for the model substrate p-nitroanisole (PNA).

[0156] Table 3 P450 enzyme activity determination results

[0157]

[0158] However, from Figure 8 It can be seen from the peak area of ​​ethiprole liquid chromatography that after the microsomal proteins of each transgenic strain metabolize ethiprole, the B4 strain metabolizes the most ethiprole, while the F11 strain and GFP metabolize the least, proving that the metabolic capacity of the CYP6CW1 mutants of the three mutation combinations for ethiprole is significantly increased compared with the wild-type mutant. The ethiprole metabolism experiment further fully proves that the transgenic fruit flies overexpressing different CYP6CW1 variants constructed by the present invention can be used to verify the insecticide resistance function of the CYP6CW1 variant carrying the S414F mutation.

[0159] In summary, the fruit fly constructed by the present invention can be used accurately and quickly for the determination of insecticide resistance and the screening of new chemical drugs.

[0160] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0161] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0162] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A CYP6CW1 protein mutant, characterized in that: The mutant is a mutant of SEQ ID NO: 1, and the mutant is included in SEQ ID NO:

1. 1) S414F mutation; 2) S414F and T110I mutations; 3) mutations of S414F and V371A; or, 4) mutations of S414F, T110I, and V371A, The amino acid sequence of the mutant is any one of SEQ ID NOs: 2, 5, 6, and 8.

2. A nucleic acid, characterized in that The nucleic acid encodes the CYP6CW1 protein mutant according to claim 1.

3. A biomaterial, characterized in that The biological material includes: (A) A vector comprising the nucleic acid of claim 2; (B) A cell comprising the vector described in (A).

4. A method for constructing a transgenic insect, characterized in that: The insect expresses the CYP6CW1 protein mutant according to claim 1.

5. The construction method according to claim 4, characterized in that The construction method comprises introducing the nucleic acid according to claim 2.

6. The construction method according to claim 4 or 5, characterized in that: The construction method also includes using the TARGET-GAL4 / UAS system and / or the PhiC31 site-directed recombinase system.

7. The construction method according to claim 6, characterized in that: The construction method comprises: 1) preparing a recombinant plasmid containing a nucleic acid of a CYP6CW1 protein mutant, injecting the recombinant plasmid into insect embryos, and obtaining transgenic insects after the embryos develop into adults; 2) Remove the PhiC31 integrase and corpus luteum from insects.

8. A method for screening insecticides, characterized in that: The transgenic insects are obtained by the construction method according to any one of claims 4 to 7, and the candidate substance is administered to the transgenic insects; and the mortality rate of the transgenic insects is detected.

9. The screening method according to claim 8, characterized in that The candidate substance capable of killing transgenic insects is a target insecticide, which has a killing effect on brown planthoppers that are resistant to other existing insecticides, or the target insecticide can reduce the resistance level of brown planthoppers to other existing insecticides, and the other existing insecticides include ethiprole.

10. Use of the CYP6CW1 protein mutant according to claim 1, the nucleic acid according to claim 2, the biological material according to claim 3, or the transgenic insect obtained by the construction method according to any one of claims 4 to 7. The applications described include: (1) Study the application of mutation in insect resistance; (2) Application in screening of pesticides.

11. The use according to claim 10, characterized in that The candidate substance capable of killing transgenic insects is a target insecticide, which has a killing effect on brown planthoppers that are resistant to other existing insecticides, or the target insecticide can reduce the resistance level of brown planthoppers to other existing insecticides, and the other existing insecticides include ethiprole.

Images